Construction method of a TRIM22 humanized animal model and application thereof

Abstract

The application discloses a construction method of a TRIM22 humanized animal model and application thereof, relates to the field of animal genetic engineering, and provides the construction method of the TRIM22 humanized mouse model, wherein a human gene coding TRIM22 is inserted into a specific site of a mouse genome in a manner of gene modification, the prepared TRIM22 humanized mouse model has a functional gene of human, and can be used for screening and evaluating human TRIM22 drugs, and solves the problem that TRIM22 drugs screened on mice are not completely suitable for human due to species differences of rodents. In the method, steps of sgRNA and vector preparation are optimized to the maximum, and the success rate of the animal model is ensured.

Description

Technical Field

[0001] This invention relates to the field of animal genetic engineering, and more specifically, to a method for constructing a TRIM22 humanized animal model and its application. Background Technology

[0002] The innate immune system of mammals provides the first line of defense for the host, protecting it from pathogen invasion. Pathogen-associated molecular patterns (PAMPs) can activate the host's immune defense response after being recognized by the host's pattern recognition receptors (PRRs). Viral infection is a major threat to human health. During viral infection, viral nucleic acid molecules can act as PAMPs and can be recognized by various PRR families, including toll-like receptors (TLRs) and cytoplasmic DNA receptors. Viral nucleic acids trigger the secretion of downstream type I interferon, thereby activating interferon-mediated antiviral activity.

[0003] TRIM22, also known as the 50kDa stimulatory trans-acting factor (Staf50), was first discovered in a cDNA library screening of lymphoma cells. It is a gene whose transcription is upregulated upon IFN-α / β stimulation. TRIM22 is expressed in IFN-α-stimulated peripheral blood mononuclear cells (PBMCs) and is also expressed in various human tissues. The 5' end of the TRIM22 gene contains two IFN-stimulatory response elements that can bind to IFN regulator 1 (IRF-1), playing a crucial regulatory role in sensing type I and type II IFN stimulation signals and in TRIM22 expression. Besides interferon stimulation, TRIM22 expression is regulated by various viral antigens. For example, TRIM22 expression is upregulated after infection with rubella virus and Epstein-Barr virus (EBV) in response to these viral infections.

[0004] TRIM22 contains three intracellular domains: a RING domain with E3 ubiquitin ligase activity, a B domain (B-box 2), and a PRYSPRY domain (B30.2). Within the RING domain, cysteine-15 and cysteine-18 constitute the catalytic site mediating ubiquitin transfer to target proteins. Furthermore, the RING domain promotes the autoubiquitination pathway, leading to proteasome degradation. The B domain, located downstream of the RING domain, is likely essential for TRIM22 nuclear localization. The PRYSPRY domain, composed of three highly variable regions, regulates the formation of the TRIM5α heterodimer, thereby exerting its antiviral effect. TRIM22 inhibits the replication of various viruses, including human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), influenza A virus, encephalocarditis virus, and herpes simplex virus. Meanwhile, TRIM22 single nucleotide polymorphisms (SNPs) play an antiviral role in various viral infections, including measles, HBV, HCV, and HIV. The antiviral function of TRIM22 also depends on its subcellular localization; it has been reported to exist in both the cytoplasm and nucleus. Therefore, TRIM22 inhibits viruses that replicate using both the cytoplasm and nucleus.

[0005] In 2019, SARS-CoV-2 emerged as a novel pathogen, leading to the COVID-19 pandemic. SARS-CoV-2 can cause upper and lower respiratory tract infections, typically associated with fever, cough, and loss of smell and taste. However, some patients experience more severe illness, exhibiting systemic inflammation, tissue damage, acute respiratory distress syndrome (ARDS), thromboembolic complications, cardiac injury, and cytokine storm. Given the widespread expression of the TRIM22 protein in epithelial cells, it has potential applications in the treatment of SARS-CoV-2. A recent study showed that TRIM22 protein expression was significantly upregulated in lung epithelial cells infected with SARS-CoV-2 in vitro, suggesting that TRIM22 may be an important effector protein against SARS-CoV-2 infection. During SARS-CoV-2 infection, TRIM22 acts as an important antiviral effector protein, directly inhibiting the envelope glycoproteins and genome of SARS-CoV-2. Furthermore, TRIM22 activates innate antiviral immune responses and participates in antibody-mediated SARS-CoV-2 clearance.

[0006] Therefore, there is an urgent need for a humanized animal model of TRIM22 that can be used for research on antiviral drugs and the mechanism of action of TRIM22.

[0007] In view of this, the present invention is proposed. Summary of the Invention

[0008] The purpose of this invention is to provide a method for constructing a TRIM22 humanized animal model and its application.

[0009] This invention is implemented as follows:

[0010] In a first aspect, embodiments of the present invention provide a method for constructing a humanized TRIM22 animal model, comprising: inserting a human TRIM22 gene sequence into a safe site in a mouse.

[0011] Secondly, embodiments of the present invention provide a method for obtaining a TRIM22 humanized animal model, which includes: breeding the TRIM22 humanized animal model obtained by the construction method described in the foregoing embodiments.

[0012] Thirdly, the embodiments of the present invention provide the application of animal models constructed by the construction method described in the foregoing embodiments or animal models obtained by the method for obtaining humanized TRIM22 animal models described in the foregoing embodiments in screening antibody drugs or small molecule drugs targeting TRIM22.

[0013] The present invention has the following beneficial effects:

[0014] This invention provides a method for constructing a TRIM22 humanized mouse model. Through gene modification, the human gene encoding TRIM22 is inserted into a specific site in the mouse genome. The resulting TRIM22 humanized mouse model possesses human functional genes and can be used to screen and evaluate human TRIM22 drugs. This solves the problem that TRIM22 drugs screened in mice due to species differences in rodents are not entirely suitable for humans.

[0015] This invention provides an optimized method for preparing human TRIM22 gene animal models. This method optimizes steps such as sgRNA and vector preparation to the greatest extent, ensuring the success rate of animal models. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1Agarose gel electrophoresis images of F0 mice for PCR identification; where A shows the identification results of 5' arm, 3' arm and tandem identification of F0 mice numbered 1#-21#; B shows the identification results of 5' arm, 3' arm and tandem identification of F0 mice numbered #22; C shows the legend of TRANS 2K PLUSII bands (marker);

[0018] Figure 2 Agarose gel electrophoresis images of F1 mice for PCR identification; where A shows the identification results of the 5' and 3' arms of F1 mice numbered 23# to 29#; B shows the identification of wild-type genes in F1 mice numbered 23# to 29#; and C shows the tandem detection of F1 mice numbered 23# to 29#. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0020] On one hand, embodiments of the present invention provide a method for constructing a humanized TRIM22 animal model, which includes: inserting a human TRIM22 gene sequence into a safe site in a mouse.

[0021] In some implementations, the construction method includes the following steps:

[0022] A mixture of a targeting vector, sgRNA targeting a safe site, and Cas9 is injected into fertilized oocytes and transplanted into pseudopregnant animals to obtain F0 generation positive animals; wherein the targeting vector contains a human TRIM22 gene sequence, and the Cas9 includes at least one of Cas9 mRNA and Cas9 protein;

[0023] F0 generation animals were crossed with wild-type animals to obtain F1 generation positive heterozygous animals.

[0024] In some embodiments, the construction method further includes: obtaining a stably inherited TRIM22 humanized animal model by self-crossing F1 generation positive heterozygous animals.

[0025] In some embodiments, the safe site is the Rosa26 site. Rosa26 is located on mouse chromosome 6 and is a safe site for the insertion of foreign genes. Foreign genes integrated into this site can be expressed stably and efficiently without disrupting the function of endogenous mouse genes. The TRIM22 humanized mouse model provides a more affordable and readily available animal evaluation system for preclinical screening of human TRIM22 antibody drugs.

[0026] In some embodiments, the target sequence of the sgRNA is selected from the sequence shown in SEQ ID NO: 2. This results in higher cleavage efficiency compared to other target sequences.

[0027] SEQ ID NO:2 (5'~3') is as follows:

[0028] TCCTGCCATGTGGTCTCTTGTTTGCTACTAACTTCCCATGGCTTAAATGGCATGGCTTTTTGCCTTCTAAGGGCAGCTGCTGAGATTTGCAGCCT.

[0029] In some embodiments, the sgRNA comprises any one or more sequences as shown in SEQ ID NO: 3-4.

[0030] In some embodiments, the targeting vector further includes a 3' homologous arm and a 5' homologous arm at the safety site; the 5' homologous arm and the 3' homologous arm are located at the 5' end and 3' end of the Rosa 26 site, respectively.

[0031] In some embodiments, the nucleotide sequence of the targeting vector is shown in SEQ ID NO:5.

[0032] SEQ ID NO:5 (5'~3') are as follows:

[0033]

[0034] In some embodiments, the human TRIM22 gene sequence is shown in SEQ ID NO:1.

[0035] On the other hand, embodiments of the present invention provide a method for obtaining a TRIM22 humanized animal model, which includes: breeding the TRIM22 humanized animal model constructed by the construction method described in any of the foregoing embodiments.

[0036] On the other hand, embodiments of the present invention provide the application of animal models constructed by the construction methods described in any of the foregoing embodiments or animal models obtained by the methods for obtaining humanized TRIM22 animal models described in any of the foregoing embodiments in screening antibody drugs or small molecule drugs targeting TRIM22.

[0037] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0038] Example 1

[0039] 1. Construction of TRIM22 humanized targeting homologous DNA donors

[0040] Homologous recombination was used to insert a gene fragment from the coding region of the human TRIM22 gene into the Rosa26 site in C57BL / 6 mice. Rosa26 is located on mouse chromosome 6 and is a safe site for the insertion of foreign genes. Foreign genes integrated into this site can be expressed stably and efficiently without disrupting the function of endogenous genes. The TRIM22 gene sequence (SEQ ID NO:1) is as follows:

[0041]

[0042] 2. TRIM22 humanized mouse sgRNA design

[0043] The approximate region of the sgRNA was determined based on the replacement fragment. Using sgRNA evaluation software, sequences with the lowest off-target rates were selected for the target fragment; the following sequences were chosen as candidate sgRNAs (see Table 1). An sgRNA expression vector was designed and constructed:

[0044] Table 1. sgRNA sequences targeting Rosa26 site

[0045]

[0046] The target sequence of sgRNA is SEQ ID No:2.

[0047] sgRNA transcription preparation method: Using the PrimerStar or PrimerStar Max system, sgRNA-F and sgRNA-R were used as primers. A correctly sequenced puc57-sgRNA plasmid (1:30 dilution) was used as a template for PCR. The PCR product was purified to prepare the sgRNA transcription template. sgRNA transcription was performed using the T7-ShortScript in vitro transcription kit (AM1354).

[0048] 3. Establishment of TRIM22 humanized mouse model

[0049] The designed sgRNA and TRIM22 humanized targeting homologous DNA donor (sequence shown in SEQ ID No:5) were mixed with Cas9 protein and injected into 0.5-day-old mouse fertilized eggs, which were then transplanted into 0.5-day-old pseudopregnant female mice. After the mice were born, the targeted mice (F0) were selected by genetic identification.

[0050] Genotyping of humanized F0 generation mice: Two pairs of primers were used to perform PCR on the tail genomic DNA of the obtained F0 mice after target insertion. Primers Rosa26-S8-1200-5tF1 / CAG-tR1 were located outside the 5' end of the Rosa26 locus and inside the human fragment of the targeting vector, respectively. If this primer pair amplified and produced PCR products, it indicated that the target vector had been effectively inserted at the 5' end of the Rosa26 locus in the mouse genome. BGH-pA-tF1 / Rosa26-S8-1200-3tR1 were located inside the human fragment of the targeting vector and outside the 3' end of the Rosa26 locus, respectively. If this primer pair amplified and produced PCR products, it indicated that the target vector had been effectively inserted at the 3' end of the Rosa26 locus in the mouse genome.

[0051] Table 2. F0 and F1 tests to identify correctly inserted primers for TRIM22

[0052]

[0053] Note: KI is the target genotype; WT is the wild type; KI / KI is homozygous; KI / WT is heterozygous.

[0054] The PCR reaction system and reaction conditions are shown in Tables 3 and 4:

[0055] Table 3. PCR reaction system

[0056] 2×Taq Master Mix, Dye Plus 12.5 \ ddH2O 9.5 \ Primer A (10 pmol / μl) 1 10μM Primer B (10 pmol / μl) 1 10μM Template (≈100ng / μl) 1 ~4.4ug

[0057] Table 4. PCR Reaction Conditions

[0058]

[0059]

[0060] Mouse clones that were positive for PCR at both ends were sequenced for verification. Clones with the targeting vector inserted into the Rosa26 site of the mouse genome and correctly sequenced were identified as positive F0 mice.

[0061] Table 5. Sequencing primers

[0062]

[0063] 4. Results

[0064] 4.1 F0 Identification Results

[0065] Three positive F0 mice were obtained by targeting against a background of C57BL / 6JGpt mice. The hTRIM22 F0 mouse tail DNA identification results are as follows: Figure 1 The image shows electrophoresis results for identifying the 5' end of the 5' arm labeled with hTRIM22-KI-target and the 3' end of the 3' arm labeled with hTRIM22-KI-target. The WT control is C57BL / 6JGpt genomic DNA. N is the blank control, a control without template. M represents the TRANS 2KPLUS II bands: 8000bp, 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0066] Depend on Figure 1 As can be seen from A, mouse #17 did not undergo vector tandem and was used for subsequent breeding; mouse #11 was a tandem mouse and was euthanized, and not used for subsequent breeding. Figure 1 As can be seen from B, both the 5'arm and 3'arm of 22# were positive, and no vector tandem occurred, so subsequent breeding was carried out.

[0067] The human TRIM22 gene 5' and 3' of mice #17 and #22 were identified and sequenced positively, meeting the breeding requirements, indicating that these mice are F0 positive mice that have undergone correct gene recombination.

[0068] 4.2 F1 Assessment Results

[0069] F0 positive mice with C57BL / 6JGpt background were bred with C57BL / 6JGpt background mice to obtain the F1 generation. The hTRIM22 gene was identified in the tails of the F1 generation mice. The PCR results of the F1 generation mice are shown below. Figure 2 (Electrophoresis images of the 5' end labeled with hTRIM22-KI-target and the 3' end labeled with hTRIM22-KI-target; WT is wild-type mouse genomic DNA as template; N is blank control, no template control; P is positive control; M is TRANS 2K PLUS II bands: 8000bp\5000bp\3000bp\2000bp\1000bp\750bp\500bp\250bp\100bp).

[0070] Depend on Figure 2 It was found that the 5'arm and 3'arm of mice #24, #25, #27, and #28 were all positive. Wild-type genes were detected in all F1 generations numbered #23 to #29. Combined with the 5'arm and 3'arm identification results, mice #24, #25, #27, and #28 were heterozygous mice positive for the humanized hTRIM22 gene, indicating that these mice were positive for gene recombination correctly and without tandem gene insertion, meeting the breeding requirements. After large-scale propagation of the F1 generation, crossbreeding was performed to obtain homozygous humanized TRIM22 mice, abbreviated as B6-hTRIM22.

[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for constructing a TRIM22 humanized animal model, characterized in that, It includes: Insert the human TRIM22 gene sequence into a safe site in mice; The construction method includes: A mixture of a targeting vector, sgRNA targeting a safe site, and Cas9 is injected into fertilized oocytes and transplanted into pseudopregnant animals to obtain F0 generation positive animals; wherein, the targeting vector contains a human TRIM22 gene sequence and a CAG promoter, and the Cas9 includes at least one of Cas9 mRNA and Cas9 protein; F0 generation animals were crossed with wild-type animals to obtain F1 generation positive heterozygotes; The safe site is the Rosa26 site, and the target sequence of the sgRNA is shown in SEQ ID NO:

2.

2. The construction method according to claim 1, characterized in that, The construction method also includes: obtaining a stable genetic TRIM22 humanized animal model by self-crossing F1 generation positive heterozygous animals.

3. The construction method according to claim 1, characterized in that, The targeting vector also includes the 3' and 5' homologous arms of the Rosa 26 safety site.

4. The construction method according to claim 1, characterized in that, The nucleotide sequence of the targeting vector is shown in SEQ ID NO:

5.

5. The construction method according to any one of claims 1 to 4, characterized in that, The human TRIM22 gene sequence is shown in SEQ ID NO:

1.

6. A method for obtaining a humanized animal model of TRIM22, characterized in that, It includes: Breed the TRIM22 humanized animal model constructed by the construction method according to any one of claims 1 to 5.

7. The application of the animal model constructed by the method according to any one of claims 1 to 5 or the animal model obtained by the method for obtaining a humanized TRIM22 animal model according to claim 6 in screening antibody drugs or small molecule drugs targeting TRIM22.

Images