Use of StATP6V1C1 in improving resistance of potato to late blight

Abstract

The present application relates to the field of plant biotechnology, and in particular to a kind of potato anti-late blight gene StATP6V1C1 Function verification and application. Respectively using strong promoter drive and VIGS technology in potato Désirée StATP6V1C1 Gene expression is inhibited and overexpressed. StATP6V1C1 Transient expression and stable transgenic line are significantly enhanced to potato late blight resistance, and StATP6V1C1 Silencing line is more susceptible, and the recognition of disease resistance protein R2, Rpi-mcq1 to pathogenicity protein Avr2 (PITG_22870), AL3 (PITG_23008) of effector protein of phytophthora infestans depends on the expression of StATP6V1C1, which proves that StATP6V1C1 gene plays an important role in potato resistance to late blight.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology and provides a functional verification of the potato disease resistance-related gene StATP6V1C1. StATP6V1C1 positively regulates potato resistance to late blight, and the recognition of the pathogenic Phytophthora effector proteins Avr2 and AL3 by the two disease resistance proteins R2 and Rpi-mcq1 depends on the expression of StATP6V1C1, demonstrating that the StATP6V1C1 gene plays an important role in potato resistance to late blight. Background Technology

[0002] Plants are sessile, meaning they cannot freely move away from their habitat to avoid adverse environments. They must directly withstand abiotic and biotic stresses. Therefore, plants have developed more complex systems to resist abiotic and biotic stresses. Through long-term co-evolution with pathogenic microorganisms, plants have formed a two-layered immune defense system (Dangl and Jones, 2006). The first layer involves plants directly recognizing pathogen-associated molecular patterns (PAMPs) of pathogens via cell membrane-localized pattern recognition receptors (PRRs), triggering the plant's first-layer immune system (PTI) to resist pathogen infection. To counteract this first-layer defense, pathogens secrete effectors into plant cells via specific transport systems, directly targeting and inhibiting the PRR or PTI immune signaling pathways, making the plant susceptible to pathogens. This is called effector-triggered susceptibility (ETS) (Sáket al., 2021). The second layer involves the recognition of pathogen effector proteins by intracellular resistance proteins (R) or certain receptor-like proteins (RLPs) on the cell membrane, triggering stronger immune responses such as hypersensitive response (HR) and systemic acquired resistance (SAR). This typically limits pathogen spread through rapid local cell death and is commonly referred to as effector-triggered immunity (ETI). ETS has also become an important pathway for pathogens to suppress ETI and evade resistance responses (Ngou et al., 2022). Plants and pathogens are constantly evolving their respective arsenals around PTI / ETI and effector molecules, forming round after round of arms races. In current agricultural production, the breeding of disease-resistant varieties mainly targets the ETI response mediated by the major resistance gene R for crop improvement. Therefore, the mechanism by which the R gene and R protein recognize pathogen effector molecules is of great value for improving disease-resistant varieties.

[0003] The recognition of plant R proteins by pathogen avirulence genes (Avr) is the mechanism of most ETI (Effective Transmission Infection) and has always been a hot topic in plant immunity research. It has been reported that R proteins can directly recognize effector proteins; for example, the rice CC-NBS-LRR type R protein Pi-ta interacts directly with the rice blast pathogen avirulence protein AVR-Pita (Jia et al., 2000); and the flax TIR-NBS-LRR type R protein M directly recognizes the flax rust pathogen effector AvrM (Catanzariti et al., 2010). Simultaneously, R proteins can also indirectly recognize effector factors through intermediate proteins. The intermediate protein RIN4, which has been extensively studied in the early stages, is an important defense protein. It can be induced to degrade by effector proteins AvrPto and AvrRpt2 (Mackey et al., 2003; Luo et al., 2009) and can also be induced to undergo phosphorylation modification by AvrRpm1 (Mackey et al., 2002). The R protein RPS2 can monitor AvrRpt2-induced RIN4 degradation (Mackey et al., 2003); another R protein, RPM1, can monitor RIN4 phosphorylation induced by effector proteins AvrB and AvrRpm1 (Mackey et al., 2002). The presence of intermediate proteins increases the complexity of R-Avr recognition, enabling the relatively small plant R gene pool to effectively resist various pathogens. Currently, the most complex known resistance recognition model in the potato-Phytophthora infestans interaction system is that the effector protein Avr2 can be recognized by two independently evolved resistance proteins, R2 and Rpi-mcq1, through a BSL-dependent intermediate protein mechanism (Aguileragalvez et al., 2018). No new effector proteins or intermediate proteins have been reported to participate in the complex resistance recognition process between them.

[0004] Potato (Solanum tuberosum L.) is the world's third largest staple food crop. To date, late blight remains the most devastating economic disease in potato production, characterized by its wide range of occurrence, rapid spread, severe damage and significant losses from storage. According to incomplete statistics, the global average annual losses caused by late blight and the costs associated with chemical control exceed 9 billion euros (Haverkort et al., 2016).

[0005] Compared with the application of disease-resistant genes, the application of intermediate proteins can provide plants with broader and longer-lasting resistance. Therefore, how to screen and utilize disease-resistant intermediate proteins to control potato late blight is an urgent problem to be solved. Summary of the Invention

[0006] In response to the aforementioned prior art, this application identifies a positive regulatory factor for potato late blight, StATP6V1C1, and demonstrates that StATP6V1C1, as an intermediate protein, mediates the cross-recognition of two pathogenic Phytophthora effector proteins, Avr2 (XM_002902940) and AL3 (XM_002899560), by two potato R proteins, thereby enhancing potato resistance to late blight from two levels.

[0007] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0008] In a first aspect of the invention, the use of StATP6V1C1 in improving potato resistance to late blight is provided.

[0009] First, the inventors of this application cloned the complete coding region sequence of StATP6V1C1, ligated it into the pCXSN-Myc vector, and transiently expressed it in potato Désirée. They found that transient expression of StATP6V1C1 significantly improved potato resistance to late blight. Figure 1 To further determine the resistance function of StATP6V1C1, the inventors created stable transgenic lines of StATP6V1C1. Three positive lines were selected for disease resistance testing. It was found that, compared to the wild type as a control, the area of ​​water-soaked lesions in the three StATP6V1C1-OE transgenic lines was smaller than that in the control group, and mycelial growth was reduced by 26.39%, 68.32%, and 52.84%, respectively. Compared to the wild type disease index of 68.33%, the disease indices of the three excess lines were 40%, 50%, and 41.07%, respectively, significantly lower than the control group. Figure 2 ).

[0010] Then, the inventors of this application cloned a partial coding region sequence (781-943 bp) of StATP6V1C1 and silenced the gene in potatoes using virus-mediated gene silencing (VIGS) technology. Compared with the control TRV::00 strain, the virus-mediated silenced strain TRV::StATP6V1C1 (inhibition efficiency 77.32%) showed a significant increase in lesion area 3 days after inoculation with late blight. Figure 3 ).

[0011] In a second aspect of this application, the application of the complex formed by StATP6V1C1 with disease resistance proteins R2 and Rpi-mcq1 and pathogenic Phytophthora effector proteins Avr2 and AL3 in improving the resistance of potatoes and tobacco to late blight is provided. StATP6V1C1, as a bridging protein, mediates the recognition of two pathogenic Phytophthora effector proteins Avr2 and AL3 by the two disease resistance proteins R2 and Rpi-mcq1, and is an essential factor for the production of disease resistance by related disease resistance genes.

[0012] The inventors of this application discovered that ATP6V1C1 affects the resistance recognition mediated by R2 and Rpi-mcq1. Using the HR response generated by R3a recognizing Avr3a as a control, two disease resistance proteins, R2 and Rpi-mcq1, and two effector proteins, Avr2 and AL3, were cross-expressed in the TRV::00 and TRV::NbATP6V1C1 lines, respectively. It was found that the HR induced by these four groups of cross-resistance recognition disappeared completely in the TRV::StATP6V1C1 line, indicating that ATP6V1C1 is an essential intermediate protein for the disease resistance proteins R2 and Rpi-mcq1 to exert their resistance functions.

[0013] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0014] The inventors of this application, through transient expression, stable transgenic analysis, and VIGS technology, identified the role of this gene in the disease resistance response, and for the first time internationally discovered that StATP6V1C1 positively regulates potato resistance to late blight. Simultaneously, the inventors demonstrated that StATP6V1C1, as an intermediate protein, mediates the resistance function of two disease resistance proteins, R2 and Rpi-mcq1, in recognizing two Avr2 family effector proteins, revealing the necessity of StATP6V1C1 for potato resistance to late blight on two levels. Attached Figure Description

[0015] Figure 1 A schematic diagram illustrating how transient expression of StATP6V1C1 enhances potato resistance to late blight; (A) Potatoes were infected with Agrobacterium GV3101 carrying pCX-StATP6V1C1-Myc. After 24 hours of infection, the potatoes were inoculated with a suspension of late blight pathogen EC1 spores. Disease incidence was observed 4 days after inoculation, n=30. (B) Disease index statistics.

[0016] Figure 2 Schematic diagram of enhanced resistance to potato late blight in the StATP6V1C1 stable transgenic line; (A) The StATP6V1C1-OE transgenic line enhances potato resistance to late blight. Using Actin as an internal control, the transgenic lines were detected positive with an anti-Myc tag antibody. Disease incidence was observed 3 days after inoculation with a late blight pathogen EC1 spore suspension, n=30. (B) Mycelial growth of pathogenic Phytophthora infestans (5 dpi), t-test (P<0.05).

[0017] (C) Disease index statistics.

[0018] Figure 3A schematic diagram showing the disease development of the VIGS strain after inoculation with a suspension of pathogenic Phytophthora EC1 spores for 3 days to suppress StATP6V1C1 gene expression. (A) The TRV::StATP6V1C1 strain is more susceptible to late blight. (B) Disease index statistics, n=30.

[0019] Figure 4 Schematic diagram of the effect of inhibiting StATP6V1C1 gene expression on R2 and Rpi-mcq1-mediated resistance recognition; (A) In the TRV::00 control group, the recognition of Avr3a by R3a and the four cross-recognitions of R2, Rpi-mcq1 with Avr2 and AL3 all triggered the HR response. (B) In the TRV::StATP6V1C1 line with inhibited StATP6V1C1 gene expression, the recognition of Avr3a by R3a was unaffected, and the four cross-recognitions of R2, Rpi-mcq1 with Avr2 and AL3 all disappeared. (C) Probability of HR necrosis. Detailed Implementation

[0020] The invention is further defined in the following embodiments. Based on the above description and these embodiments, those skilled in the art can determine the basic features of the invention, and various changes and modifications can be made to the invention without departing from its spirit and scope to make it suitable for various uses and conditions. Unless otherwise specified, all techniques used in this invention are prior art.

[0021] Example 1: Transient expression of the StATP6V1C1 gene significantly enhances potato resistance to late blight.

[0022] 1. Cloning the StATP6V1C1 gene

[0023] Primers were designed based on the gene sequence (accession number LOC102595740) in the NCBI database to amplify the StATP6V1C1 gene (see primers 1 and 2 in Table 1). RNA was extracted from 50-100 mg of fresh potato leaf material using the Plant RNA kit (OMEGA Bio-tek, Norcross, USA), and the first strand of cDNA was synthesized using the HiFiScript gDNA Removal cDNA Synthesis Kit (CWBIO, Beijing). The target fragment was amplified using KOD-Plus-Neo (TOYOBO, Osaka, Japan). The amplified fragment was recovered and purified using a Novozymes DNA recovery kit. The purified DNA fragment was ligated into an intermediate vector using T4 DNA ligase. The cells were transformed into *E. coli* DH5α competent cells using the heat shock method. Positive clones were selected, plasmids were extracted, and sequencing was performed by Sangon Biotech Co., Ltd. The results showed that a 1131 bp DNA fragment was obtained after PCR amplification using *Désirée* potato cDNA as a template.

[0024] Table 1

[0025] Primer 1 ATGGCTTCCAGGTATTGGGTGGTTTCTC(SEQ ID NO.1) Primer 2 TCAAACAAGATTTATTGTGAAGGAGACGT(SEQ ID NO.2) Primer 3 GGCTTCCAGGTATTGGGTGGTTTCTC(SEQ ID NO.3) Primer 4 TCAAACAAGATTTATTGTGAAGGAGACGT(SEQ ID NO.4)

[0026] 2. Construct and transform the StATP6V1C1-Myc vector

[0027] To determine the effect of StATP6V1C1 on potato resistance, the inventors inserted the full-length CDS sequence of StATP6V1C1 into the pCXSN-Myc vector using the TA cloning method. The target fragment was amplified using KOD-Plus-Neo (TOYOBO, Osaka, Japan) (see primers 3 and 4 in Table 1). The vector was digested with the restriction endonuclease Xcm I purchased from NEB, and ligation was performed using T4 DNA ligase. After successful sequencing of positive clones, they were transformed into Agrobacterium GV3101 for transient expression and Agrobacterium AGL1 for creating stable transgenic lines.

[0028] 3. Transient expression of StATP6V1C1 significantly enhances potato resistance to late blight.

[0029] Phytophthora pathogenica was cultured upside down in the dark at 18°C ​​for 14 days. The mycelia were scraped off with sterile water, and the mixture was then placed in an ice bath for 2-3 hours to allow the sporangia to fully rupture and release zoospores. The spores were diluted with sterile distilled water and counted under a biological microscope using a hemocytometer, adjusting the spore concentration to 3.4-6.8 × 10⁻⁶. 5 / mL range. The inventors used GV3101, which was successfully transformed with StATP6V1C1-Myc, to inject and infect potato leaves of Désirée. One day after infection, the leaves were harvested for in vitro inoculation. Three days after inoculation with EC1 strain, the disease phenotype was observed and the disease index was calculated. The disease severity was divided into 5 levels according to the affected area as a percentage of the total plant or leaf area: Level 0 (0%), Level 1 (0-25%), Level 2 (25-50%), Level 3 (50-75%), and Level 4 (75-100%). After testing, the StATP6V1C1 transient expression lines showed significantly enhanced resistance to potato late blight. Figure 1 ).

[0030] Example 2: Stable transgenic lines of StATP6V1C1 show enhanced resistance to late blight.

[0031] 1. Creation and positive identification of StATP6V1C1-OE stable transgenic lines

[0032] Genetic transformation of potatoes was performed using the stem segment method. Agrobacterium AGL1 carrying the StATP6V1C1-Myc expression vector was propagated and cultured. Stem segments of potato tissue culture seedlings without growth points were cut and pre-cultured in MS medium at 22℃ for 2-3 days. The segments were then resuspended in MS liquid culture medium and adjusted to OD0.05. 600 =0.5, immerse the stem segments in the infection solution, shake on a horizontal shaker at 40 rpm for 15 min, blot dry with sterile filter paper, and then place the stem segments evenly on co-culture medium (MS medium, containing GA3 0.2 mg / L, NAA 0.02 mg / L, ZT 2.5 mg / L) and incubate in the dark at 18℃ for 2 days. The co-cultured stem segments were washed five times with sterile water containing 50 μg / mL termethin for 5 minutes each time. After blotting the stem segments with sterile filter paper, they were placed on callus medium (MS medium, with added GA3 0.2 mg / L, NAA 0.02 mg / L, trans-ZT 2.5 mg / L, and termethin 50 μg / mL) for about two weeks until good callus tissue was formed. The callus tissue was then transferred to differentiation medium (MS medium, with added GA3 0.02 mg / L, NAA 0.02 mg / L, trans-ZT 2.5 mg / L, and termethin 50 μg / mL) and cultured until shoots differentiated. When the shoots grew to about 1 cm, they were cut and transferred to MS rooting medium to induce rooting and for resistance screening. After transplanting, the seedlings were identified positively by Western blotting. In this study, the tissue culture environment was 16 hours of light, 8 hours of darkness, 22°C, and 2000 Lux of light intensity. Three positive lines were selected and named Line1, Line2, and Line3, respectively.

[0033] 2. StATP6V1C1-OE stable transgenic lines exhibit enhanced resistance to potato late blight.

[0034] The disease resistance of three StATP6V1C1-OE positive lines was tested using the wild type as a control. The results are as follows: Figure 2 As shown, compared to the wild-type control, the area of ​​water-soaked lesions in the three StATP6V1C1 transgenic lines was smaller than that in the control group, and the mycelial growth was reduced by 26.39%, 68.32%, and 52.84%, respectively. Compared to the wild-type disease index of 68.33%, the disease indices of the three excess lines were 40%, 50%, and 41.07%, respectively, significantly lower than the control group. In conclusion, the StATP6V1C1 stable transgenic lines exhibit enhanced disease resistance.

[0035] Example 3: The StATP6V1C1 silent strain is more susceptible to potato late blight.

[0036] To further confirm the resistance function of the StATP6V1C1 gene, the inventors used VIGS technology to silence the StATP6V1C1 gene in potato Désirée (see primers 5 and 6 in Table 3; the underlined bases in primer 5 are the recognition sites for the restriction endonuclease BamHI, and the underlined bases in primer 6 are the recognition sites for the restriction endonuclease KpnI).

[0037] Table 2

[0038] Primer 5 CGGGATCCATCGGAAACAAGAGCTGGA(SEQ ID NO.5) Primer 6 GGGGTACCGAGGCAACCCGTATCTCAAA(SEQ ID NO.6) Primer 7 AGAGTTTCCGGCGTTCTCAG(SEQ ID NO.7) Primer 8 TTGGACAGATCACGGACAGC(SEQ ID NO.8)

[0039] The gene silencing efficiency was 77.32% as detected by qRT-PCR (primers 7 and 8 in Table 2). Three days after inoculation with a suspension of pathogenic *Phytophthora* strain EC1 spores, the disease progression was as follows... Figure 3 As shown, the lesion area of ​​the TRV::StATP6V1C1 strain is significantly increased, and potato strains with suppressed StATP6V1C1 gene expression are more susceptible to late blight.

[0040] Example 4: Silencing the NbATP6V1C1 gene in Nicotiana benthamiana affects the resistance recognition of two disease resistance proteins, R2 and Rpi-mcq1, against the pathogenic Phytophthora effector proteins Avr2 and AL3.

[0041] 1. The expression of NbATP6V1C1 was knocked down in Nicotiana benthamiana using VIGS technology. The specific steps are as follows:

[0042] RNA was extracted from germinating seedlings of Nicotiana benthamiana and reverse transcribed to obtain cDNA.

[0043] PCR amplification of the Nicotiana benthamiana cDNA fragment was performed using specific primers with BamHI and KpnI restriction sites (see primers 5 and 6 in Table 3), and the Nicotiana benthamiana NbATP6V1C1 gene interference fragment was purified.

[0044] A recombinant plasmid containing the NbATP6V1C1 gene of Nicotiana benthamiana was constructed using the VIGS viral vector. After successful transformation, the virus-mediated silent strain TRV::NbATP6V1C1 was obtained. The unsilenced strain was TRV::00 (control strain).

[0045] Four weeks later, the inhibition efficiency was detected by qRT-PCR (primers 7 and 8 in Table 2) and found to be 88.25%.

[0046] 2. Using co-expression of AVR3a and R3a as controls, the disease resistance gene R2 / Rpi-mcq1 and the effect factor Avr2 / AL3 were expressed in a cross combination of TRV::00 (control strain) and the virus-mediated silencing strain TRV::NbATP6V1C1. Photos were taken 7 days after expression and the probability of HR was counted. The specific operational steps are as follows: The full-length CDS sequences of the disease-resistant proteins R2 (ACU65456), Rpi-mcq1 (GN043560), and R3a (JN609622), as well as the C-terminal CDS sequences of the effector molecules Avr2 (XM_002902940), AL3 (XM_002899560), and Avr3a (HQ639930), were cloned respectively; the R2 / Rpi-mcq1 / R3a gene fragments were cloned into the vector pCXSN-Myc (Chen et al., 2009), the vector pCXSN-Myc was digested with Xcm1, and then ligated with the gene fragments via TA cloning to obtain the recombinant vector; the Avr2 / AL3 / Avr3a gene fragments were cloned into the vector CXSN-HA (Chen et al., 2009). (al., 2009), the vector CXSN-HA was digested with Xcm1 single enzyme, and then ligated with the gene fragment by TA cloning to obtain the recombinant vector;

[0047] The recombinant vector was transformed into competent Agrobacterium GV3101 cells and cultured in a shaker at 28°C. The bacterial suspension concentration was adjusted to OD using infection medium (10 mM magnesium chloride, 0.1 mM acetylsuccinone). 600 =1, respectively according to Figure 4 The bacterial solution of the AE combination was mixed 1:1 and injected into tobacco leaves. The probability of HR necrosis was counted seven days after injection.

[0048] The results are as follows Figure 4As shown, knocking down NbATP6V1C1 does not affect the recognition of Avr3a by R3a, and the four recognitions of Avr2 / AL3 by R2 / Rpi-mcq1 completely disappear. This proves that in addition to its own resistance function, NbATP6V1C1 also mediates four cross-recognitions between R2 / Rpi-mcq1 and Avr2 / AL3, helping plants to better resist the infection of pathogenic Phytophthora.

Claims

1. Overexpression StATP6V1C1 The application of genes in improving potato resistance to late blight is characterized by, The StATP6V1C1 The gene's accession number in the NCBI database is LOC102595740.

Images