Use of an exosome in preparation of a drug for treating osteoarthritis

Abstract

This invention provides the application of exosomes in the preparation of drugs for treating osteoarthritis, wherein the exosomes are exosomes overexpressing miR-592. Rat adipose-derived mesenchymal stem cells (ADSCs) were isolated, transfected with miR-592 mimics, and exosomes overexpressing miR-592 were extracted. These miR-592-overexpressing exosomes were then injected into a rat knee osteoarthritis model, verifying that injection of miR-592-overexpressing exosomes promoted chondrocyte regeneration, indicating that exosomes overexpressing miR-592 can be used to prepare drugs for treating osteoarthritis.

Description

Technical Field

[0001] This invention belongs to the field of miRNA and exosomes, and relates to the application of exosomes in the preparation of drugs for treating osteoarthritis. Background Technology

[0002] Osteoarthritis (OA) is one of the most common joint diseases, also known as degenerative arthritis, hypertrophic osteoarthritis, degenerative joint disease, proliferative osteoarthritis, or osteoarthropathy. It is a common joint disease primarily affecting the articular cartilage and involving the entire joint tissue. It is prevalent in middle-aged and elderly people and is a leading cause of disability in the elderly. The etiology and pathogenesis are not fully understood, but its occurrence is related to patient age, obesity, inflammation, congenital joint deformities, trauma, and genetic factors, resulting from the combined effects of multiple factors.

[0003] The main pathological changes in osteoarthritis are degenerative changes and loss of cartilage, as well as reactive hyperplasia of bone at the joint margins and subchondral bone to form osteophytes, which lead to joint pain, stiffness, deformity and dysfunction.

[0004] Patients can undergo physical therapy, such as cryotherapy, heat therapy, acupuncture, and transcutaneous electrical nerve stimulation (TENS), to promote local blood circulation, reduce inflammation, and thus alleviate joint pain and improve joint function. Nonsteroidal anti-inflammatory drugs (NSAIDs) can also be used under the guidance of a doctor, such as diclofenac diethylamine emulsion, enteric-coated aspirin capsules, and ibuprofen sustained-release capsules, or prednisolone acetate injection and sodium hyaluronate injection. If the above treatments are ineffective or the condition worsens, surgical treatment, such as arthroscopic debridement or total joint replacement, may be considered.

[0005] Osteoarthritis remains a difficult disease for humans to overcome. Early intervention and avoiding overexertion play a crucial role in the prognosis of osteoarthritis. Summary of the Invention

[0006] The purpose of this invention is to provide the application of exosomes in the preparation of a drug for treating osteoarthritis.

[0007] The technical solution adopted in this invention is as follows:

[0008] The use of an exosome in the preparation of a medicament for treating osteoarthritis, wherein the exosome is an exosome overexpressing miR-592.

[0009] Preferably, the exosomes overexpressing miR-592 are derived from adipose-derived mesenchymal stem cells.

[0010] More preferably, the exosomes overexpressing miR-592 are obtained by separating adipose-derived mesenchymal stem cells (ADSCs), transfecting them with miR-592 mimics, and then extracting the exocrine bodies.

[0011] Preferably, the drug is administered to treat osteoarthritis by injection into the joint cavity.

[0012] More preferably, when the exosomes are used to treat osteoarthritis in a rat knee osteoarthritis model, the dosage is 1*10^9 exosomes per rat per dose, once a week, for a total of 4 doses.

[0013] Preferably, the exosomes overexpressing miR-592 can promote chondrocyte regeneration.

[0014] The beneficial effects of this invention are as follows:

[0015] This invention isolates rat adipose-derived mesenchymal stem cells (ADSCs), transfects them with miR-592 mimics, extracts exosomes overexpressing miR-592, and injects these miR-592-overexpressing exosomes into a rat knee osteoarthritis model. The results demonstrate that injection of miR-592-overexpressing exosomes promotes chondrocyte regeneration, indicating that these exosomes can be used to prepare drugs for treating osteoarthritis, thus providing a new research direction for the clinical treatment of osteoarthritis. Attached Figure Description

[0016] Figure 1 The results are from flow cytometry analysis in an embodiment of the present invention.

[0017] Figure 2 This is the osteogenic induction result of an embodiment of the present invention.

[0018] Figure 3 The results of electron microscopy identification of exosomes in an embodiment of the present invention are shown.

[0019] Figure 4 The results of exosome particle size identification are shown in the embodiments of the present invention.

[0020] Figure 5 The results of flow cytometry identification of exosome membrane protein content in an embodiment of the present invention are shown.

[0021] Figure 6 The expression level of miR-592 in exosomes was detected in this embodiment of the invention (* represents P<0.05 compared with the Control group (rat ADSCs exo); # represents P<0.05 compared with the NC group).

[0022] Figure 7 This is a diagram illustrating the modeling experiment process in an embodiment of the present invention.

[0023] Figure 8HE staining results of articular cartilage in an embodiment of the present invention.

[0024] Figure 9 The results of Safranin-Fix Green staining of articular cartilage in an embodiment of the present invention are shown. Detailed Implementation

[0025] To more clearly illustrate the present invention, the invention will be further described in detail below with reference to embodiments and accompanying drawings. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of the present invention.

[0026] Unless otherwise specified, the materials and methods used in the following experiments can all be achieved using conventional techniques.

[0027] Example

[0028] The specific implementation process of this embodiment mainly includes:

[0029] I. Isolation and Identification of Rat Adipose-Derived Mesenchymal Stem Cells

[0030] (I) Isolation: Six-week-old rats were disinfected by soaking in 75% alcohol for 3 minutes. The mice were then transferred to an ice plate in a laminar flow hood, and the white subcutaneous adipose tissue in the groin was quickly removed. Visible blood vessels and fibrous parts were removed from the adipose tissue. The tissue was washed three times with PBS, minced, and three times the volume of 0.2% collagenase I was added. The tissue was digested overnight at 4°C, and then at 37°C for 20 minutes the next day, with shaking every 5 minutes to accelerate digestion. After digestion was accelerated, complete culture medium containing 10% FBS was added to terminate the digestion. The digested tissue was filtered through a 70 μm cell sieve, and the filtrate was collected. The filtrate was centrifuged at 1000 rpm for 5 minutes, the supernatant was discarded, and the tissue was resuspended in freshly prepared culture medium and cultured in a culture flask.

[0031] (II) Flow Cytometry Identification of Cells: Collect cells, centrifuge to remove supernatant, wash once with 1 ml PBS, centrifuge at 1500 rpm for 5 min, and discard supernatant; divide the cells into seven tubes, one tube as a control tube, and add 5 μl each of antibodies CD11b APC, CD34 PE, CD45 PERCP, CD29 PE, CD44 FITC, and CD90 FITC to the other six tubes respectively; mix gently and incubate at room temperature in the dark for 20 min; add 1 ml PBS, centrifuge at 1500 rpm for 5 min, and discard supernatant; add 1 ml PBS, centrifuge at 1500 rpm for 5 min, and discard supernatant; resuspend the cells in 500 μl PBS, mix well, and then analyze using a flow cytometer.

[0032] (III) Results: Primary isolated ADSCs cells, flow cytometry results are as follows: Figure 1As shown in Figure A, ADSCs contained 20.3% CD29, 18.42% CD44, and 16.69% CD90; in Figure B, ADSCs contained 15.58% CD11B, 8.98% CD34, and 7.46% CD45. Mesenchymal stem cells exhibited high levels of CD29, CD44, and CD90, and low levels of CD11B, CD34, and CD45. Based on these results, ADSCs were identified as stem cells.

[0033] II. Osteogenesis Induction

[0034] use The rat adipose-derived mesenchymal stem cell osteogenic induction differentiation kit (RAXMD-90021, Cyagen Biosciences) involves adding rat adipose-derived mesenchymal stem cells to osteogenic induction medium, culturing them at 37 degrees Celsius in an incubator, changing the medium every 2-3 days, and continuing induction for 14 days.

[0035] Alkaline phosphatase (ALP) is a marker enzyme of mature osteoblasts, and the calcium nodules formed by osteoblasts are also markers of osteoblasts; enzymatic activity results in the formation of black cobalt sulfide precipitates. For example... Figure 2 The cells shown have a large amount of cobalt sulfide precipitate, indicating that stem cell-induced osteoblasts were successfully induced.

[0036] III. Exosome Extraction and Identification

[0037] (I) Extraction: Supernatant of rat adipose-derived mesenchymal stem cells was rapidly thawed at 37℃. The cell supernatant was transferred to a new centrifuge tube and centrifuged at 2000×g, 4℃, for 30 min. The supernatant was carefully transferred again to a new centrifuge tube and centrifuged again at 12,000×g, 4℃, for 45 min to remove larger vesicles. The supernatant was collected and filtered through a 0.45 μm filter membrane, and the filtrate was collected. The filtrate was transferred to a new centrifuge tube and centrifuged at 110,000×g, 4℃, for 70 min using an ultracentrifuge rotor. The supernatant was removed, and the cells were resuspended in 10 mL of pre-chilled 1×PBS. The cells were then centrifuged again at 110,000×g, 4℃, for 70 min using an ultracentrifuge rotor. The supernatant was removed and the cells were resuspended in 90 μL of pre-chilled 1×PBS.

[0038] (II) Exosome particle size identification: Take frozen samples, thaw them in a 25°C water bath, and place them on ice. Dilute the exosome samples with 1×PBS and directly use them for NTA detection.

[0039] (III) Transfection of the isolated ADSCs with miR-592 mimics: Calculate the volume of the medium in a 6-well plate (6cm dish) twice that of the 6-well plate. When the cell density reaches 70%, prepare for transfection. Replace the cell medium with serum-free medium, 1ml in volume. Take two sterile EP tubes, add 125μL of Opti-MEM to each tube, add 5μL of Lipofectamine 3000 to one tube, and add 12.5μL of mirRNA (mirRNA dry powder dissolved in DEPC water; 125μL / 1OD) to the other EP tube. Mix well and incubate at room temperature for 5min. Mix the two EP tubes and incubate at room temperature for 15min. Drop the mixture into the corresponding wells of the 6-well plate and return the cells to the incubator. 4-6h after transfection, add 1ml of complete medium with 20% serum to the 6-well plate. Continue subsequent experiments after 48h.

[0040] miR-592 mimics and their negative control (NC) are synthesized by Universal Biosynthesis.

[0041] Exosomes were extracted from each group, such as Figure 3 As shown, scanning electron microscopy results revealed that the extracted exosomes possessed a cake-like vesicle structure, such as... Figure 4 As shown, the particle diameter in the Control group was 160.4 nm, the particle diameter in the NC group was 195.9 nm, and the particle diameter in the miR-592 group was 185.1 nm. Flow cytometry was used to identify the content of membrane proteins CD9 and CD63, as shown... Figure 5 As shown, the contents of CD9 and CD63 in the three groups were higher than those in the blank group, indicating that the extracted particles were exosomes.

[0042] IV. miR-592 overexpression detected in exosomes

[0043] Normal cells (rat ADSCs exo) (Control group) were extracted and transfected with exosomes of miR-NC (NC group) and miR-592 (miR-592 group). miRNAs were extracted, and the levels of miRNA-592 in each group were detected by qPCR. Figure 6 As shown, compared with the Control group (rat ADSCs exo) and the NC group, the expression level of miRNA-592 in the exosomes of the miR-592 group was significantly increased.

[0044] The primer sequences for qPCR detection are as follows:

[0045] rno-miR-592 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCA cel-miR-39 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAGCT

[0046] V. The therapeutic effect of exosomes carrying miR-592 by ADSCs on osteoarthritis

[0047] (I) Establishment of a rat model of knee osteoarthritis: After acclimatization, rats were routinely anesthetized. The left knee joint was prepared, the modeling site was disinfected with iodine, and a drape was applied. The joint cavity was opened from the medial side of the patellar ligament to expose the medial collateral ligament and medial meniscus. The medial collateral ligament was then transcribed and the medial meniscus removed. Figure 7 As shown in the left image. After rinsing with saline solution and applying pressure with cotton swabs to stop the bleeding, the joint cavity was closed.

[0048] (II) Drug administration: Four weeks after model establishment, intra-articular injection of exosomes was initiated for intervention, such as... Figure 7 As shown in the right figure, the dosage is 1*10^9 per animal per dose, once a week, for a total of 4 doses.

[0049] The experimental groups were:

[0050] 1) Sham surgery group - Sham group

[0051] 2) Model Group

[0052] 3) Model + NC exosome group - NC group

[0053] 4) Model + miR-592 exosome group - miR-592 group.

[0054] (III) Results: HE staining results are as follows Figure 8 As shown, the cartilage surface in the Sham group was smooth and flat, with a clear and orderly structure and intact tide lines; the superficial cartilage in the Model group showed severe fibrosis and degeneration, with some cartilage severely damaged, indicating successful modeling. After injection of exosomes from the NC group, the results were consistent with the model group, showing no significant improvement. After injection of miR-592 exosomes, the cartilage layer became smoother, the degree of damage was significantly reduced, and the cartilage tissue recovered well. Safranin-Fixed Green staining results are shown below. Figure 9 As shown, red represents cartilage tissue (exampleed by arrow ① in the figure), and green or blue-green represents osteoblastic tissue (exampleed by arrow ② in the figure). In the Sham group, a smooth, red cartilage layer and a green osteoblastic layer are visible. In the Model and NC groups, the cartilage layer is extensively damaged, the red staining is lighter, the boundary between osteoblasts and cartilage is unclear, and the tissue structure is severely damaged. After injection of exosomes overexpressing miRNA-592, more cartilage close to the osteoblastic layer is observed, and the red color is deeper, indicating that injection of exosomes overexpressing miR-592 promotes chondrocyte regeneration.

[0055] Obviously, the above embodiments of the present invention are merely examples to illustrate the present invention more clearly, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all implementation methods here. Any obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. Application of an exosome in preparation of a drug for treating osteoarthritis, wherein the exosome is an exosome overexpressing miR-592, and the exosome overexpressing miR-592 is from adipose-derived mesenchymal stem cells.

2. The use of an exosome according to claim 1 in the preparation of a medicament for the treatment of osteoarthritis, characterized in that, The exosome overexpressing miR-592 is obtained by isolating adipose-derived mesenchymal stem cells ADSCs, transfecting miR-592 mimics, and then extracting exosomes.

3. The use of an exosome according to claim 1 in the preparation of a medicament for the treatment of osteoarthritis, characterized in that, The drug is administered by intra-articular injection to treat osteoarthritis.

Images