Chrldl1 gene knock-in mouse model and construction method thereof

Abstract

The application provides a CHRDL1 gene knock-in mouse model and a construction method thereof, and the method comprises the following steps: obtaining an active sgRNA12, wherein the nucleotide sequence of the sgRNA12 is shown as SEQ ID NO. 3; obtaining an active Cas9 mRNA, wherein the nucleotide sequence of the Cas9 is shown as SEQ ID NO. 4; mixing the active sgRNA12, the Cas9 mRNA and a targeting vector with a nucleotide sequence shown as SEQ ID NO. 1, and then microinjecting the mixture into a mouse zygote to obtain F0 generation mice; selecting F0 generation positive mice to mate with wild type mice to obtain F1 generation mice with stable genotypes; and screening to obtain CHRDL1 gene knock-in model mice. The method has high gene editing efficiency, and the transgenic mouse can highly express human CHRDL1 protein.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a CHRDL1 gene knock-in mouse model and its construction method. Background Technology

[0002] Chordin-like 1 (CHRDL1) is a secretory glycoprotein with abundant repetitive cysteine ​​domains. It competitively binds to ligands of the bone morphogenetic proteins (BMPs) family, inhibiting their function through receptor binding. CHRDL1 is widely distributed across multiple organs in the human body, primarily found in various cell types of the central nervous system, retina, thyroid gland, heart, lungs, colorectal region, and reproductive organs. CHRDL1 is a multifunctional protein with functions including promoting neuronal development, regulating immune responses, promoting angiogenesis, controlling osteochondral formation, and modulating cancer development. Therefore, CHRDL1 has broad application prospects in various fields such as musculoskeletal diseases, immune system diseases, and cancer treatment.

[0003] Research on CHRDL1 is still relatively limited both domestically and internationally, and no one has yet studied methods for producing the CHRDL1 protein. Previously, traditional methods such as mammalian cell culture, insect cell culture, or microbial fermentation were commonly used to express proteins, but these methods generally have drawbacks such as low protein expression levels, high production costs, or complex purification processes, making it difficult to achieve large-scale industrial production.

[0004] Therefore, in order to achieve large-scale production in the future, it is necessary to develop a method for preparing transgenic mice that highly express human CHRDL1 protein using CRISPR / Cas9. Summary of the Invention

[0005] The purpose of this invention is to provide a CHRDL1 gene knock-in mouse model and its construction method. This method has high gene editing efficiency, and the transgenic mouse can highly express human CHRDL1 protein.

[0006] In a first aspect of the invention, a targeting vector for a CHRDL1 gene knock-in mouse is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Furthermore, the targeting vector comprises a DNA fragment structure CAGPr-loxP-Stop-loxP-EGE-ZK-037CDS-WPRE-pA with a nucleotide sequence as shown in SEQ ID NO.2, wherein CAG is a promoter, Pr-loxP-Stop-loxP is a regulatory element, and EGE-ZK-037CDS-WPRE-pA is an expression element, and includes homologous arms at the 5' and 3' ends of ZK-037CDS.

[0008] In a second aspect of the invention, a method for constructing a CHRDL1 gene knock-in mouse model is provided, the method comprising:

[0009] sgRNA12 was transcribed into mRNA in vitro to obtain active sgRNA12, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0010] An active Cas9 mRNA was obtained, the Cas9 nucleotide sequence of which is shown in SEQ ID NO.4;

[0011] The active sgRNA12, Cas9 mRNA and the targeting vector with the nucleotide sequence shown in SEQ ID NO.1 were mixed and microinjected into mouse zygotes to obtain F0 generation mice;

[0012] F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes; then, gene-targeted mice that underwent correct recombination were screened out to obtain CHRDL1 gene knock-in model mice.

[0013] In a third aspect of the invention, a set of nucleic acid molecules for constructing a human CHRDL1 transgenic mouse model is provided, the set of nucleic acid molecules comprising:

[0014] (a) The nucleotide sequence encoding gRNA, as shown in SEQ ID NO.3;

[0015] (b) The nucleotide sequence encoding Cas9, as shown in SEQ ID NO.4;

[0016] (c) Targeting vector with nucleotide sequence as shown in SEQ ID NO.1.

[0017] In a fourth aspect of the invention, a CHRDL1 gene knock-in mouse model obtained by the method is provided.

[0018] In a fifth aspect of the invention, the use of the described CHRDL1 gene knock-in mouse model in the preparation of human CHRDL1 protein overexpression or in drug screening is provided.

[0019] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0020] The mouse model prepared by this invention can improve gene knock-in efficiency by nearly 20 times, and is faster and more convenient, increasing the success rate, saving costs, shortening the cycle, and making it more conducive to industrialization and large-scale commercial applications. Tests showed that Chrdl1 was successfully overexpressed in the retina of the CHRDL1 gene knock-in mouse model. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The gene is CHRDL1 (EGE-ZK-037).

[0023] Figure 2 This is a schematic diagram of a target carrier.

[0024] Figure 3 Southern blot screening strategy;

[0025] Figure 4 The pCS(puro) vector spectrum;

[0026] Figure 5 This is an electrophoresis image of sg12 RNA; the left lane is the negative control group, and the right lane is sg12 RNA.

[0027] Figure 6 The results are for Cas9 / sgRNA activity assays; where con is the negative control group, pc is the positive plasmid control group, sg1-sg18 represent the 18 designed sgRNAs, and blank is the blank control group.

[0028] Figure 7 A map of the target carrier;

[0029] Figure 8 Image showing enzyme digestion identification of the targeting vector;

[0030] Figure 9 Electrophoresis diagram of partial results of F0 generation mouse tail genotype identification;

[0031] Figure 10 The results of F1 generation mouse genotyping; among them Figure 10 The primer for A is “ROSA-GT-new-L-F2 / ROSA-GT-new-L-R2”; Figure 10 The primer for B is “WPRE-F1 / ROSA-GT-new-R-R1”; where, Figure 10 The primer for C is “Rosa-GT-F / Rosa-GT-R”; Figure 10 The primer for D is “Rosa-GT-F / Rosa26-Test(L)-R3”; Figure 10 E represents the identification principle;

[0032] Figure 11 The results are from Southern blot analysis of F1 generation positive homologous recombinant mice.

[0033] Figure 12 The results are from Example 2, where Figure 12 A represents the results of PCR amplification and gel electrophoresis techniques for identifying mouse genotypes, and 12B represents the results of qRT-PCR detection of Chrdl1 mRNA levels in the retinas of the two groups of mice. Detailed Implementation

[0034] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0035] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0036] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0037] Terminology Explanation

[0038] Wild type allele (WT): i.e., wild-type mouse;

[0039] Targeted allele: refers to positive mice obtained through injection of fertilized eggs, or F1 generation positive heterozygous mice obtained by mating F0 generation positive mice with wild-type mice.

[0040] 1EK37-15: This refers to the mouse's serial number. The numbering principle is as follows: 1 indicates the F1 generation; EK37 is an abbreviation for this research project; -15 indicates the tail-clipping serial number.

[0041] To solve the above-mentioned technical problems, the overall concept of the technical solution of the present invention is as follows:

[0042] Design scheme for Rosa26-CAG-LSL-EGE-ZY-037 gene knock-in mouse model

[0043] 1. The CHRDL1 (EGE-ZK-037) gene is located on the reverse strand of the X chromosome and is 122.2 kb in length. Gene ID (NCBI): 91851. The EGE-ZK-037 gene has 5 transcripts.

[0044] 2. Based on the characteristics of the Rosa26 gene, we selected to insert CAG Pr-loxP-Stop-loxP-EGE-ZK-037CDS-WPRE-pA (e.g., at the Rosa26 site of the CHRDL1 gene) into the Rosa26 site. Figure 2 (As shown). The sgRNA was designed to be positioned around the insertion site.

[0045] The Rosa26 gene knock-in targeting vector mainly includes the following functional elements: CAG promoter; Loxp-Stop-Loxp regulatory element; EGE-ZK-037CDS-WPRE-pA expression element; and homologous arms at the 5' and 3' ends, each approximately 2kb.

[0046] 3. Southern blot identification strategy: To verify the correctness of recombination in F1 mice, we used Southern blot, and simultaneously utilized 5' probe-2 and WPRE(3') probe for verification. The specific design is as follows: 5' probe-2 was used to detect the occurrence of gene recombination. If correct recombination occurred, two bands, wild-type and mutant, would appear; if incorrect recombination did not occur, only the wild-type band would appear. WPRE(3') probe was used to detect whether random insertion was present. If correct recombination occurred, only the target band would appear; if random insertion was present, multiple bands would appear.

[0047] The following will provide a detailed description of the method for constructing a humanized CHRDL1 transgenic mouse model according to this application, in conjunction with embodiments and experimental data.

[0048] Example 1: Construction of the CHRDL1 gene knock-in mouse model

[0049] 1. Sequencing confirmation of the target sequence;

[0050] Different strains may have different target gene sequences. To ensure the efficiency of the designed sgRNA, the target site sequence in the C57BL / 6N mouse tail must first be amplified by PCR and sequenced to confirm that the sgRNA recognition sequence is completely identical to the C57BL / 6N mouse tail DNA sequence. The nucleotide sequences of the PCR primers are shown in Table 1.

[0051] Table 1

[0052]

[0053] PCR amplification and sequencing verification of C57BL / 6N mouse tail DNA showed that the target sequence of C57BL / 6N mouse tail was completely consistent with the sequences provided by Genebank and Ensembl.

[0054] 2. Design and construction of Cas9 / sgRNA plasmids;

[0055] 2.1 Design of Cas9 / sgRNA plasmid;

[0056] Based on the design principles of sgRNA, a total of 18 sgRNAs, namely sgRNA1 to sgRNA18, were designed in the target site region. The oligo sequences corresponding to these 18 sgRNAs are shown in Table 2.

[0057] Table 2

[0058] Guide #1 85 ACTGGAGTTGCAGATCACGAGGG Guide #2 81 GGCAGGCTTAAAGGCTAACCTGG Guide #3 81 GTCCTGCAGGGGAATTGAACAGG Guide #4 72 AAGATGGGCGGGAGTCTTCTGGG Guide #5 71 GTGTGTGGGCGTTGTCCTGCAGG Guide #6 71 TGGGCGGGAGTCTTCTGGGCAGG Guide #7 67 CGCCCATCTTCTAGAAAGACTGG Guide #8 64 CAGGACAACGCCCACACACCAGG Guide #9 62 GTTGCAGATCACGAGGGAAGAGG Guide #10 62 TCTGAGGACCGCCCTGGGCCTGG Guide #11 61 CAGGGCGGTCCTCAGAAGCCAGG Guide #12 88 AAGGCCGCACCCTTCTCCGGAGG Guide #13 76 ACCCTTCTCCGGAGGGGGGAGGG Guide #14 73 GAGCTGCAGTGGAGTAGGCGGGG Guide #15 89 GCTCTGAGTTGTTATCAGTAAGG Guide #16 89 CCTCGATGGAAAATACTCCG Guide #17 77 TGGGAGGATAGGTAGTCATCTGG Guide #18 71 CGACAAAACCGAAAATCTGTGGG

[0059] 2.2 Construction of Cas9 / sgRNA plasmid;

[0060] Primers were synthesized according to the 18 designed sgRNA sequences, and after annealing and polymerization, they were ligated into the following sequences using Gibson Assembly: Figure 4 The pCS(puro) vector shown was transformed and sequenced to verify its correctness, thus constructing 18 Cas9 / sgRNA plasmids.

[0061] 3. Cas9 / sgRNA activity was detected using a self-developed CRISPR / Cas9 activity detection method – the UCATM method. This method offers advantages such as no species limitations, high throughput, wide adaptability, high sensitivity, and simplicity. sgRNA12 was selected for the next experimental step, and the detection results are as follows: Figure 5 As shown in Table 3.

[0062] Table 3

[0063]

[0064]

[0065] After activity testing of 18 constructed Cas9 / sgRNA plasmids, the results were as follows: Figure 9 The test results are shown below. Figure 5 As can be seen, the activity and specificity of the 12th Cas9 / sgRNA plasmid are significantly better than those of the other 17 Cas9 / sgRNA plasmids. Therefore, sgRNA12 corresponding to this Cas9 / sgRNA plasmid was selected for the next step.

[0066] 4. Preparation of sgRNA via microinjection

[0067] First, the sgRNA12 sequence was ligated into the PT7-4G plasmid vector with the T7 promoter. After the plasmid was sequenced and verified to be correct, the T7 promoter and sgRNA nucleotide sequence were amplified using universal amplification primers. Finally, the PCR product was used as a template for in vitro transcription to obtain the microinjection RNA of sgRNA112.

[0068] Furthermore, the reaction conditions during its preparation were 65℃ for 5 minutes, and the RNA electrophoresis image is shown below. Figure 6 As shown, Figure 6 This indicates that sgRNA12 was successfully transcribed at the required concentration.

[0069] 5. Construction of the target carrier;

[0070] First, based on the designed targeting scheme, primers are designed and targeting vectors are constructed. The spectrum of the targeting vector is shown in the figure below. Figure 7 As shown, the specific construction method is as follows:

[0071] Identify the target sequence and design primers (sequences are shown in Table 1).

[0072] The DNA fragment structure shown in SEQ ID NO.2 was ligated into an EGE vector (purchased from Biocytogen) to obtain a targeting vector, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0073] The targeting vector contains a DNA fragment structure CAG Pr-loxP-Stop-loxP-EGE-ZK-037CDS-WPRE-pA, as shown in SEQ ID NO.2, wherein CAG is a promoter, Pr-loxP-Stop-loxP is a regulatory element, EGE-ZK-037CDS-WPRE-pA is an expression element, and contains homologous arms at the 5' and 3' ends of ZK-037CDS. WPRE contains a 12bp restriction enzyme site sequence, and there is a 17bp restriction enzyme site sequence between WPRE and pA. The restriction enzyme sites are used for subsequent Southern blot identification.

[0074] The resulting targeting vector was then identified through enzyme digestion and sequencing to confirm its successful construction. The results of the enzyme digestion and sequencing of the targeting vector are as follows: Figure 8 As shown, this indicates that the target carrier was successfully constructed.

[0075] 6. Preparation of F0 generation mice;

[0076] Cas9 and sgRNA were microinjected into mouse zygotes via microinjection of the RNA and targeting vector. Mice born after injection were designated as generation F0.

[0077] 7. Genotyping of F0 generation mice:

[0078] This invention uses Cas9 / sgRNA injection into fertilized eggs to construct gene knock-in mice. Due to the rapid cleavage rate in the early embryonic stage, the resulting F0 generation mice are chimeras. Therefore, the F0 genotype obtained by identifying the tail of the F0 generation mice is for reference only and does not necessarily represent a heritable gene mutation. The heritable genotype needs to be determined after testing the tail of the F1 generation mice.

[0079] 7.1, in accordance with... Figure 4 Based on the PCR primer design principles shown, primers for genotyping F0 generation mice were designed. The nucleotide sequences of these PCR primers are shown in Table 4.

[0080] 7.2. Genotyping of the tails of F0 generation mice was performed, and some results are shown below. Figure 9 As shown.

[0081] Conclusion: PCR products and sequencing showed that EK37-3, EK37-5 and EK37-39 were positive F0 generation mice.

[0082] 8. Preparation of F1 generation mice;

[0083] F0 generation mice with positive tail genotypes were mated with C57BL / 6N wild-type mice to obtain F1 generation mice with stable genotypes. The mating protocol is shown in Table 4.

[0084] Table 4

[0085]

[0086] 9. Genotyping and Southern blot identification of F1 generation mice;

[0087] 9.1 Genotyping of F1 generation mice;

[0088] The PCR primer design principles, PCR primer information, and PCR conditions were the same as those for F0 generation mouse genotyping. Some identification results are shown below. Figure 10 As shown.

[0089] Conclusion: PCR identification and point mutation site sequencing results showed that 1EK37-15, 1EK37-17, 1EK37-20, 1EK37-22 and 1EK37-23 were PCR-positive F1 generation mice.

[0090] 9.2 Southern blot detection in F1 generation positive homologous recombinant mice;

[0091] DNA was extracted from the tails of F1 generation mice that tested positive by PCR and then subjected to Southern blot analysis and sequencing. The results are as follows: Figure 11 As shown. The test results show that 1EK37-15, 1EK37-17, 1EK37-20, 1EK37-22 and 1EK37-23 are correctly recombined and there are no random insertions.

[0092] Example 2: Application of the CHRDL1 gene knock-in mouse model obtained in Example 1 in the preparation of human CHRDL1 protein overexpression.

[0093] 1. In Example 1, transgenic mice overexpressing Chrdl1 in the retina were prepared (loxp = 278 bp, Six3-cre = 480 bp, wild-type GT = 469 bp). The GT primer sequence was as follows:

[0094] Rosa-GT-F:AGTCGCTCTGAGTTGTTATCAG;

[0095] Rosa-GT-R:TGAGCATGTCTTTAATCTACCTCGATG;

[0096] Mouse genotypes were identified using PCR amplification and gel electrophoresis techniques. Figure 12 A) Because the Chrdl1 overexpression sequence is inserted between the corresponding sites of the GT primers, the mutant alleles cannot be amplified by GT. Therefore, the GT primer is used to identify the presence of wild-type alleles.

[0097] The results are as follows Figure 12 As shown in Figure A, Controll represents mice without knock-in, CHRDL1six3-KI represents homozygous mice with CHRDL1 gene knock-in, and CHRDL1S3-KI(+ / -) represents heterozygous mice with CHRDL1 gene knock-in. The results show that the electrophoretic bands are as expected.

[0098] 2. Mice of different genotypes from the same litter were harvested at P0.5 and P90 (the CHRDL1 gene knock-in mice obtained in Example 1 are abbreviated as Chrdl1). Six3-KI Retinal tissue fragments and genomic RNA were collected from mice (with a control group of non-knock-in mice). The fragments were reverse transcribed into cDNA, and the Chrdl1 mRNA content in the retinas of both groups of mice was detected by qRT-PCR. The primer sequences used for qRT-PCR were:

[0099] ROSA-GT-new-L-F2:GAGCTCTGGGCGAAAAATGAGTTGC;

[0100] ROSA-GT-new-L-R2:TGGGCTATGAACTAATGACCCGTA;

[0101] Experimental results are as follows Figure 12 As shown in Figure B, compared with the control group, Chrdl1 Six3-KI The levels of Chrdl1 in mice were significantly upregulated, indicating that Chrdl1 was successfully overexpressed in the retina. Figure 12 B).

[0102] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0103] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0104] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0105] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A targeting vector for CHRDL1 gene knock-in mice, characterized in that, The nucleotide sequence of the targeting vector is shown in SEQ ID NO.

1.

2. A method for constructing a CHRDL1 gene knock-in mouse model, characterized in that, The method includes: sgRNA12 was transcribed into mRNA in vitro to obtain active sgRNA12, the nucleotide sequence of which is shown in SEQ ID NO.3; An active Cas9 mRNA was obtained, the Cas9 nucleotide sequence of which is shown in SEQ ID NO.4; The active sgRNA12, Cas9 mRNA and the targeting vector with the nucleotide sequence shown in SEQ ID NO.1 were mixed and microinjected into mouse zygotes to obtain F0 generation mice; F0 generation positive mice from the F0 generation genotype identification results were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes; then, gene-targeted mice that underwent correct recombination were screened out to obtain CHRDL1 gene knock-in model mice.

3. The application of the CHRDL1 gene knock-in mouse model obtained by the method of claim 2 in the preparation of human CHRDL1 protein overexpression.

4. A complete set of nucleic acid molecules for constructing a CHRDL1 gene knock-in mouse model, characterized in that, The complete set of nucleic acid molecules includes: (a) The nucleotide sequence encoding gRNA, as shown in SEQ ID NO.3; (b) The nucleotide sequence encoding Cas9, as shown in SEQ ID NO.4; (c) The target carrier according to claim 1.

Images