Corynebacterium glutamicum stress-resistant engineering strain and its application in production of acidic bio-based chemicals

Abstract

This invention discloses a stress-resistant genetically engineered strain of Corynebacterium glutamicum with improved stress resistance and its application in the production of acidic bio-based chemicals. The acidic pH environment conversion process based on this stress-resistant Corynebacterium glutamicum offers high substrate conversion rates and fewer byproducts. The preparation process is simple and convenient, with mild and controllable production conditions. The resulting α-ketoglutarate exhibits better stability in an acidic environment, satisfying the optimal catalytic reaction conditions for L-glutamate oxidase, thus more efficiently catalyzing the conversion of L-glutamate (salt) to α-ketoglutarate. It also helps save on alkali usage and reduce the generation of high-concentration wastewater, significantly reducing production costs and improving product separation and purification efficiency, demonstrating promising technological application prospects.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and synthetic biology, and relates to a method for constructing a stress-resistant genetically engineered strain of Corynebacterium glutamicum, and its application in the production of acidic bio-based chemicals such as α-ketoglutarate. Background Technology

[0002] Corynebacterium glutamicum ( Corynebacterium glutamicum Actinobacterium is an important food-grade industrial microbial strain that has been widely used in the industrial fermentation of various amino acids, as well as the biosynthesis of organic acids, nucleotides, and vitamins, and has significant economic value and application prospects [Lee JY, Na YA, Kim E, et al. The Actinobacterium]. Corynebacterium glutamicum [J. Microbiol Biotechnol, 2016, 26: 807-22.]. However, under industrial fermentation conditions, such as the fermentation production of acidic bio-based chemicals like glutamic acid and its derivatives, Corynebacterium glutamicum often faces numerous physiological and non-physiological stresses, severely affecting the normal physiological state of the strain and the efficient accumulation of related target products. Among these, low-acid stress is a relatively common environmental stress [Guan N, Li J, Shin H, et al. Microbial response to environmental stresses: from fundamental mechanisms to practical applications. Appl Microbiol Biotechnol, 2017, 101: 3991-4008.]. High-performance microbial strains are the foundation of fermentation engineering and an important guarantee for improving the yield and quality of bio-fermentation products. Engineered microorganisms with excellent, stable, and stress-resistant phenotypes are essential for achieving higher fermentation yields, productivity, and production intensity. Therefore, based on a deep understanding of the physiological adaptation mechanism of Corynebacterium glutamicum to the complex industrial fermentation environment, it is of great theoretical and practical significance to use synthetic biology and other strategies and tools to regulate the physiological performance of Corynebacterium glutamicum, improve the metabolic capacity and tolerance of the strain under adverse stress, and thus give full play to its industrial value.

[0003] Currently, the amino acid industry is still dominated by traditional bulk low- and medium-grade products. The development and production of high-value-added amino acid derivatives urgently need to be strengthened. Developing high-value-added downstream products of the amino acid industry through biotransformation and other methods, focusing on biomedicine, biofeed, and bioenvironmental protection, is of great significance for further expanding and extending the amino acid industry chain and achieving sustainable development. α-ketoglutarate (α-KG) is an important organic acid that plays a crucial role in the carbon-nitrogen metabolism of organismal cells. It is also an important precursor for the synthesis of various sugars, amino acids, and proteins, and has broad application prospects in the food, pharmaceutical, feed, fine chemical, and cosmetic industries [Wu N, Yang M, Gaur U, et al. Alpha-ketoglutarate: physiological functions and applications. BiomolTher, 2016, 24: 1-8.]. Currently, traditional processes primarily employ chemical synthesis to produce α-KG, including oxalate ethyl ester hydrolysis or acyl cyanide hydrolysis. However, chemical synthesis methods suffer from harsh conditions, high energy consumption, and low yields. The processes also involve the use of large amounts of harmful reagents such as cyanides, heavy metal ions, and strong acids and bases, severely limiting their application in the pharmaceutical, cosmetic, and food industries. Compared to chemical synthesis, fermentation-based α-KG production offers advantages such as abundant raw materials, lower costs, and higher yields. However, the fermentation process generates excessive byproducts such as pyruvate, fumaric acid, and malic acid, and suffers from drawbacks such as scarce production strains, low fermentation yields, and excessively long fermentation cycles, thus failing to meet the needs of large-scale industrial production. Bioconversion, with its advantages of simple operation, mild conditions, high raw material utilization, high conversion rates, and easy separation and purification, holds significant application value in significantly reducing production costs and addressing glutamate overcapacity.

[0004] L-glutamate oxidase (LGOX) efficiently catalyzes the conversion of L-glutamate into the high-value-added product α-KG, and is a key enzyme preparation for the bioconversion production of α-KG [Niu P, Dong X, Wang Y, et al. Enzymatic production of alpha-ketoglutaric acid from L-glutamic acid via L-glutamate oxidase. J Biotechnol, 2014, 179: 56-62.]. LGOX-mediated catalytic reactions have many advantages, including mild reaction conditions, high catalytic efficiency, strong substrate specificity, and environmental friendliness, and have been widely used in food, pharmaceutical, chemical, and environmental protection fields. However, due to its generally low enzyme activity, its optimal activity pH being acidic, and its poor stability, its practical application is greatly affected. In 2017, the applicant's research group, starting with screening for potentially highly active LGOX, discovered and identified LGOX from multiple different sources. Subsequent screening using L-glutamate oxidase-inducible medium resulted in a Streptomyces strain with excellent L-glutamate oxidase catalytic activity [Liu Q, Ma X, Cheng H, et al. Co-expression of L-glutamate oxidase and catalase in Escherichia coli to produce alpha-ketoglutaric acid by whole-cell biocatalyst. Biotechnol Lett, 2017, 39:913-919.]. The L-glutamate oxidase gene from Streptomyces X was then... E. coli Cloning, expression, and purification were performed in BL21, yielding a crude enzyme activity of 125.7 U / mg, significantly higher than that of currently known L-glutamate oxidases. Enzymatic property studies revealed that the optimal reaction pH is 6.0, and the optimal reaction temperature is 35°C. However, the enzyme exhibits slightly poor thermostability; LGOX activity decreases sharply at reaction temperatures above 45°C. Despite these minor imperfections, the enzyme's excellent catalytic activity potential lays an important foundation for the subsequent development of efficient α-KG biotransformation technologies. Summary of the Invention

[0005] Based on the above understanding, the main objective of this invention is to provide a stress-resistant genetically engineered strain of Corynebacterium glutamicum with excellent stress resistance, and to use this engineered strain to design and construct a highly efficient microbial cell factory that can efficiently prepare acidic bio-based chemicals such as α-ketoglutarate under low pH stress conditions.

[0006] The discovery, characterization, and standardization of superior biological functional components are the cornerstone of synthetic biology research and a prerequisite for constructing highly efficient and stress-resistant microbial chassis. This invention utilizes the testing of Corynebacterium glutamicum (…). Corynebacterium glutamicum ATCC 13032) has reported candidate genes for stress resistance, and the genes discovered from ( Escherichia coli MG1655), Lactobacillus brevis ( Lactobacillus brevis ATCC 367), Acidophilus ferrooxidans ( Acid ithiobacillusferrooxidans ATCC 23270) and extreme thermophilic archaea ( Thermococcus kodakarensis This invention aims to identify and evaluate potential acid-resistant functional elements in microorganisms such as KOD1 (a type of microorganism), including stress-resistance regulators, signal-response proteins, molecular chaperones, and repair proteins, applicable to Corynebacterium glutamicum. Through growth tolerance testing, this invention provides several excellent candidate acid-resistant functional elements, including *Lactobacillus brevis* Cfa [GenBank: ABJ65104.1], *Corynebacterium glutamicum* Dps [GenBank: CAF18940.1], *Acidithiobacillus ferrooxidans* GroES [GenBank: ACK77997.1], and *Typhatidylcholine* TK2097 [GenBank: BAD86286.1], which can provide important targets for constructing *Corynebacterium glutamicum* strains with enhanced acid stress resistance.

[0007] Therefore, the present invention provides a Corynebacterium glutamicum engineered strain with strong resistance to acid stress, which is obtained by introducing an acid-resistant gene controlled by a low-acid, highly specific response promoter into the Corynebacterium glutamicum origin strain.

[0008] Specifically, the low-acid highly specific response promoter is Pcg2796; the acid-resistant gene is selected from Dps (GenBank accession number CAF18940.1), TK2097 (GenBank accession number BAD86286.1), and GroES (GenBank accession number ACK77997.1).

[0009] In a specific embodiment, the starting bacterium is Corynebacterium glutamicum, which is obtained by subculturing wild-type Corynebacterium glutamicum or by subculturing it under low-acid stress conditions below pH 6. Its cell biomass under low-acid conditions is higher than that of wild-type Corynebacterium glutamicum.

[0010] Preferably, the genetically engineered bacteria obtained by co-expressing glutamate oxidase and catalase in the starting bacteria are further used to achieve one-step synthesis of α-KG.

[0011] More preferably, the glutamate oxidase is L-glutamate oxidase or a mutant thereof, wherein the mutant refers to the mutation of the 280th amino acid from serine (S) to threonine (T) or the 533rd amino acid from histidine (H) to leucine (L) based on wild-type L-glutamate oxidase derived from Streptomyces moulinae; and the catalase is Escherichia coli catalase.

[0012] More specifically, by using a gene knockout method, the gene encoding α-ketoglutarate dehydrogenase, which is downstream of the metabolic pathway, was knocked out in the starting bacteria. kgd [GenBank: CAF19835.1], glutamate dehydrogenase encoding gene gdh [GenBank:CAF20415.1] and the gene encoding glutamate efflux protein. mscCG [GenBank: CAF19973.1], to increase the supply of intracellular glutamate precursors and the accumulation of intracellular α-KG.

[0013] In one specific embodiment, the gene encoding α-ketoglutarate dehydrogenase is GenBank accession number CAF19835.1. kgd The gene encoding glutamate dehydrogenase is the one with GenBank accession number CAF20415.1. gdh The gene encoding the glutamate efflux protein has a GenBank accession number of CAF19973.1. mscCG .

[0014] Preferably, the gene knockout method is a scarless knockout of the target gene based on homologous recombination.

[0015] This invention also provides a biological method for preparing and producing acidic bio-based chemicals such as α-ketoglutarate, which utilizes the stress-resistant genetically engineered strain of Corynebacterium glutamicum to produce α-ketoglutarate.

[0016] Specifically, whole-cell catalytic sludge is prepared through high-density fermentation culture, and α-ketoglutarate is obtained by catalytic reaction using L-glutamic acid or its salt as a substrate.

[0017] More specifically, the catalysis is carried out at a temperature of 35°C. o C, the stirring speed is 300 r / min, the aeration rate is set to 80 NL / min, and the catalytic time is 24 to 40 hours.

[0018] The beneficial effects of this invention are as follows: This invention successfully constructed a stress-resistant genetically engineered *Corynebacterium glutamicum* strain with enhanced acid stress resistance using adaptive evolution and synthetic biology strategies, and provides a process for efficiently preparing acidic bio-based chemicals such as α-ketoglutarate using this engineered strain under acidic conditions. This method exhibits high substrate conversion rates and fewer byproducts. The preparation method is simple and convenient, with mild production conditions. The prepared α-ketoglutarate shows better stability in acidic environments, demonstrating excellent technological application prospects. The acidic environment conversion process of *Corynebacterium glutamicum* disclosed in this invention can not only meet the optimal catalytic reaction conditions of L-glutamate oxidase, thus catalyzing the conversion of L-glutamate (salt) to α-ketoglutarate more efficiently, but also helps to save on alkali usage, reduce the generation of high-concentration wastewater, and improve the separation and purification efficiency of the product. Attached Figure Description

[0019] Figure 1 Screening and construction tests for acid-fast chassis bacteria of Corynebacterium glutamicum; Figure 2 A schematic diagram of the construction of Corynebacterium glutamate α-ketoglutarate producing bacteria. Detailed Implementation

[0020] The present invention will be further illustrated below through specific embodiments in order to better understand the present invention, but these embodiments do not constitute a limitation thereof.

[0021] Example 1: Discovery and Testing of Acid-Resistant Functional Components Acid-resistant elements, as key functional components, respond to environmental signals under low acid stress and act promptly to regulate intracellular pH homeostasis in microbial strains, thereby maintaining optimal growth and metabolism. To further explore potential acid-resistant functional components suitable for *Corynebacterium glutamicum*, the shuttle vector pXMJ19 was used to overexpress *Corynebacterium glutamicum* (… Corynebacterium glutamicum ATCC13032, Escherichia coli ( Escherichia coli MG1655), Lactobacillus brevis ( Lactobacillus brevis ATCC367), Acidophilus ferrooxidans ( Acidithiobacillusferrooxidans ATCC 23270) and extreme thermophilic archaea ( Thermococcus kodakarensisSeveral potential stress-resistance elements were selected from KOD1, and preliminary tests were conducted on the strain's tolerance to low acid stress. The results showed that overexpression of elements from *Lactobacillus brevis* (Cfa [GenBank: ABJ65104.1]), *Corynebacterium glutamicum* (Dps [GenBank: CAF18940.1]), *Acidobacterium ferrooxidans* (GroES [GenBank: ACK7797.1]), and *TK2097* (TAD86286.1) from *Extreme Thermophilic Archaea* increased the biomass of the strain under low acid stress by 7.5%, 19.0%, 23.1%, and 17.9%, respectively. This suggests that the highly efficient candidate acid-resistance elements screened above hold promise as fundamental functional resources for subsequent stress-resistance gene circuits.

[0022] Example 2: Construction of acid-stress-resistant chassis bacteria of Corynebacterium glutamicum Microorganisms have developed numerous methods and pathways for repairing DNA damage during long-term evolution. For example, uracil glycosyl repair enzyme systems and mismatch repair systems can correct replication errors, while photoreactivation repair systems, excision repair systems, recombination repair systems, and SOS repair systems can repair DNA molecular damage caused by environmental factors and in vivo chemicals. The applicant's earlier patent application CN115725631A provides a method for constructing a controllable high-mutation-rate *Corynebacterium glutamicum* engineered bacterium based on DNA damage repair mechanisms and its application. Using this engineered bacterium, a genome-level continuous mutation enhancement tool can be established, enabling "mutation and screening simultaneously" under given environmental stress conditions, achieving the goal of controllable and efficient breeding of *Corynebacterium glutamicum* engineered bacteriums with excellent stress-resistant phenotypes. In one specific embodiment, through a low-acid tolerance evolution experiment, evolved bacteria with better robustness and adaptability to low-acid environmental stress can be rapidly obtained within a relatively short continuous screening cycle. Using wild-type Corynebacterium glutamicum ATCC 13032 as the starting strain, the bacteria were passaged under low-acid stress conditions of pH 5.8, pH 5.5, and pH 5.2. After three rounds of passage for a total of 9 days, the domesticated bacteria with good growth characteristics under low-acid stress were rapidly screened. After subsequent isolation and purification, a strain of Corynebacterium glutamicum evolved into CgEVO with a biomass increase of more than 30% under low-acid conditions of pH 6.0 could be obtained from 100 single colonies.

[0023] Acid-base specific response elements (AFIs) are a crucial component of the control module in acid-fast gene circuits. Their response performance to different pH levels, such as precision, breadth, and sensitivity, directly affects whether the designed gene circuit operates as expected. Based on currently reported transcriptome data of *Corynebacterium glutamicum* under different pH conditions and combined with existing research on acid-fast response elements in model organisms, we analyzed, screened, and tested the pH response specificity of more than ten gene promoters. By placing the promoter sequences of more than ten candidate genes before the eGFP fluorescent protein-encoding gene, we tested the expression of related response elements under different pH stress conditions. The study confirmed that Pcg2796 from *Corynebacterium glutamicum* is a highly specific low-acid response promoter, and its expression level varies significantly with changes in the external acidic pH environment. Figure 1 Middle A). The above-mentioned Pcg2796 promoter sequence is as SEQ ID NO.1 Shown: ccatcctcatcctggctgagaacaacactattgattggaccttcagaaaatatgtgagctggagtcatagcccccgagtgtaatgaaaaatgtccatccggggcatggaatttggggtttggaatttggggtggaagcttccggaagacaaggtgcttaatgggaggat tggcacacatttccaaccctcgacacacagataaccaaacactaacaaaaatcttttacacatagaagagttctatgacttgatccacaatgtgatgcaaatcattgaccctcaccccggaccaagcgcttaatgaaggcaagccaaacttaactagtagataggattgca.

[0024] Based on the highly efficient candidate acid-resistant elements and pH-specific promoters identified above, the corresponding biological elements were sequentially combined and introduced into the screened wild-type Corynebacterium glutamicum ATCC13032 and the evolved strain CgEVO to obtain a series of acid-resistant gene circuits. Among them, the acid-resistant gene circuit obtained by placing the acid-resistant functional elements Dps [GenBank: CAF18940.1], TK2097 [GenBank: BAD86286.1], and GroES [GenBank: ACK80015.1 / ACK77997.1] under the control of the low-acid highly specific promoter Pcg2796 can endow the strain with superior resistance to low-acid stress. The nucleotide sequence of the acid-resistant gene elements is shown in SEQ ID NO. 2. The acid-resistant gene circuits were integrated at the chromosome level using the commonly used homologous recombination technology based on the SacB sucrose lethality principle. Detailed steps can be found in published patents CN112375726B and CN103805552B, etc. Specifically, overlapping extension PCR was used to obtain a fusion fragment containing ~1 kb flanking sequences upstream and downstream of the target gene promoter and the acid-fast gene circuit. This fragment was subcloned into knockout vectors such as pK18mobsacB or pCRD206 to construct a target gene expression replacement plasmid. This replacement plasmid was then electrotransformed into wild-type Corynebacterium glutamicum ATCC13032 and the evolved strain CgEVO, respectively. After two rounds of homologous double crossover, the corresponding Corynebacterium glutamicum acid-fast gene circuit strains CgAID1 and CgAID2 were obtained through screening.

[0025] The growth of *Corynebacterium glutamicum* wild-type ATCC13032, the evolved strain CgEVO, and the acid-fast gene-based strains CgAID1 and CgAID2 were tested under low-acid stress conditions at pH 6.0. The results are as follows: Figure 1 As shown, compared to the wild-type ATCC13032 control strain, the cell biomass of the chassis bacteria CgAID1 and CgAID2, which contain acid-fast gene circuits, increased by 32% and 41%, respectively, under low-acid conditions at pH 6.0. Figure 1 (B) suggests that the acid-resistant gene circuit bacteria have improved tolerance to low acid stress.

[0026] Example 3: Construction of a genetically engineered Corynebacterium glutamate strain for producing α-ketoglutarate Currently, there are relatively few reports on the production of α-ketoglutarate (α-KG) by prokaryotic microorganisms. Some reports use *Escherichia coli* as the production strain, which limits its application in the food and pharmaceutical industries. In a specific implementation case, food-grade *Corynebacterium glutamicum* ATCC 13032 was selected as the starting strain. Through co-expression of glutamate oxidase and catalase, and systemic metabolic engineering of the chassis engineered bacteria, a one-step synthesis of α-KG was achieved. Figure 2This invention can significantly increase the added value of glutamic acid, a bulk fermentation product. On the other hand, the biocatalytic method has advantages such as short process cycle, high conversion efficiency and few by-products, and has great advantages in both production process and safety.

[0027] Utilizing the mature genetic operating system of *Corynebacterium glutamicum*, this invention employs a shuttle expression vector pXMJ19 to heterologously co-express an L-glutamate oxidase mutant and *E. coli* catalase KatE. The construction method and steps of the co-expression recombinant plasmid pXMJ19-tac-lgox-katE are described in the applicant's aforementioned patent CN 110283800 B, etc., which simultaneously introduces the encoding genes for L-glutamate oxidase and catalase into a single plasmid. The L-glutamate oxidase mutant described in this invention refers to a mutation at amino acid position 280 (serine S to threonine T) or amino acid position 533 (histidine H to leucine L) derived from the wild-type L-glutamate oxidase of *Streptomyces moulinae*. The recombinant engineered bacteria are obtained by transforming or introducing the above-mentioned dual-enzyme co-expression vector into the wild-type host bacterium *Corynebacterium glutamicum* ATCC 13032 and its derivatives.

[0028] To prevent the α-KG synthesized by recombinant Corynebacterium glutamicum from being utilized or degraded by the bacterial cells, metabolic engineering techniques were employed to modify the substrate uptake process, α-KG degradation pathway, and transport system. In one specific embodiment, based on the acid-fast pathway substrate CgAID1 of Corynebacterium glutamicum, the gene encoding α-ketoglutarate dehydrogenase downstream of the metabolic pathway was knocked out using traceless gene knockout technology. kgd [GenBank: CAF19835.1], glutamate dehydrogenase encoding gene gdh [GenBank:CAF20415.1] and the gene encoding glutamate efflux protein. mscCG [GenBank: CAF19973.1], to increase intracellular glutamate precursor supply and intracellular α-KG accumulation levels. This invention mainly employs temperature-sensitive and... SacB Homologous recombination technology based on the sucrose lethality principle is used for the scarless knockout of target genes. Detailed steps can be found in published patents CN112375726B and CN103805552B. Using overlap extension PCR, a fusion fragment containing ~1 kb flanking sequences upstream and downstream of the target gene is obtained. This fragment is subcloned into commonly used knockout vectors for Corynebacterium glutamicum, such as pCRD206 or pK18mobsacB, to construct a target gene knockout plasmid. After electrotransformation of the knockout plasmid into the acid-fast chassis CgAID1 strain of Corynebacterium glutamicum, two rounds of homologous double crossover are performed, followed by screening to obtain bacteria with in situ target gene deletion.

[0029] Example 4: Establishment of a biological process for preparing acidic bio-based chemicals such as α-ketoglutaric acid This embodiment provides a process for preparing acidic bio-based chemicals such as α-ketoglutaric acid under an acidic environment. Using the in situ target gene-deleted bacteria prepared in Example 3 above, and following the method described in the applicant's aforementioned patent CN110283800 B, whole-cell catalytic sludge is prepared through high-density fermentation to establish a bio-production process for α-KG. The α-KG production method utilizes a 5 L whole-cell catalytic system established in a fermenter. The whole-cell transformation system is controlled under acidic pH 6.0 or neutral pH 7.5 conditions. The entire reaction system contains an L-glutamic acid (salt) substrate concentration of 270 g / L and a catalytic sludge concentration of 15 g / L. The catalytic temperature throughout the reaction system is controlled at 35°C. o C. The stirring speed was 300 r / min, and the aeration rate was set to 80 NL / min. After the catalytic time was 24-40 hours, the content of α-KG in the catalytic reaction solution was determined by liquid chromatography (HPLC) after the reaction was completed.

[0030] Liquid chromatography analysis revealed that under acidic catalytic conditions, after 26 hours of catalytic reaction, the α-KG content in the whole-cell catalytic reaction solution reached 190.2 g / L, with a production intensity of 7.32 g / h. Under neutral catalytic conditions, after 30 hours of catalytic reaction, the α-KG content in the whole-cell catalytic reaction solution reached 185.2 g / L, with a production intensity of 6.17 g / h. This suggests that an acidic catalytic environment is more conducive to the production of α-KG by engineered Corynebacterium glutamicum. Furthermore, stability tests on the α-KG product in the whole-cell catalytic reaction solution revealed that under acidic catalytic conditions, after 24 hours of storage, the α-KG content decreased to 179.8 g / L, with approximately 5.47% of the product degrading. In contrast, under neutral catalytic conditions, the α-KG content decreased to 157.4 g / L after 24 hours of storage, with approximately 15.01% of the product degrading. This also suggests that an acidic catalytic environment helps maintain the stability of α-KG, which can significantly reduce production costs and simplify the separation and purification process, demonstrating promising technological application prospects.

Claims

1. A stress-resistant genetically engineered strain of Corynebacterium glutamicum, wherein the stress resistance refers to tolerance to low acid stress, characterized in that, It is obtained by introducing an acid-fast gene element controlled by a low-acid highly specific response promoter into the originating strain of Corynebacterium glutamicum; the nucleotide sequence of the acid-fast gene element is shown in SEQ ID NO: 2; the low-acid highly specific response promoter is Pcg2796 derived from Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO: 1; The originating strain of Corynebacterium glutamicum is Corynebacterium glutamicum ATCC 13032.

2. The Corynebacterium glutamicum stress-resistant genetically engineered bacterium as described in claim 1, characterized in that, In the stress-resistant genetically engineered bacteria, a glutamate oxidase mutant and catalase are further co-expressed to achieve one-step synthesis of α-KG; wherein the L-glutamate oxidase mutant refers to the L-glutamate oxidase derived from wild-type Streptomyces moulinae, in which the 280th amino acid is mutated from serine (S) to threonine (T), or the 533rd amino acid is mutated from histidine (H) to leucine (L); the amino acid sequence of the wild-type L-glutamate oxidase derived from Streptomyces moulinae is shown in SEQ ID NO: 1 of Chinese Patent CN110283800B; The glutamate oxidase is L-glutamate oxidase; the catalase is Escherichia coli catalase.

3. The Corynebacterium glutamicum stress-resistant genetically engineered bacterium as described in claim 2, characterized in that, Furthermore, by using gene knockout methods, the gene encoding α-ketoglutarate dehydrogenase kgd (GenBank accession number CAF19835.1), the gene encoding glutamate dehydrogenase gdh (GenBank accession number CAF20415.1), and the gene encoding glutamate efflux protein mscCG (GenBank accession number CAF19973.1) downstream of its metabolic pathway were knocked out to increase the intracellular supply of glutamate precursors and the accumulation level of intracellular α-KG.

4. The Corynebacterium glutamicum stress-resistant genetically engineered bacterium as described in claim 3, characterized in that, The gene knockout method described above is a scarless knockout of the target gene based on homologous recombination.

5. A method for preparing acidic bio-based chemicals using a biological process, characterized in that, It uses the stress-resistant genetically engineered Corynebacterium glutamicum as described in any one of claims 1 to 4 to produce acidic bio-based chemicals.

6. The method as described in claim 5, characterized in that, Whole-cell catalytic sludge was prepared by high-density fermentation culture, and α-ketoglutarate was obtained by catalytic reaction using L-glutamic acid or its salt as substrate.

7. The method as described in claim 6, characterized in that, The catalysis was carried out under low acidity conditions (pH 6.0), at a temperature of 35°C, with a stirring speed of 300 r / min, an aeration rate of 80 NL / min, and a catalytic time of 24–40 hours.

Images