Bacillus licheniformis wjj and application thereof in degrading thiosulfate

Abstract

The application discloses bacillus licheniformis WJJ and application of the bacillus licheniformis WJJ in degradation of thiosulfate, and provides the bacillus licheniformis WJJ from saline-alkali soil sludge, has high efficient degradation effect on thiosulfate, and can more completely convert pollutants into recyclable materials such as sulfur element; meanwhile, the strain can also tolerate pH=9.5 and 1.0 mol / L total sodium salt concentration, is favorable to improving the removal capacity of thiosulfate wastewater, and has wide application prospect in biological purification of industrial wastewater.The bacillus licheniformis can completely degrade thiosulfate into sulfur element and sulfate, and the removal rate of the bacillus licheniformis on thiosulfate within 5000 mg / L is up to 100%.

Description

(I) Technical Field

[0001] This invention relates to a Bacillus licheniformis WJJ and its application in the degradation of thiosulfate. (II) Background Technology

[0002] Thiosulfate is commonly used in many industrial processes. For example, it is used as a fixative for silver complexation in film processing or as a starting material in the synthesis of liquid polysulfide polymers. In the mining industry, it can be used as a substitute for cyanide to improve the leaching rate of precious metals from its ores. In each of these cases, thiosulfate ultimately becomes part of the process wastewater, and direct discharge would inevitably cause serious harm to the environment and public health. Thiosulfate has complex biochemical mechanisms; high concentrations can threaten the growth and metabolism of microorganisms. A sudden increase in thiosulfate concentration can reduce microbial activity, and high-concentration thiosulfate wastewater will have a foul odor, while also increasing the COD content and overall pH of the wastewater, making the degradation of pollutants in the wastewater more difficult. Therefore, it needs to undergo desulfurization treatment before being discharged.

[0003] Chemical treatment methods, such as wet air oxidation or photocatalytic oxidation, have been developed for removing thiosulfate from wastewater streams. However, biological processes are generally considered a cost-effective alternative, in which thiosulfate can be oxidized by chemoautotrophic sulfur-oxidizing bacteria. Some oxidation products are biogenic elemental sulfur, which can be recycled for use in the production of fertilizers and sulfuric acid. Furthermore, to improve the removal capacity and efficiency of thiosulfate, bacteria tolerant to high salt and alkali conditions are more advantageous than those with neutral pH.

[0004] Therefore, screening for highly efficient halophilic and alkaliphilic bacteria that degrade thiosulfate from the environment is essential for environmental health. Literature review currently focuses on the degradation of thiosulfate-containing wastewater by Thiobacillus thioparus and Halothiobillus neapolitanus, with no reports found on the efficient degradation of thiosulfate by Bacillus licheniformis using thiosulfate as the sole sulfur source. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a novel halophilic and alkaliphilic strain—Bacillus licheniformis—and its application in the degradation of thiosulfate. This strain can degrade thiosulfate using thiosulfate as the sole sulfur source to produce elemental sulfur. It is also tolerant to salt and alkali environments, easy to scale up, and has the advantages of high efficiency and strong removal capacity. It is of great significance for the efficient purification of thiosulfate pollutants in industrial wastewater.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a thiosulfate-degrading bacterium—Bacillus licheniformis WJJ, deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M 20221017, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of Bacillus licheniformis WJJ of this invention are: the colonies are orange-yellow with neat edges, opaque, easy to pick up, and the bacterial growth follows the streaks; it is aerobic, halophilic and alkaliphilic, and Gram-positive.

[0009] The present invention also provides an application of Bacillus licheniformis WJJ in the degradation of thiosulfate. Specifically, the application involves adding the bacterial culture obtained by expanding the culture of Bacillus licheniformis WJJ or the resting cells after centrifugation of the bacterial culture to an inorganic salt liquid culture medium containing thiosulfate with a pH of 8.0-10.0 and a total sodium salt concentration of 0.5-2.0 mol / L, and culturing at 25-35℃ to achieve the degradation of thiosulfate.

[0010] Furthermore, the thiosulfate includes thiosulfate-containing wastewater.

[0011] Furthermore, in the inorganic salt liquid culture medium, the amount of bacterial solution added is expressed as an OD value. 600 The concentration of thiosulfate in the inorganic salt liquid culture medium is 0.01-0.05, preferably 0.02; the amount of resting cells added is 20-80 mg / L based on the dry weight of the cells, preferably 50 mg / L. The initial concentration of thiosulfate in the inorganic salt liquid culture medium is 500-5000 mg / L, preferably 500 mg / L.

[0012] Furthermore, the inorganic salt liquid culture medium comprises: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 0-1.5 mol / L, and a trace element stock solution of 1 ml / L. The solvent is deionized water, and the pH is 8.0-10.0. The trace element stock solution comprises: CuSO4·5H2O 0.02 g / L, FeSO4·7H2O 1.0 g / L, MnSO4·4H2O 0.1 g / L, NaMoO4·2H2O 0.02 g / L, and CoCl2·6H2O. The inorganic salt liquid culture medium contains 0.02 g / L of H3BO3, 0.014 g / L of ZnSO4·7H2O, and 0.10 g / L of deionized water as the solvent. The pH of the inorganic salt liquid culture medium is preferably 9.5, and the total sodium salt concentration is preferably 1 mol / L, where total sodium salt refers to NaCl and NaOH.

[0013] Furthermore, the resting Bacillus licheniformis cells were prepared according to the following steps:

[0014] (1) Slant culture:

[0015] Bacillus licheniformis WJJ was inoculated onto a slant culture medium and cultured at 30℃ for 24–36 h to obtain slant cells. The final concentration composition of the solid culture medium was: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, agar 20 g / L, deionized water as solvent, pH 8.0–10.0.

[0016] (2) Expanded cultivation:

[0017] Use an inoculation loop to pick up the slant cells obtained in step (1) and inoculate them into liquid culture medium. Incubate at 30°C for 24-36 h to obtain OD. 600The bacterial suspension has a concentration of 0.1-0.2; the final concentration composition of the liquid culture medium is: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, with deionized water as the solvent and pH 8.0-10.0.

[0018] Compared with the prior art, the beneficial effects of the present invention are reflected in:

[0019] The *Bacillus licheniformis* WJJ strain provided by this invention, derived from saline-alkali land sludge, exhibits highly efficient degradation of thiosulfate, effectively converting pollutants into recyclable substances such as elemental sulfur. Furthermore, this strain can tolerate pH values ​​of 8.0-10.0 and total sodium salt concentrations of 0.5-2.0 mol / L, which is beneficial for improving the removal capacity of thiosulfate wastewater. Therefore, it has broad application prospects in the biological purification of industrial wastewater.

[0020] The Bacillus licheniformis described in this invention can completely degrade thiosulfate into elemental sulfur and sulfate, and the removal rate of thiosulfate up to 5000 mg / L is as high as 100%. Therefore, this Bacillus licheniformis has a highly efficient degradation capacity for thiosulfate and can withstand high concentrations of pollutants. (iv) Description of the attached drawings

[0021] Figure 1 This is a photograph of the colony morphology of strain WJJ on an inorganic salt solid medium.

[0022] Figure 2 This is a phylogenetic tree diagram of strain WJJ.

[0023] Figure 3 The degradation curves of strain WJJ for different concentrations of thiosulfate are shown.

[0024] Figure 4 The degradation curves of strain WJJ for 500 mg / L thiosulfate at different pH values ​​are shown.

[0025] Figure 5 The degradation curves of strain WJJ for 500 mg / L thiosulfate at different total sodium salt concentrations are shown. (V) Detailed Implementation Methods

[0026] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0027] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0028] The final concentration of the solid culture medium is as follows: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, agar 20 g / L, deionized water as solvent, pH 9.5.

[0029] The final concentration of the liquid culture medium is as follows: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, with deionized water as the solvent and pH 9.5.

[0030] The inorganic salt liquid culture medium consists of: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 1.0 mol / L, and a trace element stock solution of 1 ml / L. The solvent is deionized water, and the pH is 9.5. The trace element stock solution consists of: CuSO4·5H2O 0.02 g / L, FeSO4·7H2O 1.0 g / L, MnSO4·4H2O 0.1 g / L, NaMoO4·2H2O 0.02 g / L, and CoCl2·6H2O 0.02 g / L. The concentrations of H3BO3 and ZnSO4·7H2O were 0.10 g / L, and the solvent was deionized water.

[0031] Example 1: Isolation, purification and identification of Bacillus licheniformis WJJ.

[0032] 1. Isolation and purification of Bacillus licheniformis WJJ.

[0033] Bacillus licheniformis WJJ is a Gram-positive bacterium domesticated and isolated from activated sludge. The specific steps are as follows:

[0034] Add 50 mL of liquid culture medium to a 300 mL shake flask, then add 10 mL of activated sludge and 11.07 g / L of thiosulfate for enrichment culture. When the thiosulfate concentration reaches 50% of the initial concentration, take 5 mL of the enriched solution and add it to 50 mL of fresh liquid culture medium. Add the same amount of thiosulfate, and repeat the above enrichment process 5 times. After the last enriched solution is serially diluted and spread on solid culture medium, it is purified by streaking on single colony isolation plates. Figure 1 The selected candidate bacteria were added to a liquid culture medium, and thiosulfate was added as the sole sulfur and energy source for verification. The resulting colonies were picked to obtain strain WJJ.

[0035] 2. Identification of strain WJJ

[0036] (1) Characteristics of strain WJJ: The colonies are orange-yellow with neat edges, opaque, easy to pick up, and Gram-positive.

[0037] (2) The ability of strain WJJ to utilize 47 carbon sources on bioMérieux BCL cards.

[0038] The metabolic activity of strain WJJ to 47 different carbon sources was investigated using the bioMérieux fully automated identification system (contracted to Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. Using the VITEK biochemical reaction system of the bioMérieux fully automated identification system, strain WJJ was found to have strong utilization of 18 carbon sources, but not the other 29.

[0039] Table 1. Biochemical reaction results of strain WJJ using the VITEK automated identification system (BCL card) from bioMérieux.

[0040]

[0041] Note: + indicates a positive reaction; - indicates a negative reaction.

[0042] (3) The strain was identified as Bacillus licheniformis through 16S rRNA sequence analysis and physiological and biochemical experiments. The specific steps are as follows:

[0043] DNA from strain WJJ was extracted and purified using the Ezup column-based bacterial genomic DNA extraction kit and stored at 4 °C. The purified DNA was amplified by PCR using universal primers for bacteria: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows: 94 °C pre-denaturation for 4 min, followed by 94 °C denaturation for 45 s, 55 °C annealing for 45 s, and 72 °C extension for 1 min, for 30 cycles, and a final 72 °C repair extension for 10 min. The PCR product was purified and recovered, and then sequenced (Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The 16S rRNA sequencing result (SEQ ID NO.1) was uploaded to NCBI, obtaining accession number OP648258. This sequence was also compared with gene sequences in the NCBI database using BLAST. It was found to belong to the genus *Bacillus*, and showed 99% homology with *Bacillus subtilis* subsp. *subtilis* strain 168, *Bacillus atrophaeus* strain NBRC 15539, and *Bacillus saerius* strain 24K. From the results, 10 representative *Bacillus* strains were selected, and a phylogenetic tree was constructed using MEGA 7.0 software based on 16S rRNA gene sequence homology. Figure 2 Based on genetic distance and 16S rRNA sequence comparison, it was identified as Bacillus licheniformis and named Bacillus licheniformis WJJ. It is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M 20221017, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072.

[0044] Example 2: Obtaining Bacillus licheniformis WJJ resting cells

[0045] 1. Slant culture

[0046] Bacillus licheniformis WJJ was inoculated into liquid culture medium and cultured at 30 ℃ and 160 rpm for 24-36 h. The activated bacteria were then streaked onto solid culture medium plates and incubated at 30 ℃. Single colonies were taken and streaked again to test the purity of the bacteria. The bacteria were then stored in solid test tube slants at 4 ℃ using routine methods.

[0047] 2. Expand training

[0048] The slant cells from step 1 were inoculated into liquid culture medium and cultured at 30 ℃ and 160 rpm for 24-36 h to obtain a bacterial suspension with OD600=0.1-0.2. The suspension was centrifuged, the wet cells were collected, washed with liquid culture medium, and Bacillus licheniformis WJJ resting cells were obtained.

[0049] Example 3: Degradation performance of Bacillus licheniformis WJJ on different concentrations of thiosulfate.

[0050] Inorganic salt liquid culture medium was dispensed into 300 mL shake flasks (50 mL per flask) and sterilized at 110 °C for 40 min. After sterilization, the flasks were left at room temperature for 2 days to confirm the absence of bacterial growth. Resting cells obtained in Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight). Thiosulfate was then added as the sole sulfur source to final concentrations of 500, 1500, 2500, 3500, and 5000 mg / L. The shake flasks were sealed and incubated at 30 °C on a shaker at 160 rpm. A blank control without bacteria was also included. The residual thiosulfate concentration in the shake flasks was measured periodically using ion chromatography. The removal rate curves of different initial thiosulfate concentrations over time were plotted. The results are shown in [Figure number missing]. Figure 3 As shown in the figure. The results indicate that strain WJJ can rapidly degrade all added substrates when the thiosulfate concentration is between 500 and 5000 mg / L.

[0051] The concentration of thiosulfate ions was quantitatively analyzed using a Dionex ICS-2100 ion chromatograph (Dionex Corporation, USA), equipped with a DS6 conductivity detector and an ASRS 300 suppressor; a Chromeleon chromatography workstation was used, with a Dionex IonPac AS18 (250×4 mm) separation column and an IonPac AG18 (50×4 mm) guard column. The chromatographic operating conditions for the ions were: detector temperature 30℃, suppressor current 75 mA, eluent KOH concentration 30 mM, and ion injection volume 1 mL.

[0052] Example 4: Degradation performance of Bacillus licheniformis WJJ on 500 mg / L thiosulfate under different initial pH conditions.

[0053] The inorganic salt liquid culture medium was adjusted to different pH values ​​(8.0, 8.5, 9.0, 9.5, 10.0) using 1 mol / L NaOH or 1 mol / L H2SO4 aqueous solution. The bacterial suspension prepared according to the method in Example 2 was inoculated under the condition that the initial bacterial suspension concentration in each parallel sample was 500 mg / L. 600The value was calculated to be 0.02. The samples were cultured in a constant temperature shaker at 30 ℃ and 160 rpm, with a blank control without bacteria. Samples were taken periodically, and the concentration of residual thiosulfate in the shake flasks was determined using the method described in Example 3. The removal rate curves of thiosulfate over time under different pH conditions were plotted. The results are shown in [Figure 1]. Figure 4 As shown in the figure. The results indicate that Bacillus licheniformis WJJ can degrade thiosulfate at various pH levels, with the best degradation effect observed at pH 9.5.

[0054] Example 5: Degradation performance of Bacillus licheniformis WJJ on 500 mg / L thiosulfate at different total sodium salt concentrations.

[0055] The pH of the inorganic salt liquid culture medium was controlled at 9.5. The total sodium salt concentration was adjusted using NaCl to 0.5, 0.8, 1.0, 1.5, and 2.0 mol / L. The bacterial suspension prepared according to the method in Example 2 was inoculated under the condition that the initial thiosulfate concentration was 500 mg / L. The initial bacterial suspension concentration in each parallel sample was expressed as an OD value. 600 The value was calculated to be 0.02. The sample was cultured in a constant temperature shaker at 30 ℃ and 160 rpm, with a blank control without bacteria. Samples were taken periodically, and the concentration of residual thiosulfate in the shake flasks was determined using the method described in Example 3. The removal rate curves of thiosulfate over time under different total sodium salt concentrations of the strain were plotted. The results are shown in [Figure 1]. Figure 5 As shown in the figure. The results indicate that Bacillus licheniformis WJJ can degrade thiosulfate at various total sodium salt concentrations, and the degradation effect is best at a total sodium salt concentration of 1.0 mol / L.

Claims

1. Bacillus licheniformis WJJ, deposited at China Center for Type Culture Collection, accession number: CCTCC NO: M 20221017, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072, China.

2. The application of Bacillus licheniformis WJJ as described in claim 1 in the degradation of thiosulfate.

3. The application as described in claim 2, characterized in that, The application is as follows: the bacterial culture obtained by expanding the culture of Bacillus licheniformis WJJ or the resting cells after centrifugation of the bacterial culture are added to an inorganic salt liquid culture medium containing thiosulfate with a pH of 8.0-10.0 and a total sodium concentration of 0.5-2.0 mol / L, and cultured at 25-35℃ to achieve the degradation of thiosulfate.

4. The application as described in claim 3, characterized in that, In the inorganic salt liquid culture medium, the amount of resting cells added is 20-80 mg / L based on the dry weight of the cells; the initial concentration of thiosulfate in the inorganic salt liquid culture medium is 500-5000 mg / L.

5. The application as described in claim 3, characterized in that, The resting cells of Bacillus licheniformis were prepared according to the following steps: (1) Slant culture: Bacillus licheniformis WJJ was inoculated onto a solid culture medium and cultured at 30℃ for 24–36 h to obtain slant cells. The final concentration of the solid culture medium was as follows: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, agar 20 g / L, deionized water as solvent, pH 8.0–10.

0. (2) Expanded cultivation: The slant cells obtained in step (1) were picked up with an inoculation loop and inoculated into liquid culture medium. The culture was carried out at 30°C for 24-36 h to obtain a bacterial suspension with OD600 = 0.1-0.

2. The suspension was centrifuged, the wet cells were collected, and the suspension was washed with liquid culture medium to obtain Bacillus licheniformis WJJ resting cells. The final concentration of the liquid culture medium was: NaHCO3 29.0 g / L, K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, NaOH 5.0 g / L, NaCl 29.25 g / L, and the solvent was deionized water with a pH of 8.0-10.0.

Images