Engineered bacteria for producing glycosylated astaxanthin and construction method and application thereof

Abstract

This invention relates to engineered bacteria producing glycosylated astaxanthin, their construction methods, and applications, belonging to the field of fermentation engineering technology. This invention discloses an engineered bacterium producing glycosylated astaxanthin, named OUC-AdGHB1-7CJ, which was deposited on August 1, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.25446 and classified as *Yarrowia lipolytica*. The application of this engineered bacterium in the preparation of glycosylated astaxanthin is also disclosed. The invention also discloses the construction method of this engineered bacterium. The engineered bacterium producing glycosylated astaxanthin of this invention can achieve a yield of 27.274 mg / L. This invention provides feasibility for the efficient synthesis of other glycosylated carotenoids in microorganisms, laying the foundation for the industrial production of glycosylated astaxanthin.

Description

Technical Field

[0001] This invention relates to engineered bacteria that produce glycosylated astaxanthin, their construction methods and applications, and belongs to the field of fermentation engineering technology. Background Technology

[0002] Glycosylated astaxanthin, also known as astaxanthin glucoside, is a rare natural carotenoid formed by the dehydration condensation of astaxanthin with two glucose molecules under the catalysis of the glycosyltransferase CrtX. Astaxanthin possesses strong antioxidant properties and red coloring properties. It is the only carotenoid that can penetrate the blood-brain and blood-retinal barriers and has positive effects on the central nervous system and brain function, finding wide applications in the food, feed, pharmaceutical, and cosmetic industries. However, the hydrophobicity of astaxanthin limits its applications. Glycosylated astaxanthin, through glycosylation, increases molecular polarity and reduces hydrophobicity, making it more easily absorbed by the human body as a food additive and drug. Furthermore, glycosylation of carotenoids also leads to structural diversity and other benefits, such as improved bioavailability, enhanced efficacy as a food supplement and drug, and improved photostability and biological activity (e.g., antioxidant activity) of carotenoids.

[0003] Glycosylated astaxanthin is sparsely distributed in nature (mainly found in some bacteria), and its properties are still poorly understood, as are its health effects on humans and animals. Naturally occurring, synthesized glycosylated astaxanthin is present in very low quantities and is difficult to extract and separate. Metabolic engineering biosynthesis is an effective route to obtain glycosylated astaxanthin, but to date, only a few studies have achieved the biosynthesis of carotenoid glycosides in *Escherichia coli* and a few natural microorganisms. These studies have only produced detectable amounts of carotenoid glycosides, far from the minimum requirements for industrial applications.

[0004] Yarrowia lipolytica is an unconventional yeast strain that has been certified as GRAS (generally recognized as safe) by the US FDA. It has a broad substrate spectrum, tolerance to various environmental stresses, sufficient intracellular acetyl-CoA supply, the ability to perform high-density fermentation, and safety for humans. In recent years, it has received much attention in the field of synthetic biomanufacturing. Summary of the Invention

[0005] To address the aforementioned limitations of existing technologies and achieve the industrial production of glycosylated astaxanthin, this invention constructs an engineered bacterium that produces glycosylated astaxanthin, provides its construction method, and its application in the preparation of glycosylated astaxanthin. Furthermore, this invention obtains an engineered bacterium that produces glycosylated astaxanthin through screening of the bacterium.

[0006] This invention is achieved through the following technical solution:

[0007] An engineered strain producing glycosylated astaxanthin, named OUC-AdGHB1-7CJ, was deposited on August 1, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.25446 and classified as Yarrowia lipolytica.

[0008] The biological characteristics of the engineered bacteria that produce glycosylated astaxanthin are as follows: when cultured on YPD solid medium at 30°C for 24 hours, the colonies are round, brick red, wrinkled, with hairy edges, and dry in texture. Under natural conditions, they generally exist in both yeast and hyphal forms.

[0009] The application of the engineered bacteria that produce glycosylated astaxanthin in the preparation of glycosylated astaxanthin. The engineered bacteria that produce glycosylated astaxanthin of the present invention can produce glycosylated astaxanthin with high efficiency, far superior to other transformants, and has great advantages and application prospects in the preparation of glycosylated astaxanthin.

[0010] Furthermore, in specific applications, the engineered bacteria that produce glycosylated astaxanthin are cultured, and glycosylated astaxanthin is extracted. The specific culture method can be as follows: colonies of the engineered bacteria producing glycosylated astaxanthin are picked and inoculated into YPD medium to obtain a seed culture; the seed culture is inoculated into YPD medium to obtain a fermentation broth; the fermentation broth is taken, centrifuged to obtain a bacterial precipitate and fermentation supernatant, and the glycosylated astaxanthin is obtained by extracting the bacterial precipitate.

[0011] Furthermore, the conditions for culturing the seed culture medium are: 30°C, 200 rpm for 24 hours.

[0012] Furthermore, the inoculation amount of the seed culture solution is 2% (volume ratio).

[0013] Furthermore, the fermentation broth is cultured under the following conditions: 30°C, 200 rpm for 84 hours.

[0014] The YPD medium is a commercially available medium in the prior art, and its components include: 1% yeast extract, 2% peptone, 2% glucose, and the balance being water.

[0015] An engineered bacterium that produces glycosylated astaxanthin, whose host is *Yarrowia lipolytica*, contains the following genes ①②⑤ or ③④⑤ in its genome:

[0016] ①The encoding gene HBFD for carotenoid 4-hydroxy-β-cyclic 4-dehydrogenase (HBFD), the nucleotide sequence of which is shown in SEQ ID NO.2;

[0017] ②The gene encoding carotenoid β-cyclic 4-dehydrogenase (tr53-CBFD) with chloroplast transport peptide removed, tr53-CBFD, has the nucleotide sequence shown in SEQ ID NO.3; its promoter is the hp4d promoter, and its nucleotide sequence is shown in SEQ ID NO.7;

[0018] ③The encoding gene crtZ for β-carotene hydroxylase (crtZ) has the nucleotide sequence shown in SEQ ID NO.10;

[0019] ④ The encoding gene crtW for β-carotene ketolase (crtW) has the nucleotide sequence shown in SEQ ID NO.9;

[0020] ⑤ The gene encoding glycosyltransferase (crtX) is shown in SEQ ID NO.8.

[0021] Among them, CBFD and HBFD are derived from *Adonis aestivali*, crtW from *Brevundimonas sp. SD212*, and crtZ and crtX from *Pantoea ananatis*. The process of producing glycosylated astaxanthin is as follows: β-carotene is catalyzed by CBFD and HBFD or CrtW and CrtZ to be converted into astaxanthin, and then further catalyzed by CrtX to be converted into glycosylated astaxanthin.

[0022] The method for constructing the above-mentioned engineered bacteria that produce glycosylated astaxanthin includes the following steps:

[0023] (1) Construct a recombinant plasmid containing the following nucleotide fragments: hp4d promoter; tr53-CBFD-RIDD fragment; HBFD-RIAD fragment;

[0024] Among them, RIDD is the encoding gene of the short peptide RIDD, and its nucleotide sequence is shown in SEQ ID NO.5; RIAD is the encoding gene of the short peptide RIAD, and its nucleotide sequence is shown in SEQ ID NO.6;

[0025] Alternatively: Construct recombinant plasmids containing the following nucleotide fragments: crtZ, crtW;

[0026] (2) Construct recombinant plasmids containing crtX;

[0027] (3) The recombinant plasmid constructed in step (1) is transformed into Yersinia lipolytica that produces β-carotene to obtain a transformant; the recombinant plasmid constructed in step (2) is then used to transform the transformant to obtain an engineered bacterium that produces glycosylated astaxanthin.

[0028] SEQ ID NO.3:

[0029] 5’-ATGTCTGTGGCTGGAAGAACTCGAAATCTGGACATCCCCCAAATCGAGGAGGAGGAGGAGAACGTGGAGGAG CTGATTGAGCAGACCGACTCTGACATCGTGCACATCAAGAAGACCCTGGGCGGCAAGCAGTCTAAGCGACCCACTGGATCTATCGTGGCCCCTGTGTCTTGCCTGGGCATTCTGTCTATGATCGGCCCCGCCGTTTATTTCAAGTTCTCTCGACTGATGGAGGGCGGCGACATCCCCGTTGCAGAGATGGGCATTACTTTTGCTACCTTTGTGGCCGCCGCCGTGGGCACTGAATTTCTGTCTGCTTGGGTGCACAAGGAGCTGTGGCACGAGTCTCTGTGGTACATCCACAAGTCTCACCACCGATCTCGAAAGGGCCGATTCGAGTTCAACGACGTGTTCGCCATCATCAACGCCCTGCCCGCTATTGCCCTTATCAACTACGGCTTCTCTAACGAGGGCCTGCTGCCCGGAGCTTGTTTTGGAGTTGGACTGGGAACCACTGTGTGTGGCATGGCTTATATCTTTCTGCACAACGGCCTGTCTCACCGACGATTCCCCGTGTGGCTGATTGCCAATGTGCCCTATTTCCACAAGCTGGCCGCCGCCCATCAAATCCATCATTCTGGAAAGTTTCAGGGCGTGCCCTTTGGCCTGTTTCTGGGCCCTAAAGAGCTGGAGGAGGTGCGAGGAGGAACTGAGGAGCTGGAAAGAGTGATTTCTAGAACCACCAAGCGAACCCAGCCCTCTACCTAA-3’。

[0030] SEQ ID NO.4:

[0031] 5’-ATGGGCGGAACTGGCAAAGTGGGAGGATCTACTGCCCTGGCTCTGTCTAAATTCTCTCCCGACCTGCGACTG GTGATCGGCGGAAGAAATCGAGAGAAAGGCGACGCCGTGGTGTCTAAGCTGGGCGAAAATTCTGAGTTCGTGGAGGTGAACGTGGACTCTGTGCGATCTCTGGAGTCTGCCCTGGAGGACGTGGATCTGGTGGTGCATGCTGCTGGACCTTTTCAACAAGCTGAGAAGTGTACCGTGCTGGAGGCTGCCATTTCTACCCGAACTGCCTACGTGGACGTGTGCGACAATACCTCTTACTCTATGCAGGCCAAGTCTTTCCACGACAAGGCCGTGGCCGCCAATGTGCCTGCCATTACTACTGCCGGAATCTTCCCTGGCGTGTCTAACGTGATCGCCGCCGAACTGGTGAGATCTGCTCGAGATGAAAACACCGAGCCCCAGAGACTGAGATTTTCTTACTTCACCGCCGGCTCTGGCGGCGCTGGACCTACTTCTCTGGTGACTTCTTTTCTGCTGCTGGGCGAGGAGGTGGTGGCCTATTCTGAAGGAGAGAAAGTGGAGCTGAAACCCTACACCGGCAAGCTGAACATCGACTTCGGCAAGGGCGTGGGCAAACGAGATGTGTATCTGTGGAACCTGCCCGAGGTGCGATCTGGCCATGAAATTCTGGGCGTGCCTACCGTGTCTGCCAGATTTGGCACTGCCCCCTTTTTTTGGAACTGGGCCATGGTGGCCATGACCACCCTGCTGCCTCCTGGAATTCTGCGAGATAGAAATAAAATCGGCATGCTGGCCAACTTCGTGTACCCCTCTGTGCAGATCTTCGACGGCATCGGGAGAGTGTCTGGCCATGAGAGTGGACTGGAGGACCATGGAGAGTCGAGTC GCATCCTGTCTCACGAGCGACTGTGCTGCTGGTGGGCACTTCTACTGCCGTGTTTGCCATGGCCATCCTGGAGGGATCTACCCAGCCTGGCGTTTGGTTTCCTGAAGAACCCGGCGGAATTGCCATCTCTGATCGAGAGCTGCTGCTGCTGCAGAGAGCCTCTCAGGGAGCTGCTGCTGCTGCTGCTGAGGAGCATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGATTGAGGGAATTT

[0032] SEQ ID NO.5:

[0033] 5'-GGAGGAGGCGGATCTGGAGGAGGAGGATCTGGAGGAGGAGGATGCGGATCTCTGAGAGAATGTGAACTGTAT GTGCAGAAGCACAACATCCAGGCCCTGCTGAAGGACTCTATCGTGCAGCTGTGCACCGCCCGACCTGAAAGACCTATGGCTTTTCTGAGAGAGTACTTCGAGCGACTGGAGAAGGAGGAGGCCAAGTAA-3'。

[0034] SEQ ID NO.6:

[0035] 5'-GGAGGAGGAGGATCTGGAGGAGGAGGATCTGGAGGAGGAGGATGCGGACTGGAACAATATGCTAATCAGCTG GCTGATCAGATTATCAAGGAGGCCACCGAGGGCTGCTAA-3'。

[0036] SEQ ID NO.7:

[0037] 5’-GCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTA CATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCACTGATCACGGGCAAAAGTGCGTATATATACAAGAGCGTTTGCCAGCCACAGATTTTCACTCCACACACCACATCACACATACAACCACACACATCCACGATG-3’。

[0038] SEQ ID NO.8:

[0039] 5’-ATGAGCCATTTCGCGGCGATCGCACCGCCTTTTTACAGCCATGTTCGCGCATTACAGAATCTCGCTCAGGAA CTGGTCGCGCGCGGTCATCGGGTGACCTTTATTCAGCAATACGATATTAAACACTTGATCGATAGCGAAACCATTGGATTTCATTCCGTCGGGACAGACAGCCATCCCCCCGGCGCGTTAACGCGCGTGCTACACCTGGCGGCTCATCCTCTGGGGCCGTCAATGCTGAAGCTCATCAATGAAATGGCGCGCACCACCGATATGCTGTGCCGCGAACTCCCCCAGGCATTTAACGATCTGGCCGTCGATGGCGTCATTGTTGATCAAATGGAACCGGCAGGCGCGCTCGTTGCTGAAGCACTGGGACTGCCGTTTATCTCTGTCGCCTGCGCGCTGCCTCTCAATCGTGAACCGGATATGCCCCTGGCGGTTATGCCTTTCGAATACGGGACCAGCGACGCGGCTCGCGAACGTTATGCCGCCAGTGAAAAAATTTATGACTGGCTAATGCGTCGTCATGACCGTGTCATTGCCGAACACAGCCACAGAATGGGCTTAGCCCCCCGGCAAAAGCTTCACCAGTGTTTTTCGCCACTGGCGCAAATCAGCCAGCTTGTTCCTGAACTGGATTTTCCCCGCAAAGCGTTACCGGCTTGTTTTCATGCCGTCGGGCCTCTGCGCGAAACGCACGCACCGTCAACGTCTTCATCCCGTTATTTTACATCCTCAGAAAAACCCCGGATTTTCGCCTCGCTGGGCACGCTTCAGGGACACCGTTATGGGCTGTTTAAAACGATAGTGAAAGCCTGTGAAGAAATTGACGGTCAGCTCCTGTTAGCCCACTGTGGTCGTCTTACGGACTCTCAGTGTGAAGAGCTGGCGCGAAGCCGTCATACACAGGTGGTGGATTTTGCCGATCAGTCAGCCGCGCTGTCTCAGGCGCAGCTGGCGATCACCCACGGCGGCATGAATACGGTACTGGACGCGATTAATTACCGGACGCCCCTTTTAGCGCTTCCGCTGGCCTTTGATCAGCCCGGCGTCGCGTCACGCATCGTTTATCACGGCATCGGCAAGCGTGCTTCCCGCTTTACCACCAGCCATGCTTTGGCTCGTCAGATGCGTTCATTGCTGACCAACGTCGACTTTCAGCAGCGCATGGCGAAAATCCAGACAGCCCTTCGTTTGGCAGGGGGCACCATGGCCGCTGCCGATATCATTGAGCAGGTTATGTGCACCGGTCAGCCTGTCTTAAGTGGGAGCGGCTATGCAACCGCATTATGA-3’。

[0040] SEQ ID NO.9:

[0041] 5’-ATGACCGCCGCCGTCGCCGAGCCCCGAATCGTCCCCCGACAGACCTGGATTGGCCTGACCCTGGCCGGCATG ATTGTGGCCGGCTGGGGCTCCCTCCACGTCTACGGTGTCTACTTCCACCGATGGGGCACCTCTTCCCTCGTGATTGTTCCCGCTATTGTCGCTGTTCAAACCTGGCTGTCTGTTGGACTTTTTATTGTCGCTCACGACGCCATGCATGGTTCTCTGGCTCCTGGTAGACCCCGACTTAACGCTGCCGTTGGTAGATTGACCTTGGGTCTCTACGCTGGCTTTAGATTTGATAGGCTGAAAACCGCACACCATGCCCATCACGCCGCTCCTGGTACTGCTGATGATCCTGATTTTTATGCTCCTGCACCTCGTGCTTTTCTCCCTTGGTTCCTCAACTTCTTCCGAACCTACTTCGGCTGGCGAGAGATGGCCGTCCTGACCGCTCTCGTGCTGATCGCCCTGTTCGGCCTCGGCGCCCGACCCGCCAACCTGCTGACCTTCTGGGCCGCCCCCGCCCTCCTGTCCGCCCTGCAGCTGTTCACCTTCGGCACCTGGCTCCCCCACCGACACACCGACCAGCCCTTCGCCGACGCTCACCACGCCCGATCCTCTGGTTACGGCCCCGTCCTGTCGCTGCTGACCTGCTTCCACTTCGGCCGACACCACGAGCACCACCTGACCCCCTGGCGACCCTGGTGGCGACTGTGGCGAGGTGAGTCGTAA-3’。

[0042] SEQ ID NO.10:

[0043] 5'-ATGCTGTGGATTTGGAACGCCCTGATTGTCTTTGTTACTGTTATCGGTATGGAAGTGATTGCTGCTCTCGCT CACAAGTACATTATGCACGGCTGGGTGGGGCTGGCACCTGTCCCACCACGAGCCCCGAAAGGGCGCCTTCGAGGTCAACGACCTGTACGCCGTCGTCTTCGCCGCCCTGTCCATCCTGCTGATCTACCTGGGCTCCACCGGCATGTGGCCACTGCAGTGGATCGGTGCCGGAATGACCGCCTACGGCCTGCTGTACTTCATGGTCCACGACGGCCTGGTCCACCAGCG ATGGCCCTTCCGATACATCCCCGAAAGGGCTACCTGAAGCGACTGTACATGGCCCACCGAATGCACCACGCCGTCCGAGGCAAGGAGGGCTGCGTCTCTTTCGGCTTCCTGTACGCCCCCCTGTCCAAGCTGCAGGCCACCCTGCGAGAGCGACATGGTGCTAGAGCTGGCGCCGCCCGAGACGCTCAGGGAGGTGAGGATGAGCCTGCTTCCGGAAAGTAA-3'.

[0044] The engineered bacteria that produce glycosylated astaxanthin are used in the preparation of glycosylated astaxanthin. Specifically, the engineered bacteria that produce glycosylated astaxanthin are cultured, and then glycosylated astaxanthin is extracted.

[0045] A method for preparing glycosylated astaxanthin: culturing the above-mentioned engineered bacteria that produce glycosylated astaxanthin or the engineered bacteria that produce glycosylated astaxanthin constructed using the above method, and extracting glycosylated astaxanthin.

[0046] Further, the method for preparing glycosylated astaxanthin specifically comprises: inoculating engineered bacteria producing glycosylated astaxanthin into a culture medium to obtain a seed culture; inoculating the seed culture into a culture medium to obtain a fermentation broth; taking the fermentation broth, centrifuging to obtain a bacterial precipitate and a fermentation supernatant, and extracting the bacterial precipitate to obtain glycosylated astaxanthin. The culture conditions for the seed culture can be: 30℃, 200 rpm for 24 hours; the inoculum size of the seed culture can be 2%; the culture medium can be YPD medium; and the culture conditions for the fermentation broth can be: 30℃, 200 rpm for 84 hours.

[0047] This invention utilizes *Yersinia lipolytica* as a host for carotenoid synthesis, offering unique advantages: First, *Yersinia lipolytica* can synthesize large amounts of acetyl-CoA as a precursor for the MVA pathway, which is more conducive to carotenoid accumulation. Second, yeast cells accumulate a large amount of lipids, forming a favorable hydrophobic space that can potentially store lipophilic carotenoids. Third, *Yersinia lipolytica* has low requirements for its growth environment, can use a variety of low-cost carbon sources as its culture medium, and exhibits high osmotic pressure and strong tolerance to various pH values. Furthermore, this strain has a clear genetic background, and relatively complete genetic metabolic modification tools have been developed in recent years, making it an ideal industrial host strain for accumulating glycosylated astaxanthin and other carotenoids.

[0048] This invention marks the first time that glycosylated astaxanthin has been produced in *Yarrowia lipolytica*. Astaxanthin can be synthesized from β-carotene through the combined action of CBFD and HBFD or CrtW and CrtZ. This synthetic pathway is unique compared to the astaxanthin synthesis pathways in microorganisms and algae, and has currently only been verified in *E. coli*. HBFD acts only on carotenoids with a 4-hydroxy-β ring, while CBFD cannot hydroxylate the 3rd carbon of the unmodified β ring or the 4-hydroxy-β ring. This characteristic allows for strict control of the catalytic reaction sequence, contributing to the efficient synthesis of astaxanthin without the formation of hydroxyl-containing intermediates, which is highly beneficial for the production, extraction, and purification of glycosylated astaxanthin.

[0049] This invention utilizes synthetic biology techniques to introduce the gene required for synthesizing glycosylated astaxanthin into *Yarrowia lipolytica*, a β-carotene-producing yeast, thereby obtaining a strain that produces glycosylated astaxanthin. By employing metabolic engineering strategies to regulate the astaxanthin yield in this engineered strain, the yield of glycosylated astaxanthin produced by yeast fermentation was ultimately increased. The engineered strain OUC-AdGHB1-7CJ, screened by this invention, achieved a glycosylated astaxanthin yield of 27.274 mg / L, making it the engineered strain with the highest glycosylated astaxanthin yield. This provides feasibility for the efficient synthesis of other glycosylated carotenoids in microorganisms and lays the foundation for industrial production.

[0050] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0051] The engineered strain for producing glycosylated astaxanthin of this invention is named OUC-AdGHB1-7CJ, with a deposit date of August 1, 2022. The depository institution is the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.25446. The classification name is Yarrowia lipolytica, and the depository address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0052] Figure 1 Liquid phase analysis of fermentation samples from strains F-A1 and F-A2.

[0053] Figure 2 Liquid phase analysis of fermentation samples from strains F-A3, F-A4, F-A5, F-X1, F-X2, and F-X3.

[0054] Figure 3 Schematic diagram of astaxanthin yield determination results for strains F-A2, F-A3, and F-A4.

[0055] Figure 4 Schematic diagram of astaxanthin yield determination results for strain F-A5.

[0056] Figure 5 Schematic diagram of the results of glycosylated astaxanthin production determination in strain F-X3.

[0057] Figure 6 Schematic diagram of the glycosylated astaxanthin yield determination results of strains F-X1, F-X2, and F-X3. Detailed Implementation

[0058] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0059] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0060] The *Yarrowia lipophila* strain Polh involved in this invention, and the pMT015 plasmid involved, were donated by Wang Shi'an of the Qingdao Institute of Bioenergy and Bioengineering, Chinese Academy of Sciences.

[0061] The strain F0 involved in this invention was obtained by introducing the carB (phytopene dehydrogenase) and carRP (lycopene cyclase / phytopene synthase) genes into *Yersinia lipolytica* Polh. Its β-carotene yield was 21.2 mg / L. The specific construction method is as follows: The carB and carRP genes were synthesized in their entirety by Sangon Biotech (Shanghai) Co., Ltd. Using the synthesized genes as templates, the carB and carRP gene fragments were amplified by PCR. Using pMT015 plasmid as a template, the plasmid backbone was amplified by PCR and ligated using homologous recombination seamless splicing technology. The recombinant plasmid was transformed into *E. coli* DH5α competent cells, and the plasmid was extracted using a rapid plasmid miniprep kit. The plasmid was linearized by PCR, and the linear DNA fragment was randomly inserted into the *Yersinia lipolytica* genome using chemical transformation. The strain with the highest β-carotene yield was screened by high-performance liquid chromatography (HPLC), which is designated as F0. References for the specific methods involved in constructing strain F0: Zhang Guilin. Construction and regulation of β-carotene synthesis pathway in Yersinia lipolytica: [Master's Thesis]. Qingdao: Ocean University of China, 2022.

[0062] The strain F1 involved in this invention was obtained by transforming the ERG12S gene from *Saccharomyces cerevisiae*, the modularized IDI-GGS1 gene, the modularized ERG20Y-GGS1 gene, and the mvaE-mvaSMT gene from *Enterococcus faecalis* into strain F0. The strain with the highest β-carotene production was obtained by screening using high-performance liquid chromatography (HPLC), and its β-carotene production was 607.1 mg / L. For specific construction methods, please refer to: Zhang Guilin. Construction and Regulation of β-Carotene Synthesis Pathway in *Yacinthia lipolytica*: [Master's Thesis]. Qingdao: Ocean University of China, 2022.

[0063] The relevant strains and construction strains used in this invention are described in Table 1. The specific primers used in this invention are shown in Table 2.

[0064] Table 1

[0065] E. coli DH5α Clone plasmid TsingKe F0(Y.lipolytica PO1h-β) carB-carRP Laboratory construction F-A1-1 CBFD-HBFD-URA This invention constructs F-A1-2 tr53-CBFD-tr45-HBFD-URA This invention constructs F-A2 tr53-CBFD-HBFD-URA This invention constructs F-A3 tr53-CBFD-RIDD-HBFD-RIAD-URA This invention constructs F-A4 <![CDATA[P hp4d -tr53-CBFD-RIDD-HBFD-RIAD-URA]]> This invention constructs F-A5 crtW-crtZ-URA This invention constructs F-X1 tr53-CBFD-HBFD+crtX-URA This invention constructs F-X2 <![CDATA[P hp4d -tr53-CBFD-RIDD-HBFD-RIAD+crtX-URA]]> This invention constructs F-X3 crtW-crtZ-URA+crtX-URA This invention constructs Pub4-cre Cre plasmid Laboratory construction

[0066] Table 2

[0067]

[0068]

[0069]

[0070] Example 1: Construction of astaxanthin-producing strain F-A1

[0071] The enzymes CBFD and HBFD catalyze the reaction of β-carotene to produce astaxanthin. Therefore, in this embodiment, the CBFD and HBFD genes are further integrated into the engineered strain F0 that produces β-carotene to construct a chassis strain that produces astaxanthin.

[0072] (I) Construction of pMT-1 plasmid

[0073] (1) The CBFD gene derived from *Calendula officinalis* was codon-optimized based on the preference of *Yarrowia lipolytica*, and the optimized nucleotide sequence is shown in SEQ ID NO.1. The gene fragment was then artificially synthesized by Beijing Liuhe BGI Genomics Co., Ltd. Using the synthesized gene fragment as a template, a 921 bp CBFD fragment was amplified by PCR using primers CBFD-1-F / CBFD-1-R and the P525 enzyme.

[0074] Using plasmid pMT015 as a template, PCR amplification was performed with primers PMT-1-F / PMT-1-R to obtain plasmid backbone 1 of 8422 bp. The plasmid backbone 1 was recovered using a PCR recovery kit. The recovered CBFD fragment and plasmid backbone 1 were ligated using homologous recombination seamless splicing technology to obtain plasmid pMT-a.

[0075] (2) The HBFD gene, derived from *Calendula officinalis*, was codon-optimized based on the preference of *Yarrowia lipolytica*. The optimized nucleotide sequence is shown in SEQ ID NO.2. The gene fragment was then artificially synthesized by Beijing Liuhe BGI Genomics Co., Ltd. Using the synthesized gene fragment as a template, a 1221 bp HBFD fragment was amplified by PCR using primers HBFD-1-F / HBFD-1-R and the P525 enzyme.

[0076] Using plasmid pMT-a as a template, PCR amplification was performed with primers PMT-2-F / PMT-2-R to obtain plasmid backbone 2 of 9187 bp. The HBFD fragment was recovered using a PCR recovery kit, and the recovered HBFD fragment and plasmid backbone 2 were ligated using homologous recombination seamless splicing technology to obtain plasmid pMT-1.

[0077] SEQ ID NO.1:

[0078] 5’-ATGGCAATTTCAGTGTTCAGTTCAGGTTATTCTTTCTACAAGAATCTCTTGTTGGACTCAAAACCAAATATT CTCAAACCCCCATGCCTGCTATTCTCTCCAGTTGTGATCATGTCGCCTATGAGAAAGAAAAAGAAACATGGTGATCCATGTATCTGCTCCGTTGCAGGGAGAACAAGGAACCTTGATATTCCTCAAATTGAAGAAGAGGAAGAGAATGTGGAAGAACTAA TAGAACAGACCGATTCTGACATAGTGCATATAAAGAAAACACTAGGGGGGAAACAATCAAAACGGCCCACTGGCTCCATTGTCGCACCCGTATCTTGTCTTGGGATCCTTTCAATGATTGGACCTGCTGTTTACTTCAAGTTTTCACGGCTAATGGAGGGTGGAGATATACCTGTAGCAGAAATGGGGATTACGTTTGCCACCTTTGTTGCTGCTGCTGTTGGCACGGAGTTTTTGTCAGCATGGGTTCACAAAGAACTCTGGCACGAGTCTTTGTGGTACATTCACAAGTCTCACCATCGGTCACGAAAAGGCCGCTTCGAGTTCAATGATGTGTTTGCTATTATTAACGCGCTTCCCGCTATTGCTCTTATCAATTATGGATTCTCCAATGAAGGCCTCCTTCCTGGAGCGTGCTTTGGTGTCGGTCTTGGAACAACAGTCTGTGGTATGGCTTACATTTTTCTTCACAATGGCCTATCACACCGAAGGTTCCCAGTATGGCTTATTGCGAACGTCCCTTATTTCCACAAGCTGGCTGCAGCTCACCAAATACACCACTCAGGAAAATTTCAGGGTGTACCATTTGGCCTGTTCCTTGGACCCAAGGAATTGGAAGAAGTAAGAGGAGGCACTGAAGAGTTGGAGAGGGTAATCAGTCGTACAACTAAACGAACGCAACCATCTACC-3’。

[0079] SEQ ID NO.2:

[0080]

[0081] (II) Construction of astaxanthin-producing strain F-A1

[0082] The pMT-1 plasmid was linearized by PCR, and the linearized target fragment was transformed into strain F0 to obtain engineered strain F-A1. Fermentation was then performed on F-A1, and the yields of astaxanthin and other carotenoids were measured. The specific steps are as follows:

[0083] (A) Plasmid linearization

[0084] Using pMT-1 plasmid as a template, the target fragment was linearized by PCR using primers 1-F / 1-R, and then recovered using a PCR recovery kit to obtain the linearized target fragment.

[0085] (B) Transformation

[0086] The recovered linearized fragments were chemically transformed into the β-carotene-producing Yersinia lipolytica strain F0, with the following specific steps:

[0087] (1) Inoculate F0 into YPD medium (10 mL) and incubate at 30°C and 200 rpm for 36 h in a temperature-controlled shaker;

[0088] (2) Collect an appropriate amount of bacterial cells, resuspend them in about 1 mL of 1×TE buffer, centrifuge at 3000g for 2 min, discard the supernatant, resuspend them in about 1 mL of 0.1M LiAc solution, incubate at 30℃ for 1 h, centrifuge at 3000g for 2 min, and discard the supernatant.

[0089] (3) Add about 200 μL of 0.1 M LiAc solution to resuspend to a suitable concentration (refer to the concentration of competent E.coli DH5α, etc.), and dispense 40 μL / tube;

[0090] (4) Add 3 μL of fish sperm DNA and 3 μg of linear target fragment to each tube of competent cells, mix well by pipetting, and incubate at 30°C for 15 min.

[0091] (5) Add 350 μL PEG-LiAc (315 μL of 50% PEG and 35 μL of 1M LiAc) and 16 μL of 1M DTT, and incubate at 30℃ for 1 h.

[0092] (6) Add 40 μL DMSO, heat shock at 39℃ for 10 min, add 600 μL LiAc, and let stand at room temperature for 30 min;

[0093] (7) Centrifuge at 3000g for 2 min, discard part of the supernatant, keep about 100 μL of the remaining bacterial solution, mix well, spread on SD-URA plates, and incubate upside down in a 30℃ incubator for 3 days;

[0094] (8) Pick 20 single colonies with a darker red color from the URA plate with bacteria and inoculate them into a new SD-URA plate. Incubate in an inverted incubator at 30°C for 24 hours.

[0095] (C) Fermentation of the strain and determination of cell dry weight

[0096] Ten colonies were picked from the SD-URA plate in (8) above and inoculated into 10 mL of YPD medium. The culture was then incubated at 30°C and 200 rpm for 24 h to obtain seed culture. 1 mL of seed culture was added to 50 mL of YPD medium and incubated at 30°C and 200 rpm for 84 h.

[0097] After fermentation, 1 mL of the engineered strain was placed in a preservation tube containing 500 μL of 50% glycerol and stored at -20°C. Then, 2 mL of the bacterial solution was added to a 2 mL pre-weighed EP tube, centrifuged at 12000 rpm for 2 min, the supernatant was discarded, the tube was opened and placed in an 80°C oven for 24 h, weighed, and placed for another 1 h, weighed again, until the weight changed. The cells were then removed and the dry weight was calculated based on the weight change.

[0098] (D) Extraction and detection of fermentation products

[0099] Add 500 μL of the remaining bacterial culture to a 2 mL grinding tube, centrifuge at 12000 rpm for 3 min, discard the supernatant, add 1 mL of methyl tert-butyl ether, mix well, and grind in a grinder according to a program of 65 Hz, 120 s / 0 Hz, 10 s, 10 cycles. After grinding, centrifuge at 12000 rpm for 3 min, take the supernatant solution into a 5 mL centrifuge tube, blow the supernatant dry using nitrogen blowing, and reconstitute with 500 μL of acetone solution. Filter the reconstituted solution through a 0.22 μm organic filter membrane for detection.

[0100] Fermentation products were detected by high-performance liquid chromatography (HPLC). The detection conditions were as follows: column: C18 HPLC column; column temperature: 35℃; flow rate: 0.9 mL / min; injection volume: 20 μL; detection wavelength: 470 nm; detection time: 45 min; mobile phase: A: water, B: acetonitrile, tetrahydrofuran (1:1); elution gradient (min-%A): 0-95; 5-95; 15-20; 24-20; 25-0; 35-0; 40-95; 45-95.

[0101] The peak times for glycosylated astaxanthin, astaxanthin, β-carotene, and lycopene were 18.4, 23.2, 34.0, and 33.3 min, respectively.

[0102] Accurately weigh a certain amount of astaxanthin standard, dissolve it in acetone, and dilute it by different factors. Measure the peak area of ​​the standard at different concentrations using high-performance liquid chromatography (HPLC) as described above. Plot a standard curve based on the standard concentration and peak area. Substitute the peak area of ​​the sample extracted from the test bacteria, as determined by HPLC, into the standard curve to obtain the astaxanthin content of the test bacteria (mg / L, specifically the astaxanthin content per liter of bacterial solution).

[0103] Liquid chromatography analysis results showed that none of the 10 strains produced astaxanthin. The liquid chromatography analysis of the fermentation broth of strain F-A1 is shown in the figure below. Figure 1 As shown. Considering that CBFD and HBFD originate from plants, the complete protein sequences were analyzed using TargetP-2.0, and the sequences of chloroplast transport peptides in CBFD and HBFD were predicted. CBFD and HBFD may contain chloroplast transport peptides that affect enzyme expression. Therefore, in order to obtain astaxanthin-producing strains, the chloroplast transport peptide sequences of CBFD and HBFD will be removed in the following experiments.

[0104] Example 2: Construction of astaxanthin-producing strain F-A2 with chloroplast transport peptides removed

[0105] (I) Construction of CBFD and HBFD plasmids pMT-2 with chloroplast transport peptides removed

[0106] The amino acid sequences of CBFD and HBFD were used to predict chloroplast transport peptides. Based on the prediction results, the chloroplast transport peptide sequences of CBFD and HBFD were removed respectively. Using primers CBFD-2-F / CBFD-2-R, a 768 bp tr53-CBFD fragment (the nucleotide sequence with the chloroplast transport peptide sequence removed is shown in SEQ ID NO.3) was amplified using primers HBFD-2-F / HBFD-2-R, and a tr45-HBFD fragment (the nucleotide sequence with the chloroplast transport peptide sequence removed is shown in SEQ ID NO.4) was amplified using primers HBFD-2-F / HBFD-2-R, using the HBFD gene as a template.

[0107] Using primers PMT-3-F / PMT-3-R, plasmid backbone 3 (9507 bp) was amplified using plasmid pMT-1 as a template. The amplified tr53-CBFD fragment and plasmid backbone 3 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-2-1. Using primers PMT-10-F / PMT-10-R, plasmid backbone 10 was amplified using plasmid pMT-2-1 as a template. The amplified tr45-HBFD fragment and plasmid backbone 10 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-2-2.

[0108] (II) Effects of chloroplast transport peptide removal from CBFD and HBFD on astaxanthin production

[0109] The pMT-2-1 and pMT-2-2 plasmids were linearized by PCR using primers 1-F / 1-R. The linearized target fragments were transformed into strain F0 to obtain engineered strains F-A2-1 and F-A2-2. (Note: After transforming strain F0 with pMT-2-1, the strains were plated on SD-URA-deficient medium. After 3 days, the 20 transformants with the deepest red color were selected and transferred to a new SD-URA-deficient medium. After 24 hours, the 10 transformants with the deepest red color were selected and inoculated into 50 mL of liquid YPD medium. The strains were cultured at 200 rpm and 30 °C for 84 hours. All 10 strains produced astaxanthin. The strain with the highest astaxanthin production was named F-A2-1.) (Similarly, F-A2-2 and the strains in the following examples were obtained in the same way unless otherwise specified.) The strains were fermented to determine the production of astaxanthin and other carotenoids.

[0110] Liquid chromatography-mass spectra of the fermentation broths of strains F-A2-1 and F-A2-2 are shown below. Figure 1 As shown, strain F-A2-1 produced astaxanthin. The astaxanthin content determination results are as follows... Figure 3 As shown, strain F-A2-1 produced 0.597 mg / L (0.054 mg / g DCW) of astaxanthin, while strain F-A2-2 did not produce astaxanthin. This indicates that CBFD is active in removing predicted chloroplast transport peptides, while HBFD is inactive. Strain F-A2-1 also accumulated a relatively large amount of β-carotene, but the conversion rate of β-carotene was low, which may be due to the low expression levels of CBFD and HBFD. To increase astaxanthin production, CBFD and HBFD need to be modified.

[0111] Example 3: Construction of astaxanthin-enhancing strains F-A3 and F-A4

[0112] Constructing multi-enzyme complexes can prevent intermediate product diffusion, increase the yield of final products, and control metabolite flux. Modular assembly of CBFD and HBFD can be achieved using a pair of short peptide tags (RIAD and RIDD). Expression of the tr53-CBFD-RIDD-HBFD-RIAD enzyme complex in the β-carotene-producing strain F0 can increase astaxanthin yield; increasing promoter strength can improve gene transcription levels, thereby increasing enzyme expression. Replacing the CBFD promoter with the stronger hp4d promoter can also increase astaxanthin yield, as detailed below:

[0113] (I) Construction of CBFD and HBFD modular assembly plasmid pMT-3

[0114] The gene sequences of the short peptide RIDD (its nucleotide sequence is shown in SEQ ID NO.5) and RIAD (its nucleotide sequence is shown in SEQ ID NO.6) were synthesized together with tr53-CBFD and HBFD (artificial synthesis was commissioned to Beijing Liuhe Huada Genomics Co., Ltd.). Using the synthesized fragments as templates, a 1032bp tr53-CBFD-RIDD fragment was obtained by PCR amplification using primers CBFD-3-F / CBFD-3-R and P525 enzyme; a 1374bp HBFD-RIAD fragment was obtained by PCR amplification using primers HBFD-3-F / HBFD-3-R and P525 enzyme.

[0115] Plasmid backbone 4 was amplified using primers PMT-4-F / PMT-4-R with plasmid pMT015 as a template. The amplified tr53-CBFD-RIDD fragment and plasmid backbone 4 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct plasmid pMT-b.

[0116] Plasmid backbone 5 was amplified using primers PMT-5-F / PMT-5-R with plasmid pMT-b as a template. The amplified HBFD-RIAD fragment and plasmid backbone 5 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-3.

[0117] (II) Construction of plasmid pMT-4 with CBFD promoter replacement

[0118] The hp4d sequence (its nucleotide sequence is shown in SEQ ID NO.7) was synthesized by Beijing Liuhe BGI Genomics Co., Ltd., and used as a template to amplify the hp4d fragment using primers hp4d-1-F / hp4d-1-R.

[0119] Plasmid backbone 6 was amplified using primers PMT-6-F / PMT-6-R with plasmid pMT-3 as a template. The amplified hp4d fragment and plasmid backbone 6 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-4.

[0120] (III) The impact of modular assembly of CBFF and HBFD and CBFD promoter replacement on astaxanthin production

[0121] The pMT-3 plasmid was linearized by PCR using primers 1-F / 1-R. The linearized target fragment was transformed into strain F0 to obtain engineered strain F-A3. The strain was then fermented, and the yields of astaxanthin and other carotenoids were determined.

[0122] The pMT-4 plasmid was linearized by PCR using primers 1-F / 1-R. The linearized target fragment was transformed into strain F0 to obtain engineered strain F-A4. The strain was then fermented, and the yields of astaxanthin and other carotenoids were determined.

[0123] All of the above were performed according to the method in Example 1.

[0124] Liquid chromatography-masses of the fermentation broths of strains F-A3 and F-A4 are shown below. Figure 2 As shown in Figure A, strains F-A3 and F-A4 both produced astaxanthin. The results of the astaxanthin content determination are as follows... Figure 3 As shown, the astaxanthin yields of strains F-A3 and F-A4 were 1.112 mg / L and 1.480 mg / L, respectively, which were 86.3% and 1.48 times higher than those of strain F-A2-1. Among them, strain F-A4 had the highest astaxanthin yield of 1.480 mg / L, with a yield of 0.142 mg / g DCW per cell.

[0125] Example 4: Construction of glycosylated astaxanthin-producing strains F-X1 and F-X2

[0126] The crtX gene from *Pantoea ananatis* ATCC 19321, which has been verified by in vitro enzymatic testing to synthesize glycosylated astaxanthin from UDP-glucose and astaxanthin, was transferred into *Yarrowia lipolytica* F-A2-1 and F-A4, which produce astaxanthin, to produce glycosylated astaxanthin. The specific method is as follows:

[0127] (I) Construction of pMT-5 plasmid

[0128] The crtX gene, derived from Pantoea ananatis ATCC 19321, was codon-codon-derived, and the optimized nucleotide sequence is shown in SEQ ID NO.8. The gene fragment was synthesized by Beijing Liuhe Huada Genomics Co., Ltd. Using the synthesized gene fragment as a template, a 1296bp crtX fragment was amplified using primers crtX-1-F / crtX-1-R.

[0129] Using primers PMT-9-F / PMT-9-R, a plasmid backbone 9 of 8275 bp was amplified using plasmid pMT015 as a template. The amplified crtX fragment and plasmid backbone 9 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-5.

[0130] (II) Construction of glycosylated astaxanthin-producing strains F-X1 and F-X2

[0131] The pMT-5 plasmid was linearized by PCR using primers 2-F / 2-R. The linearized target fragment was transformed into strain F-A2-1 to obtain engineered strain F-X1. The linearized target fragment was transformed into strain F-A4 to obtain engineered strain F-X2. The strains were then fermented to determine the yield of glycosylated astaxanthin and other carotenoids.

[0132] All of the above were performed according to the method in Example 1.

[0133] Liquid chromatography-mass spectra of the fermentation broths of strains F-X1 and F-X2 are shown below. Figure 2 As shown in Figure B, both strains F-X1 and F-X2 produced glycosylated astaxanthin at 18.4 min. The results of the glycosylated astaxanthin content determination are as follows... Figure 6 As shown, the yield of glycosylated astaxanthin in strain F-X1 was 0.741 mg / L, while the yield of glycosylated astaxanthin in strain F-X2 was 1.157 mg / L, which was 56.2% higher than that of strain F-X1.

[0134] Example 5: Construction of astaxanthin-producing strain F-A5 from bacterial sources CrtW and CrtZ

[0135] (I) Construction of crtW and crtZ plasmid pMT-6

[0136] The crtW gene from Brevundimonas sp. SD212 and the crtZ gene from Pantoea ananatis were codonized, and the optimized nucleotide sequences are shown in SEQ ID NO. 9 and 10, respectively. The gene fragments were synthesized by Beijing Liuhe Huada Genomics Co., Ltd. Using the synthesized gene fragments as templates, the crtW and crtZ fragments were amplified using primers crtW-1-F / crtW-1-R and crtZ-1-F / crtZ-1-R, respectively. The plasmid backbone 7 was obtained by amplification using primers PMT-7-F / PMT-7-R with plasmid pMT015 as a template. The crtW fragment and backbone 7 were then connected using homologous recombination seamless splicing technology to construct plasmid pMT-c.

[0137] Plasmid backbone 8 was amplified using primers PMT-8-F / PMT-8-R with plasmid pMT-c as a template. The amplified crtZ fragment and plasmid backbone 8 were recovered by PCR and ligated using homologous recombination seamless splicing technology to construct pMT-6.

[0138] (II) Construction of astaxanthin-producing strains CrtW and CrtZ derived from bacteria

[0139] The pMT-6 plasmid was linearized by PCR using primers 1-F / 1-R. The linearized target fragment was transformed into strain F1 to obtain engineered strain F-A5 (a total of 10 strains were obtained, named F-A5-1 to F-A5-10 respectively). The strains were fermented to determine the yield of astaxanthin and other carotenoids.

[0140] All of the above were performed according to the method in Example 1.

[0141] The liquid chromatography-mass spectra of the fermentation broth of the strain are shown below. Figure 2 As shown in Figure A, strain F-A5 produced astaxanthin ( Figure 2 strain F-A5 in A, specifically F-A5-8, such as Figure 4 The strain with the highest astaxanthin production, F-A5-8, produced 79.077 mg / L (7.567 mg / g DCW) of astaxanthin.

[0142] Example 6: Construction of glycosylated astaxanthin-producing strain F-X3 from bacterial sources

[0143] The crtX gene from *Pantoea ananatis* ATCC 19321, which has been verified by in vitro enzymatic testing to synthesize glycosylated astaxanthin from UDP-glucose and astaxanthin, was transferred into *Yarrowia lipolytica* F-A5, a yeast strain that produces astaxanthin, to produce glycosylated astaxanthin. The specific method is as follows:

[0144] The pMT-6 plasmid was linearized by PCR using primers 2-F / 2-R. The linearized target fragment was transformed into strain F-A5-8 to obtain engineered strain F-X3 (a total of 10 strains were obtained, temporarily named F-X3-1 to F-X3-10). Fermentation was carried out on the strains (10 colonies were picked and inoculated into 10 mL of YPD medium, and cultured at 30℃ and 200 rpm for 24 h to obtain seed culture; 1 mL of seed culture was added to 50 mL of YPD medium and cultured at 30℃ and 200 rpm for 84 h). The yield of glycosylated astaxanthin and other carotenoids was measured.

[0145] All of the above were performed according to the method in Example 1.

[0146] The liquid chromatography-mass spectra of the fermentation broth of the strain are shown below. Figure 2 As shown in Figure B, strain F-X3 produces glycosylated astaxanthin. The results of the glycosylated astaxanthin content determination for strain F-X3 are presented below. Figure 5 and Figure 6 As shown ( Figure 6F-X3 in this invention refers to strain F-X3-7. Among these strains, F-X3-7 exhibited the highest yield of glycosylated astaxanthin at 27.274 mg / L, significantly higher than other strains (the yields of the other nine strains F-X3-1, 2, 3, 4, 5, 6, 8, 9, and 10 were 8.079 mg / L, 7.975 mg / L, 7.445 mg / L, 7.066 mg / L, 6.909 mg / L, 6.666 mg / L, 7.035 mg / L, 9.044 mg / L, and 7.514 mg / L, respectively). This strain was deposited in this invention and formally named OUC-AdGHB1-7CJ. The deposit date was August 1, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.25446, and classified as *Yarrowia lipolytica*. The depositary address for *lipolytica* is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0147] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. An engineered bacterium producing glycosylated astaxanthin, characterized in that: The strain, named OUC-AdGHB1-7CJ, was deposited on August 1, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 25446, and classified as *Yersinia lipolytica*. Yarrowia lipolytica ).

2. The application of the engineered bacteria for producing glycosylated astaxanthin as described in claim 1 in the preparation of glycosylated astaxanthin.

3. The application according to claim 2, characterized in that: In practical applications, engineered bacteria that produce glycosylated astaxanthin are cultured and then extracted to obtain glycosylated astaxanthin.

4. The application according to claim 3, characterized in that, The specific cultivation method is as follows: engineered bacteria that produce glycosylated astaxanthin are inoculated into a culture medium and cultured to obtain a seed culture solution; the seed culture solution is inoculated into a culture medium and cultured to obtain a fermentation broth; the fermentation broth is taken, centrifuged to obtain a bacterial precipitate and a fermentation supernatant, and the glycosylated astaxanthin is obtained by extracting the bacterial precipitate.

5. The application according to claim 3, characterized in that, The conditions for culturing the seed culture medium are: 30℃, 200 rpm for 24 hours; the inoculum size of the seed culture medium is 2%; and the conditions for culturing the fermentation broth are: 30℃, 200 rpm for 84 hours.

6. An engineered bacterium producing glycosylated astaxanthin, characterized in that: The host is *Yarrowia lipolytica*, a β-carotene-producing yeast, whose genome contains the following genes ①②⑤ or ③④⑤: ① The gene encoding carotenoid 4-hydroxy-β-cyclic 4-dehydrogenase HBFD The nucleotide sequence is shown in SEQ ID NO.2; ②The gene encoding carotenoid β-cyclic 4-dehydrogenase, which has been removed from chloroplast transport peptides, was also removed. tr53-CBFD The nucleotide sequence is shown in SEQ ID NO.3; its promoter is the hp4d promoter, and the nucleotide sequence is shown in SEQ ID NO.

7. ③The gene encoding β-carotene hydroxylase crtZ The nucleotide sequence is shown in SEQ ID NO.10; ④ The gene encoding β-carotene ketolase crtW The nucleotide sequence is shown in SEQ ID NO.9; ⑤ Genes encoding glycosyltransferases crtX The nucleotide sequence is shown in SEQ ID NO.

8.

7. The method for constructing the engineered bacteria producing glycosylated astaxanthin according to claim 6, characterized in that, Includes the following steps: (1) Construct a recombinant plasmid containing the following nucleotide fragment: hp4d promoter; tr53-CBFD-RIDD Fragment; HBFD- RIAD Fragment; in, RIDD This is the gene encoding the short peptide RIDD, and its nucleotide sequence is shown in SEQ ID NO.5; RIAD The gene encoding the short peptide RIAD has the nucleotide sequence shown in SEQ ID NO.6; Alternatively: Construct a recombinant plasmid containing the following nucleotide fragments: crtZ, crtW ; (2) Constructing a structure containing crtX Recombinant plasmids; (3) The recombinant plasmid constructed in step (1) is transformed into Yersinia lipolytica that produces β-carotene to obtain a transformant; the recombinant plasmid constructed in step (2) is then used to transform the transformant to obtain an engineered bacterium that produces glycosylated astaxanthin. The β-carotene-producing *Yersinia lipolytica* strain F0 was introduced into *Yersinia lipolytica* Polh. carB and carRP Acquired through genes.

8. The application of the engineered bacteria for producing glycosylated astaxanthin as described in claim 6 in the preparation of glycosylated astaxanthin.

9. The application according to claim 8, characterized in that: In practical applications, engineered bacteria that produce glycosylated astaxanthin are cultured and then extracted to obtain glycosylated astaxanthin.

10. A method for preparing glycosylated astaxanthin, characterized in that: Glycosylated astaxanthin is obtained by culturing the engineered bacteria that produce glycosylated astaxanthin as described in claim 1 or the engineered bacteria that produce glycosylated astaxanthin as described in claim 6.

Images