A recombinant bacterium that highly expresses polysaccharide-lysing monooxygenase and its application

Abstract

This invention discloses a recombinant bacterium that highly expresses polysaccharide monooxygenase and its applications. The recombinant bacterium is constructed by ligating the polysaccharide monooxygenase Palpmo gene into a plasmid and then transforming it into *E. coli* Arctic Express (DE3). This invention utilizes filter paper as a substrate and screens hosts using a glucose solution detection reagent. The raw materials are simple and readily available, low in cost, and the detection efficiency is high and rapid. It achieves highly efficient heterologous expression of fungal-derived polysaccharide monooxygenase in *E. coli*, with a soluble expression content of 108% of the original. The synergistic application of polysaccharide monooxygenase and cellulase in the degradation of high-solid-phase cellulose substrates, using corn cobs as an example, increases glucose yield from 65.7 g / L to 83.2 g / L, a 126% increase. This can be used for the industrial production of glucose from corn cobs, reducing costs and shortening hydrolysis time.

Description

(I) Technical Field

[0001] This invention relates to a recombinant bacterium that highly expresses polysaccharide monooxygenase and its application in cellulose degradation. (II) Background Technology

[0002] Lysogenic polysaccharide monooxygenases (LPMOs) are a class of oxidases that break glycosidic bonds in cellulose through oxidation, resulting in a looser substrate structure that facilitates more thorough hydrolysis in subsequent steps. They thus enhance polysaccharide degradation and biomass conversion, making them a promising class of biomass polysaccharide degradation coenzymes. LPMOs are widely found in fungi, bacteria, archaea, marine organisms, and even viruses. Based on their coenzyme activity, they can be divided into six families: (AA)9–11 and 13–16. LPMOs from the AA9 family are specific to cellulose, acting on β-1,4-glycosidic bonds to disrupt the crystalline structure of cellulose chains. They can synergistically work with cellulases to ultimately degrade cellulose into glucose.

[0003] In recent years, numerous applied studies of LPMO have been conducted both domestically and internationally. These studies have enabled the successful heterologous expression of LPMO in Escherichia coli and yeast, improving the degradation efficiency of cellulose substrates. The effects of LPMO type, cellulase type, substrate type, and reaction conditions have been investigated, with the highest improvement in degradation rate reaching 15-fold. For example, Forsberg Z et al. discovered a polysaccharide-lysing monooxygenase from Streptomyces cyanobacterium and heterologously expressed it in host Escherichia coli. Using filter paper as a substrate, they optimized the reaction conditions by adding 1 mM Mg to the reaction system. 2+ This study demonstrated that the degradation efficiency could be increased from 0.4 g / L to 1.2 g / L. Guo et al. discovered a thermostable polysaccharide-lysing monooxygenase from *Thermophilus spp.* and heterologously expressed it in *Escherichia coli*, increasing the degradation efficiency by 1.25 times. After confirming its activity, they investigated its temperature stability, optimal pH, and the influence of metal ions, ultimately increasing the degradation efficiency by 1.5 times. Hofmockel K et al. discovered a polysaccharide-lysing monooxygenase from *Serratia marcescens* and successfully expressed it in *Escherichia coli*. Through control experiments, they found that with the aid of this polysaccharide-lysing monooxygenase, its co-degradation efficiency of chitosan with endoglucanase reached 10 times that of the control group. Ghatge S et al. discovered a polysaccharide-lysing monooxygenase from Hanoi Hochloa bacteria and successfully expressed it heterologously in Escherichia coli. Its synergistic effect with endoglucanase significantly improved the degradation rate of microcrystalline cellulose. After optimizing the system, the degradation rate increased by 15 times after 72 hours, and the glucose yield reached 20 mg / L.

[0004] Currently, research on heterologous expression of recombinant enzymes is in full swing. However, due to the complex metabolic regulatory mechanisms in wild-type strains, the heterologous expression level of polysaccharide monooxygenase in Escherichia coli is not high, which is difficult to meet the requirements of industrial applications. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant bacterium that highly expresses polysaccharide monooxygenase and its application in cellulose degradation. This invention improves the expression of polysaccharide monooxygenase through host expression optimization and applies it to the degradation of cellulose substrates to increase glucose production.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a recombinant bacterium that highly expresses polysaccharide monooxygenase. The recombinant bacterium is constructed by ligating the polysaccharide monooxygenase Palpmo gene to the Nde I and Xho I restriction sites of plasmid pET-28a(+), and then transforming it into Escherichia coli Arctic Express(DE3).

[0008] Preferably, the nucleotide sequence of the Palpmo gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the nucleotide sequence is shown in SEQ ID NO.2.

[0009] This invention transforms the fungal polysaccharide lysing monooxygenase Palpmo gene into the host bacterium ArcticExpress(DE3) for heterologous expression. The filter paper detection method is used to verify that it has the ability to synergistically enhance the degradation of cellulose substrates with cellulase and that it cannot degrade cellulose substrates by acting alone.

[0010] The present invention also provides an application of the recombinant bacteria in the degradation of cellulose. The application is as follows: the wet bacterial cells obtained by fermentation culture of the recombinant bacteria are resuspended in a buffer solution with pH 4-5.5, ultrasonically broken, centrifuged, and the supernatant is taken as crude enzyme solution. The crude enzyme solution is used as a catalyst, cellulose as a substrate, and cellulase as a coenzyme, and the reaction is carried out at 30-80℃ for 50-80h (preferably at 50℃ for 72h) to achieve the degradation of cellulose. The cellulose includes corn cob, filter paper, wheat straw, rice straw, etc.

[0011] Preferably, the mass ratio of cellulose to cellulase is 1:0.02-0.04, more preferably 1:0.03; the amount of catalyst used is based on the protein content in the crude enzyme solution, and the mass ratio of protein content to cellulose is 0.004-0.012:1, more preferably 0.008:1.

[0012] Preferably, the buffer solution is a 100mM pH 5.5 citrate buffer solution.

[0013] Preferably, the catalyst is prepared by the following method:

[0014] The recombinant bacteria were streaked to a final concentration of 50 μg / mL of Kan. + Incubate on LB agar plates at 37°C for 12-14 hours; pick single colonies and add to a final concentration of 50 μg / mL Kans. + In LB tubes, culture at 37°C and 200 rpm in a constant temperature shaker for 12-14 h; then transfer to a solution containing 50 μg / mL Kansat at a volume concentration of 1-2%. + In LB medium, the cells were cultured at 37°C and 180 rpm with shaking until the OD600 value reached 0.4-0.6. IPTG was added to the bacterial culture to a final concentration of 0.5 mM. After induction at 28°C and 180 rpm for about 12-14 h, the cells were centrifuged at 4°C and 8000 rpm to collect the wet cells. The wet cells were resuspended in 20 mM pH 8.0 PB buffer at a concentration of 1 g / 10 mL, sonicated for 20 minutes (4 s on, 5 s off, 45 W power), and centrifuged at 12000 rpm for 5 min to obtain the supernatant, which is the crude PaLPMO enzyme solution.

[0015] This invention first constructs a recombinant bacterium containing the PaLPMO gene, achieving heterologous expression of fungal-derived PaLPMO in *E. coli*. Further, through induction of expression in different hosts, and using filter paper screening and glucose assay reagents, the optimal expression host was selected as Arctic Express (DE3), improving the soluble expression of PaLPMO. Finally, using corn cob substrate as an example, the efficient degradation of high-solid-phase substrates by LPMO in synergistic effect with cellulase was studied. High-performance liquid chromatography (HPLC) was used for precise detection, ultimately achieving degradation of high-solid-phase corn cob substrates, increasing glucose yield from 65.7 g / L to 83.2 g / L.

[0016] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0017] 1. This invention utilizes filter paper as a substrate and employs glucose solution as a detection reagent to screen host bacteria by detecting the enzyme activity of lysin monooxygenase. The raw materials are simple, readily available, and low-cost, while the detection efficiency is high and rapid, achieving efficient heterologous expression of fungal-derived lysin monooxygenase in *Escherichia coli*. Simultaneously, it increases the soluble expression content of lysin monooxygenase to 108% of the original level.

[0018] 2. The synergistic application of monooxygenase and cellulase in the degradation of high-solid-phase cellulose substrates, taking corn cobs as an example, increased the glucose yield from 65.7 g / L to 83.2 g / L, which is 126% of the original yield. This can be used for the industrial production of glucose from corn cobs, reducing costs and shortening the hydrolysis time. (iv) Description of the attached drawings

[0019] Figure 1 Schematic diagram of pET-28a(+)-Palpmo recombinant plasmid.

[0020] Figure 2 1. Verification of recombinant bacterial colonies.

[0021] Figure 3 SDS-PAGE and Western Blot validation plots of pET-28a(+)-Palpmo; Lane M represents marker; Lane 1 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+); Lane 1a represents cell pellet of E. coil BL21(DE3) / pET-28a(+); Lane 2 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+)-Palpmo; Lane 2a represents cell pellet of E. coil BL21(DE3) / pET-28a(+)-Palpmo; Lane 1 represents crude enzyme solution of E. coil BL21(DE3); Lane 2 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+); Lane 3 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+); BL21(DE3) / pET-28a(+)-Palpmo crude enzyme solution.

[0022] Figure 4 SDS-PAGE plot of pET-28a(+)-Palpmo host optimization; lane M represents marker; lane 1 represents crude enzyme solution of E. coil BL21(DE3) / pet28a(+); lane 2 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+)-Palpmo; lane 3 represents crude enzyme solution of E. coil Arctic express(DE3) / pET-28a(+)-Palpmo; lane 4 represents crude enzyme solution of E. coil Rosetta(DE3) / pET-28a(+)-Palpmo; lane 5 represents crude enzyme solution of E. coil BL21-CondonPlus(DE3)-RIPL / pET-28a(+)-Palpmo.

[0023] Figure 5 Comparison of host optimization vitality of pET-28a(+)-Palpmo.

[0024] Figure 6 Glucose standard curve.

[0025] Figure 7 Schematic diagram of the reaction process of PaLPMO synergistic cellulase degradation of 10% high solid phase corn cob dry basis. (V) Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples are conventional biochemical reagents.

[0028] The culture medium and solution preparation required:

[0029] (1) LB medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast extract, and water as solvent.

[0030] (2) LB solid plate culture medium: peptone 10g / L, sodium chloride 10g / L, yeast powder 5g / L, agar 20g / L, solvent is water.

[0031] (3) Kanamycin (Kan, Kanamycin resistance) stock solution: Weigh 0.5g of kanamycin and dissolve it in 10mL of sterile water. Sterilize by passing it through a 0.22μm filter membrane to prepare a stock solution with a final concentration of 50g / L.

[0032] (5) 30% glycerol: Measure 30 mL of glycerol and add sterile water to make up to 100 mL.

[0033] (6) 0.1M CaCl2 solution: Weigh 11.1g of molecular-grade CaCl2 powder and add water to make up to 1L.

[0034] (7) 50×TAE buffer: Weigh 242g Tris and 37.2g disodium ethylenediaminetetraacetate dihydrate and dissolve them in 800mL sterile water. After stirring and dissolving, add 57.1mL acetic acid and continue stirring until homogeneous. Make up to 1L in a volumetric flask.

[0035] (8) 100mM citric acid-sodium citrate buffer solution: Prepare 0.1mol / L citric acid solution and 0.1mol / L sodium citrate solution respectively, and prepare a buffer solution with pH 5.5 according to national standards.

[0036] (9) 100mM phosphate buffer solution: Weigh 11.996g sodium dihydrogen phosphate, add ultrapure water to make up to 1L, and adjust the pH with disodium hydrogen phosphate later to prepare a buffer solution with pH 8.0.

[0037] Example 1: Construction of recombinant plasmid pET-28a(+)-Palpmo

[0038] (1) Target gene fragment

[0039] Based on the gene sequence of Gene ID: 6187700 given in NCBI, the target gene was synthesized by Hangzhou Qingke Company through codon optimization. The nucleotide sequence of the synthesized target gene is shown in SEQ ID NO.1. It was ligated into the Nde I and Xho I restriction sites of the pPCIZA vector, transformed into E. coil DH5α competent cells, and stored at -80℃ for later use.

[0040] Plasmids were extracted from the above-mentioned strains. Using these plasmids as templates, primers Pa-F and Pa-R were designed. Pa-F was the forward primer targeting the polysaccharide monooxygenase gene, and Pa-R was the reverse primer targeting the same gene. Both primers contained approximately 20 bp of homologous regions at the vector ligation site to facilitate subsequent cloning and ligation. The polysaccharide monooxygenase gene was cloned and amplified from the template, with a fragment size of 1065 bp, matching the target fragment. Sequencing analysis showed that the amplified sequence was identical to the ideal sequence. The nucleotide sequence of the Palpmo gene is shown in SEQ ID NO. 1, and the amino acid sequence of the protein encoded by this nucleotide sequence is shown in SEQ ID NO. 2.

[0041] PCR system: Add 1 μL of target gene plasmid template, 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP (2.5 mM), 1 μL each of Palpmo gene forward and reverse primers, 1 μL of Phanta Max DNA polymerase, and add deionized water to a final volume of 50 μL.

[0042] PCR program: 98℃ pre-denaturation for 10 min, 98℃ denaturation for 30 s, 55-60℃ annealing for 30 s, 72℃ extension for 1 min (target gene) and 3 min (vector gene), for a total of 32 cycles. Final extension at 72℃ for 10 min.

[0043] SEQ ID NO.1

[0044]

[0045] (2) Carrier fragment

[0046] Using the pET-28a(+) plasmid as a template, primers pET-F and pET-R were designed with 5'Nde I and 3'Xho I as restriction enzyme sites. pET-F was the forward primer targeting the pET-28a(+) vector gene, and pET-R was the reverse primer for cleaving the pET-28a(+) vector gene. The pET-28a(+) vector gene was cloned and amplified from the template, with a fragment size of 5296 bp, consistent with the vector fragment. Sequencing analysis showed that the amplified sequence was identical to the ideal sequence.

[0047] (3) Recombinant plasmid pET-28a(+)-Palpmo

[0048] The target fragment from step (1) and the vector fragment from step (2) were collected for clean-up and ligated using the Vazyme One Step Cloning Kit to obtain the recombinant plasmid vector named pET-28a(+)-Palpmo. (See schematic diagram). Figure 1 .

[0049] One-step cloning and ligation process: In a sterile PCR tube, add 1 μl of the vector DNA from step (2) (concentration 100 ng / μl) and 1 μl of the gene fragment DNA from step (1) (concentration 80 ng / μl), 2 μl of 5×CEII buffer, 1 μl of Exnase II, and water to a final volume of 20 μl. Incubate at 37°C for 30 min, then cool to 4°C or immediately on ice. Transform the ligation product into E. coli DH5α competent cells for storage, and then extract the plasmid pET-28a(+)-Palpmo using a plasmid extraction kit.

[0050] Table 1 Primers

[0051] Pa-R TGGTGGTGGTGGTGCTCGAGGGTAGATCCACCTGGAATGTCTG pET-F CTCGAGCACCACCACCACC pET-R CATATGGCTGCCGCGCGG

[0052] Example 2: Recombinant plasmid pET-28a(+)-Palpmo was transformed into Escherichia coli BL21(DE3).

[0053] The recombinant vector pET-28a(+)-Palpmo, constructed in Example 1, was extracted using a plasmid extraction kit and introduced into competent cells of *E. coli* DH5α. The recombinant vector was then converted to kanamycin. +Antibiotic selection was performed using 50 μg / mL antibodies. Positive transformants were picked and colony PCR was performed using universal primers pET-Up (TAATACGACTCACTATAGGG) and T7-Term (GCTAGTTATTGCTCAGCGG) as upstream and downstream primers. The results showed that the recombinant plasmid pET-28a(+)-Palpmo was successfully transformed into E. coil DH5α. The specific operation is as follows:

[0054] (1) Preparation of E. coli DH5α competent cells

[0055] Take Escherichia coli (E. coli) DH5α culture from a glycerol cryopreservation tube and streak it on an LB agar plate, incubating at 37°C until single colonies appear. Transfer a single colony from the plate to 5 mL of LB liquid medium and incubate overnight at 37°C and 200 rpm. Add 200 μL of the overnight culture to 20 mL of LB liquid medium and incubate at 37°C and 200 rpm until the OD600 reaches 0.4–0.6. Transfer the culture to a pre-chilled 50 mL centrifuge tube and incubate on ice for 10 min. Centrifuge at 4°C, 4000 rpm for 5 min. Discard the supernatant, add 4 mL of 0.1 mol / L CaCl2, resuspend on ice, and incubate for 10 min. Centrifuge at 4°C, 2500 × g for 5 min. Discard the supernatant, add 1 mL of 0.1 mol / L CaCl2 (containing 15% glycerol in the solution), resuspend the precipitate, and incubate on ice for 30 min to obtain E. coli DH5α competent cells. Aliquot into 1.5 mL sterile centrifuge tubes (100 μL per tube) and store at -80°C for later use. The same procedure applies to E. coli BL21(DE3) competent cells.

[0056] (2) The recombinant plasmid pET-28a(+)-Palpmo was transformed into E. coli BL21(DE3).

[0057] Take one vial of *E. coli* DH5α competent cells as described above, incubate on ice for 5 min, add 10 μL of pET-28a(+)-Palpmo recombinant plasmid at a concentration of 100 ng / μL, incubate on ice for 30 min, then heat shock at 42℃ for 90 s, return to ice for 1 min, add 700 μL of LB liquid medium, and incubate at 37℃, 200 rpm for 1 h. Take 200 μL and spread evenly on Kansas... + (Final concentration 50 μg / mL) LB agar plates containing the antibiotic were incubated at 37℃ for 12-14 h until single colonies containing the recombinant plasmid pET-28a(+)-Palpmo appeared. Colony verification can be found in [link to relevant documentation]. Figure 2 As shown, DL250 is the Marker.

[0058] Colony validation PCR system: Pick a single colony, add 20 μL of sterile water, boil in a water bath for 5–10 min, and centrifuge at 12000 rpm for 1 min. Take 1 μL of the supernatant as a template, add 25 μL of 2×Rapid Taq Master Mix, 2 μL each of pET-Up and T7-Term forward and reverse primers, 0.1 μL of pfu DNA polymerase, and bring the total volume to 50 μL with deionized water.

[0059] Colony validation PCR procedure: 98℃ pre-denaturation for 10 min, 98℃ denaturation for 15 s, 55-60℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 32 cycles. Final extension at 72℃ for 10 min.

[0060] E. coli DH5α / pET-28a(+)-Palpmo plasmid-introduced pET-28a(+)-Palpmo was used to isolate single colonies on streaked LB agar plates. The plates were incubated at 37°C, and single colonies were picked and cultured in 10 mL agar plates containing Kansas acetylcholine (KAN). + LB liquid medium (final concentration 50 μg / mL) was cultured in test tubes at 37°C for 12-14 h. Plasmids were extracted using a plasmid kit and then introduced into E. coli BL21(DE3) competent cells for protein expression, thus constructing E. coli BL21(DE3) / pET-28a(+)-Palpmo.

[0061] Using the same method, construct E.coil BL21(DE3) / pET-28a(+).

[0062] Example 3: Expression of recombinant E. coli E. coli BL21(DE3) / pET-28a(+) and E. coli BL21(DE3) / pET-28a(+)-Palpmo

[0063] 1. Expression of recombinant Escherichia coli

[0064] E. coil BL21(DE3), E. coil BL21(DE3) / pET-28a(+) and E. coil BL21(DE3) / pET-28a(+)-Palpmo constructed in Example 2 were streaked to a concentration of 50 μg / mL in Kansas. + Incubate on LB agar plates at 37°C for 12-14 hours; pick single colonies and add to a final concentration of 50 μg / mL Kans. + In LB tubes, incubate at 37°C and 200 rpm for 12–14 h in a constant temperature shaker. Then, transfer to a solution containing 50 μg / mL Kansat at a 1% (v / v) inoculum concentration. +In LB medium, the cells were cultured at 37°C with shaking at 180 rpm for 1-2 hours until they reached the logarithmic growth phase of *E. coli*, at which point the OD600 value was 0.4-0.6. IPTG was then added to the culture to a final concentration of 0.5 mM, and the cells were induced at 28°C with shaking at 180 rpm for approximately 12-14 hours. After induction, the wet cells were collected by centrifugation at 4°C and 8000 rpm and stored at -20°C.

[0065] The wet bacterial cells were resuspended at a concentration of 1 g / 10 mL in 20 mM pH 8.0 PB buffer, sonicated for 20 minutes (4 seconds on, 5 seconds off, 45 W power), and centrifuged at 12000 rpm for 5 minutes. The supernatant obtained was the crude PaLPMO enzyme solution. The protein content was detected using a BCA assay kit, and the result was 0.8 mg / mL. The precipitate was resuspended in an equal volume of PB buffer to obtain the cell expression precipitate sample, which was used for SDS-PAGE and Western Blot detection.

[0066] 2. SDS-polyacrylamide gel electrophoresis analysis (SDS-PAGE)

[0067] (1) Take 120ul of sample, add 4x SDS loading buffer, mix well, boil at 100℃ for 10min, and wait for cooling.

[0068] (2) Install pre-cast adhesive: After tearing off the bottom seal of the pre-cast adhesive, insert it into the slot and check for leaks.

[0069] (3) Electrophoresis: Take 10 μL of sample and load it onto the marker. Set a constant voltage of 150 V / cm for electrophoresis. The time is 50 min until the bromophenol blue band reaches the bottom of the gel.

[0070] (4) Staining and destaining: The pre-cast gel was placed in a GenScrip staining and destaining system, and the protein bands were observed using a gel imaging system after the process. Results are shown below. Figure 3 As shown in Figure A, lane 1 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+), and lane 1a represents cell pellet of E. coil BL21(DE3) / pET-28a(+); lane 2 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+)-Palpmo, and lane 2a represents cell pellet of E. coil BL21(DE3) / pET-28a(+)-Palpmo.

[0071] 3. Western Blot

[0072] (1) Take 120 μL of sample, add 4x SDS loading buffer l, mix well, boil at 100°C for 10 min, and wait for cooling.

[0073] (2) Install pre-cast adhesive: After tearing off the bottom seal of the pre-cast adhesive, insert it into the slot and check for leaks.

[0074] (3) Electrophoresis: Take 10 μL of sample and load it onto the marker. Set a constant voltage of 150 V / cm for electrophoresis. The time is 50 min until the bromophenol blue band reaches the bottom of the gel.

[0075] (4) Membrane Transfer: First, cut the gel according to the marker indication and the position of the target band (note to mark the cut corners of the gel). Immerse the eluted gel and PVDF membrane in transfer buffer PBST for rinsing to remove electrophoresis buffer. After marking the PVDF membrane, immerse it in methanol for 1 min, then in 1X PVDF membrane equilibration solution for 3 min. Open the transfer clamp and place the sponge pad, membrane, gel, and dry sponge in the frame on the positive electrode side in sequence, aligning each item to ensure there are no air bubbles. Close the transfer clamp, place it in the channel, and set it for approximately 16 min for transfer. After transfer, allow the PVDF membrane and gel to separate naturally in PBST and rinse.

[0076] (5) Membrane blocking and antibody incubation: Place the PVDF membrane in blocking solution for 1 hour, then incubate with primary antibody for 2 hours, and wash with PBST 4 times for 1 minute each time. Then incubate with secondary antibody for 1 hour, and wash with PBST 4 times for 10 minutes each time.

[0077] (6) Color development and exposure: Mix the color enhancer and color developer in a 1:1 ratio, immerse the mixture in the PVDF film for 1 minute, and then observe the bands using a multi-functional imager. See results below. Figure 3 As shown in Figure B, lane 1 represents crude E. coil BL21(DE3) enzyme solution, lane 2 represents crude E. coil BL21(DE3) / pET-28a(+) enzyme solution, and lane 3 represents crude E. coil BL21(DE3) / pET-28a(+)-Palpmo enzyme solution.

[0078] The results showed that SDS-polyacrylamide gel electrophoresis analysis and Western blot gel images were obtained as follows: Figure 3 As can be seen from the gel image, the polysaccharide cleavage monooxygenase PaLPMO has been successfully expressed, and the expression band is consistent with the expected molecular weight.

[0079] Example 4: Method for detecting the activity of polysaccharide-lysing monooxygenase PaLPMO

[0080] The specific enzyme activity of Palpmo was calculated by measuring the glucose concentration produced after Palpmo and cellulase catalyze cellulose substrates using a filter paper assay solution.

[0081] The 1.5 mL reaction system included: 0.5 mL of PaLPMO crude enzyme solution (protein content 0.8 mg / mL) prepared according to the method of Example 3, 50 mg of filter paper, 1.5 mg of cellulase (cellulase Cellic CTec3 produced by Novozymes), and 1 mL of 0.1 M acetate-sodium acetate buffer solution at pH 4.8. The reaction was carried out at 50 °C for 1 h. After the reaction, the mixture was centrifuged at 12000 rpm for 5 min, and the supernatant was used to calculate its glucose content using a glucose assay reagent. The results showed that the unit enzyme activity of the PaLPMO crude enzyme solution was 14.8 U / mL. Enzyme activity unit (U) is defined as the amount of wet bacterial cells required to hydrolyze and produce 1 mmol of glucose per minute under conditions of pH 4.8 and 50 °C.

[0082] Glucose assay method: A glucose test kit (purchased from Shanghai Sangon Biotech) was used. A 96-well microplate was prepared, and 198 μL of glucose assay solution was added. 2 μL of the supernatant was taken and incubated at 37°C for 10 min. After incubation, the absorbance was measured at 505 nm using a microplate reader. The glucose content was calculated according to the formula. The above steps were also performed using the glucose standard and reaction blank control from the glucose test kit.

[0083] Formula for calculating glucose content:

[0084] Example 5: Optimization of expression of polysaccharide cleavage monooxygenase PaLPMO

[0085] Using the method in Example 2, the recombinant plasmid pET-28a(+)-Palpmo was transferred into E. coil Arctic Express (DE3), E. coil Rosetta (DE3), and E. coil BL21-CondonPlus (DE3)-RIPL competent cells to prepare recombinant bacteria E. coil Arctic Express (DE3) / pET-28a(+)-Palpmo, E. coil Rosetta (DE3) / pET-28a(+)-Palpmo, and E. coil BL21-CondonPlus (DE3)-RIPL / pET-28a(+)-Palpmo. By expressing these bacteria in different hosts, host bacteria that increase the soluble expression level of PaLPMO were screened.

[0086] According to the expression method in Example 3, SDS-PAGE gel images of the crude enzyme solutions of each recombinant bacterium were obtained, and the results are as follows. Figure 4As shown, lane 1 represents crude enzyme solution of E. coil BL21(DE3) / pet28a(+); lane 2 represents crude enzyme solution of E. coil BL21(DE3) / pET-28a(+)-Palpmo; lane 3 represents crude enzyme solution of E. coil Arctic express(DE3) / pET-28a(+)-Palpmo; lane 4 represents crude enzyme solution of E. coil Rosetta(DE3) / pET-28a(+)-Palpmo; and lane 5 represents crude enzyme solution of E. coil BL21-CondonPlus(DE3)-RIPL / pET-28a(+)-Palpmo. Analysis was performed using Quantity One software, with a 100% soluble content of BL21(DE3) as a control. The optimal host was then selected through comparison using the method described in Example 4. The host optimization activity comparison chart is shown below. Figure 5 .

[0087] The results show that:

[0088] The SDS-PAGE gel images showed an increased expression level of PaLPMO in the host Arctic Express (DE3). Further analysis of the SDS-PAGE gel images using Quantity One software, with the soluble content of PaLPMO without host optimization as a control, revealed that the soluble content of PaLPMO expressed in Arctic Express (DE3) was 108%, in Rosetta (DE3) it was 99%, and in BL21-CondonPlus (DE3)-RIPL it was 95.6%. Therefore, Arctic Express (DE3) was determined to be the optimal host after optimization.

[0089] By comparing the activity of BL21(DE3) / pET-28a(+)-Palpmo (without host optimization) as 100%, the optimized activity of host BL21-CondonPlus(DE3)-RIPL was 107.7%, host Rosetta(DE3) was 114.5%, and host Arctic Express(DE3) was 121.3%.

[0090] Example 6: Application of PaLPMO in synergistic cellulase degradation of high-solid-phase cellulose substrates

[0091] (1) Crude enzyme solution

[0092] The recombinant E. coil Arctic express(DE3) / pET-28a(+)-Palpmo was streaked to a final concentration of 50 μg / mL Kan. +Incubate on LB agar plates at 37°C for 12-14 hours; pick single colonies and add to a final concentration of 50 μg / mL Kans. + In LB tubes, incubate at 37°C and 200 rpm for 12–14 h in a constant temperature shaker. Then, transfer to a solution containing 50 μg / mL Kansat at a 1% (v / v) inoculum concentration. + In LB medium, the cells were cultured at 37°C with shaking at 180 rpm for 1-2 hours until they reached the logarithmic growth phase of *E. coli*, at which point the OD600 value was 0.4-0.6. IPTG was then added to the culture to a final concentration of 0.5 mM, and the cells were induced at 28°C with shaking at 180 rpm for 12-14 hours. After induction, the wet cells were collected by centrifugation at 4°C with shaking at 8000 rpm and stored at -20°C.

[0093] The wet bacterial cells were resuspended at a concentration of 1 g / 10 mL in 100 mM pH 5.5 citrate buffer, sonicated for 20 minutes (4 seconds on, 5 seconds off, 45 W power), and centrifuged at 12000 rpm for 5 minutes. The supernatant obtained was the crude PaLPMO enzyme solution. The protein content was detected using a BCA assay kit, and the result was 0.8 mg / mL.

[0094] (2) Degradation

[0095] In step (1), 10 g of corn cob dry substrate and 0.3 g of cellulase (cellulase Cellic CTec3 from Novozymes) were added to 100 mL of the crude enzyme solution (protein concentration of 0.8 mg / mL, buffer of 100 mM pH 5.5 citrate buffer). The mixture was reacted at 50 °C for 72 h. Samples were taken every 20 h, centrifuged at 12000 rpm for 5 min, and the supernatant was obtained. The supernatant was diluted 20 times with water, filtered through a 0.20 μm microporous aqueous filter membrane, and degassed by sonication. The peak area of ​​glucose was detected by HPLC and analyzed according to the glucose standard curve. Figure 6 The glucose concentration was obtained, and the reaction process was shown in the graph below. Figure 7 The medium curve of Palpmo (Arcticexpress) was used. Under the same conditions, a blank control without crude enzyme solution was used. Figure 7 The control curve was prepared using the crude enzyme solution of recombinant bacteria BL21(DE3) / pET-28a(+)-Palpmo prepared according to the method in Example 3 as a control. Figure 7 The medium curve is Palpmo (BL21).

[0096] The high performance liquid chromatography (HPLC) operating conditions are as follows: Column type: HPX-87H Ion Exclusion Column; Mobile phase composition: 8mM H2SO4 (435μL H2SO4 added to 1L ultrapure water); Injection volume: 20μL; Column temperature: 60℃; Flow rate: 0.6mL / min; Detector: differential detector.

[0097] Glucose standard curve: Glucose standards were purchased from Aladdin Company. Different concentrations (0.5 g / L, 1 g / L, 3 g / L, 5 g / L, 6 g / L, 10 g / L) of glucose standard solutions were prepared using deionized water. The peak areas of these standard solutions were detected by HPLC. Based on the peak areas and the concentrations of the glucose standard solutions, the standard curve was calculated as Y = 106348X - 1822.24, R0. 2 >0.99 (where Y is the peak area and X is the glucose concentration), the result is as follows. Figure 6 As shown.

[0098] The results show that:

[0099] Cellulase alone acted on 10% high-solids corn cob substrate to degrade glucose, yielding a final glucose yield of 65.7 g / L.

[0100] Cellulase, in synergy with unoptimized PaLPMO, degraded 10% high-solids corn cob substrate, yielding a final glucose yield of 80.4 g / L, with a degradation efficiency 22.3% higher than that of cellulase alone.

[0101] The host-optimized PaLPMO (Arctic Express (DE3)) synergistically with cellulase to degrade 10% high-solids corn cob substrate yielded a final glucose yield of 86.2 g / L, representing a 31.2% increase in degradation efficiency compared to cellulase alone. This demonstrates that host-optimized PaLPMO expression is more effective and can significantly improve cellulose degradation efficiency.

Claims

1. A recombinant bacterium that highly expresses polysaccharide-lysing monooxygenase, characterized in that, The recombinant bacteria were constructed by ligating the Palpmo gene, a polysaccharide monooxygenase, into a plasmid and then transforming it into Escherichia coli Arctic Express (DE3). The nucleotide sequence of the Palpmo gene is shown in SEQ ID NO.

1.

2. The recombinant bacteria expressing high levels of polysaccharide-lysing monooxygenase as described in claim 1, characterized in that, The Palpmo gene, a polysaccharide cleavage monooxygenase, is linked to the Nde I and Xho I restriction sites of plasmid pET-28a(+).

3. The application of the recombinant bacteria according to claim 1 in the degradation of cellulose, characterized in that, The application is as follows: the wet bacterial cells obtained by fermentation culture of the recombinant bacteria are resuspended in a buffer solution of pH 4-5.5, ultrasonically broken, centrifuged, and the supernatant is taken as crude enzyme solution. The crude enzyme solution is used as a catalyst, cellulose as a substrate, and cellulase as a coenzyme, and the reaction is carried out at 30-80℃ for 50-80 hours to achieve the degradation of cellulose; the cellulose includes one of corn cob, filter paper, wheat straw, and rice straw.

4. The application as described in claim 3, characterized in that, The mass ratio of cellulose to cellulase is 1:0.02-0.04; the amount of catalyst used is based on the protein content in the crude enzyme solution, and the mass ratio of protein content to cellulose is 0.004-0.012:

1.

5. The application as described in claim 3, characterized in that, The crude enzyme solution was prepared as follows: recombinant bacteria were streaked to a final concentration of 50 μg / mL Kans. + Incubate on LB agar plates at 37°C for 12-14 h; pick single colonies and add to a final concentration of 50 μg / mL Kans. + In LB tubes, cultured at 37 ℃ and 200 rpm in a constant temperature shaker for 12-14 h; then transferred to a solution containing 50 μg / mL Kansat at a volume concentration of 1-2%. + In LB medium, the cells were cultured at 37 °C and 180 rpm with shaking until the OD600 value reached 0.4-0.

6. IPTG was added to the bacterial culture to a final concentration of 0.5 mM, and the culture was induced at 28 °C and 180 rpm for 12-14 h. The cells were then centrifuged at 4 °C and 8000 rpm to collect the wet cells. The wet cells were resuspended in 20 mM pH8.0 PB buffer at a concentration of 1 g / 10 mL, sonicated for 20 min, and centrifuged at 12000 rpm for 5 min to obtain the supernatant, which was the crude enzyme solution.

6. The application as described in claim 5, characterized in that, The ultrasonic fragmentation conditions are: power 45 W, operation time 4 s, and stop time 5 s.

Images