Transient transformation of sunflower with foreign genes

Abstract

The present application belongs to the technical field of plant genetic engineering, and particularly relates to a sunflower transient transformation method. The present application aims to solve the technical problem that there is no suitable sunflower genetic transformation system. The technical solution of the present application is a sunflower exogenous gene transient transformation method, which is realized by one of the following methods: A, an infection method; B, an injection method; and C, an ultrasonic vacuum method. The present application provides a new selection for transgenic sunflower.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a method for instantaneous transformation of sunflowers. Background Technology

[0002] Soil salinization affects more than 20% of the world's arable land, and the situation in China, a major agricultural country, is no exception. Xinjiang has the largest area and widest distribution of saline-alkali land in China. How to maximize the utilization of existing saline-alkali land and improve its quality and efficiency is an urgent issue. Sunflower is an important oilseed crop, relatively tolerant of saline-alkali drought and poor soil conditions. Among them, the "Early Dwarf Big Head" sunflower parent variety possesses excellent characteristics such as a short growth cycle, large flower head, lodging resistance, and high oil content, making it a key parent for three-line sunflower breeding in Xinjiang and even Northwest China. Therefore, by breeding a more salt-tolerant "Early Dwarf Big Head" sunflower variety, the utilization rate of Xinjiang's saline-alkali land can be increased. Compared with the disadvantages of traditional hybridization breeding—long cycles and high manpower and material consumption—molecular breeding can effectively shorten the time and save costs. Transient transformation technology can preliminarily and quickly identify gene functions to select suitable genes for molecular breeding, reducing failure costs. It can also provide a reference method for subcellular localization of functional genes in sunflowers, CRISPR / Cas9 gene editing, and the study of gene-interactions. Common methods for transient transformation of plants include infection, injection, ultrasonic treatment, vacuum treatment, and protoplast transformation. The appropriate method varies depending on the species and intended use. Currently, there are few reports on suitable transient transformation methods for sunflowers, and low stable transformation rates and deformed seedlings limit the application of transgenic sunflowers. Summary of the Invention

[0003] The technical problem to be solved by this invention is that there is currently no suitable method for exogenous gene transformation in sunflowers.

[0004] The technical solution of this invention is a method for instantaneous transformation of sunflowers, implemented in one of the following ways:

[0005] A. The infection method is adopted, which includes the following steps: Sunflowers are planted hydroponically until the two cotyledons are fully unfolded; seedlings are infected with Agrobacterium tumefaciens resuspension containing a plant expression vector of exogenous genes; they are cultured in low light and then transferred to a normal environment to continue growing;

[0006] B. The injection method includes the following steps: Plant sunflowers until the two cotyledons are fully expanded. Use a needle-free syringe to draw up a suspension of Agrobacterium tumefaciens containing a plant expression vector of the exogenous gene. Gently make a non-penetrating wound on the back of the sunflower cotyledon with the syringe needle, and slowly inject the bacterial suspension through the wound. When water stains appear on the front of the cotyledon, the injection is successful. Water the seedlings thoroughly with tap water, cover them with plastic wrap to keep them moist, and cultivate them in the dark. Then transfer them to a normal environment to continue growing.

[0007] C. The ultrasonic vacuum method is adopted, specifically including the following steps: Shelled and sterile sunflower seeds are grown in a petri dish containing filter paper soaked in MS liquid medium until the cotyledons are fully expanded; seedlings are placed in a container containing sterile water and ultrasonically treated to create micro-incisions; seedlings are then placed in a Agrobacterium resuspension containing a plant expression vector of the exogenous gene for vacuum filtration; seedlings are removed and cultured in the dark in a petri dish containing liquid MS and acetylsyleugenol; transplanted into flowerpots and allowed to continue growing in a normal environment.

[0008] Specifically, the preparation of the Agrobacterium tumefaciens bacterial suspension containing the plant expression vector of the exogenous gene is as follows: A single clone of Agrobacterium EHA105 is picked and inoculated into liquid YEB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and grown at 28°C and 220 rpm for 16 h; when the bacterial suspension OD... 600 When the bacterial concentration is 0.8–1.2, the bacterial pellet is collected by centrifugation at 5000 rpm for 5–15 min using a high-speed centrifuge; the bacterial pellet is washed three times with liquid MS medium containing 0.1–0.2 mmol / L acetylsuccinone; and then resuspended.

[0009] One of the following operations is performed for resuspension:

[0010] In Method A, the resuspension is as follows: the bacterial pellet is resuspended in liquid MS medium, 7% sucrose, 50 mmol / L CaCl2, 0.1 mg / L ascorbic acid, 0.1–0.2 mmol / L acetylsuccine, and 0.02% SILWETL-77 (pH 5.8) until the bacterial concentration reaches OD200. 600 0.8~1.0;

[0011] In Method B, the resuspension is performed as follows: the bacterial pellet is resuspended in sucrose-free liquid MS medium, 10 mmol / L MgCl2, 10 mmol / L LMES, 0.1–0.2 mmol / L acetylsylgenone, and 0.02% SILWETL-77 (pH 5.8), and the bacterial suspension concentration is adjusted to OD0.05. 600 0.8~1.0;

[0012] In Method C, the resuspension is performed as follows: the bacterial pellet is resuspended in liquid MS medium and 0.1–0.2 mmol / L acetosyringone (pH 5.8) until the bacterial concentration reaches OD0.05. 600 0.8~1.0.

[0013] Furthermore, in Method A, the operation of hydroponic sunflower cultivation is as follows: Select seeds with plump, undamaged shells, and grow them in a petri dish containing three layers of filter paper soaked in tap water until the cotyledons open. Then, transfer them to a hydroponic pot containing 1 / 4 Hoagland nutrient solution and grow them at a temperature of 26±2℃ with 16 hours of light and 8 hours of darkness until the cotyledons are fully expanded and green.

[0014] Specifically, in Method A, seedlings were infected in bacterial suspension for 1–4 hours under dark conditions at 26±2℃.

[0015] Preferably, in method A, the seedlings are infected in the bacterial suspension for 2 hours.

[0016] In Method A, the specific operation of low-light culture is as follows: After infection, the seedlings are placed in 1 / 4 Hoagland nutrient solution, with the roots completely submerged below the liquid surface, and continue to grow in a low-light environment at 26±2℃ for 2 to 3 days.

[0017] Furthermore, in Method B, the specific operation for planting sunflowers is as follows: sow sunflower seeds with shells in a mixed substrate of nutrient soil: vermiculite: perlite = 3:1:1 (v:v:v), and grow them at 26±2℃ for 16 hours of light and 8 hours of darkness until the two cotyledons are fully unfolded.

[0018] In Method C, shelled and sterile sunflower seeds were grown in a petri dish containing liquid MS until the cotyledons unfolded, and then grown in the dark at 26±2℃ for 2–3 days.

[0019] Specifically, in method C, the seedlings are placed in a container containing sterile water and treated with ultrasound at 40 Hz for 1-2 minutes to create micro-injuries.

[0020] Specifically, in method C, seedlings with micro-wounds are placed in a resuspension of Agrobacterium containing a plant expression vector of exogenous genes and vacuum filtered under 0.05 kPa pressure for 5–10 min; absorbent paper is used to remove residual bacterial solution from the seed surface.

[0021] Further, in Method C, the seedlings were removed and placed in a petri dish containing liquid MS and acetylsyleugenol for dark culture; then transplanted into flower pots for continued growth in a normal environment. The specific operation was as follows: under aseptic conditions, the seedlings were placed in a petri dish containing liquid MS and 0.1-0.2 mmol / L acetylsyleugenol and cultured in the dark at 26±2℃ for 2-3 days; finally, they were transplanted into flower pots containing a mixed substrate of nutrient soil:vermiculite:perlite = 3:1:1 (v:v:v) and continued to grow under 16h light / 8h dark conditions at 26±2℃.

[0022] The beneficial effects of this invention are as follows: This invention establishes for the first time three efficient instantaneous transformation systems in sunflower: the infection method, the injection method, and the ultrasonic vacuum combined treatment method, providing options for different research applications of sunflower. Attached Figure Description

[0023] Figure 1 Cases of transient conversion failure in sunflowers; A and B: Deformed phenotypes of sunflower seedlings grown in petri dishes; C: Stem necrosis and plant death caused by bacterial suspension infection in soil-grown sunflower seedlings.

[0024] Figure 2 Infection method experiment, optimizing different infection times; A: Staining results of sunflower seedlings under different infection times; B: Phenotype of sunflower seedlings, from left to right, after infection in bacterial suspension for 0h, 1h, 2h, 4h, 6h, and 8h; C: Relative expression level of GUS gene, the horizontal axis is infection time (hours), the vertical axis is relative expression level, normalized to the expression level after 1 hour; D: Infection transformation efficiency (the percentage of individuals stained with blue spots or patches out of the total population), the horizontal axis is infection time (hours), and the vertical axis is transformation efficiency percentage (%).

[0025] Figure 3 Injection method procedure; A: 7-day-old seedlings; B: Make a wound on the back of the cotyledons; C: Injection; D: Injection completed; E: Dark culture for 3 days.

[0026] Figure 4 Ultrasonic vacuum method experiment, optimizing the ultrasonic treatment time at 40 Hz; A: Staining results of sunflower seedlings under different ultrasonic times; B: Sunflower seedling phenotypes, corresponding to the ultrasonic times in A; C: Relative expression level of the GUS gene, with the horizontal axis representing ultrasonic time (minutes) and the vertical axis representing relative expression level. Figure 3 C. Normalized expression levels after 1 hour; D: Infection transformation efficiency (the percentage of individuals stained with blue spots or patches), with the x-axis representing ultrasound time (minutes) and the y-axis representing the percentage of transformation efficiency (%).

[0027] Figure 5 Efficiency and duration of three transient transformation methods; after the transformation of sunflower seedlings by the three different methods was completed, the seedlings were placed in the corresponding environment, and the expression of the GUS gene was detected every 2-3 days; A: Infection method; B: Injection method; C: Ultrasonic vacuum method. Detailed Implementation

[0028] The sunflower seeds used in the following examples are the parent material "Early Dwarf Big Head" donated by the Institute of Economic Crops of Xinjiang Academy of Agricultural Sciences.

[0029] Example 1: A case of failed transformation of a suitable method for planting sunflower seedlings ( Figure 1 )

[0030] Step 1: Obtaining sterile seedlings: Peel and sterile sunflower seeds and grow them in a greenhouse at 26°C under 16h light / 8h dark conditions in filter paper soaked in MS liquid medium until the two true leaves are fully unfolded.

[0031] Step 2, Preparation of bacterial suspension: Monoclonal Agrobacterium EHA105 carrying the pBI121-GUS plasmid (purchased from Beijing Solarbio Science & Technology Co., Ltd.) was inoculated into liquid YEB medium containing 50 mg / L kanamycin and 25 mg / L rifampin, and grown at 28℃ and 220 rpm for 16 h. When the bacterial suspension OD... 600 At step 1.2, the bacterial pellet was collected by centrifugation at 5000 rpm for 10 min. The pellet was resuspended in liquid MS medium containing 0.1 mmol / L acetosyringone, and washed three times to remove residual YEB medium components. The pellet was then resuspended again in liquid MS medium, 7% sucrose, 50 mmol / L CaCl2, 0.1 mg / L ascorbic acid, 0.1 mmol / L acetosyringone, and 0.02% SILWETL-77 (pH 5.8) to achieve an OD concentration of [missing value]. 600 0.8, used to infect seedlings.

[0032] Step 3, Seedling Infection: Under dark conditions at 26℃, seedlings were infected in bacterial suspension for 2 hours. Figure 1 (A, B). Next, after infection, the seedlings were placed in petri dishes containing liquid MS and 0.1 mmol / L acetylsuccinone and grown in the dark for 3 days; although the GUS gene was expressed in the seedlings, the deformed seedlings were not conducive to subsequent experiments.

[0033] Step 4: Obtain soil-grown seedlings with two fully opened true leaves: Sow sunflower seeds with shells in flowerpots filled with a mixture of nutrient soil: vermiculite: perlite = 3:1:1 (v:v:v), with 5 seedlings per pot. Germinate in a greenhouse at 26℃ with 16 hours of light and 8 hours of darkness. Once the two true leaves have fully opened, conduct a transformation experiment.

[0034] Step 5: Preparation of bacterial suspension and inoculation of seedlings. The preparation of the bacterial suspension is the same as in Step 2. Seedlings are removed from the pots and the roots are washed to remove impurities. Under dark conditions at 26℃, the entire plant is inoculated in the bacterial suspension for 2 hours, and then placed in a hydroponic pot containing 1 / 4 Hoagland's nutrient solution. Figure 1 C). It was found that the infected seedlings died due to osmotic dehydration and necrosis of the stems, eventually leading to the death of the entire plant, making it impossible to conduct further experiments.

[0035] Example 2 Instantaneous conversion of sunflowers by infection method ( Figure 2 )

[0036] Step 1: Hydroponic cultivation of sunflower seedlings: Select seeds with plump, undamaged shells. Grow the seeds in a petri dish containing three layers of filter paper soaked in tap water until the cotyledons open. Then transfer them to a hydroponic pot containing 1 / 4 Hoagland nutrient solution. Grow the seeds at 26℃ with 16 hours of light and 8 hours of darkness until the cotyledons are fully expanded and the seedlings turn green.

[0037] Step 2, Preparation of bacterial suspension: Same as step 2 in Example 1.

[0038] Step 3: Seedling Infection: Under dark conditions at 26℃, seedlings were infected in bacterial suspension for 2 hours. After infection, the seedlings were placed in 1 / 4 Hoagland nutrient solution, with the roots completely submerged below the liquid surface, and continued to grow for 3 days in a low-light environment at 26℃.

[0039] Step 4: Detect instantaneous conversion efficiency

[0040] Prepare the GUS staining solution as follows: 50 mmol / L phosphate buffer (pH 7.2), 0.1% Triton X-100, 2 mmol / L potassium ferricyanide, 2 mmol / L potassium ferrocyanide, 10 mmol / L EDTA, and 0.8 g / L X-Gluc. Immerse the sample in the GUS staining solution and stain at 100 rpm for 16 h in a 37°C constant temperature shaker, protected from light. After staining, discard the staining solution and rinse the sample successively with 50%, 70%, and 100% ethanol, immersing for 5 min each time. Discard the waste solution and soak the sample in anhydrous ethanol in a 75°C water bath until the chlorophyll is completely removed. The blue-stained areas are the GUS expression sites.

[0041] The samples were immersed in GUS staining solution and placed in a 37℃ constant temperature shaker at 100 rpm for 16 hours in the dark. After removal, the staining solution was discarded, and the samples were rinsed with 50%, 70%, and 100% ethanol successively, immersing for 5 minutes each time. The waste solution was discarded, and the samples were then soaked in anhydrous ethanol in a 75℃ water bath until the chlorophyll was completely removed. The results showed that after 6 hours and 8 hours of infection with the bacterial suspension, the roots of the sunflower seedlings were completely necrotic; the seedlings infected for 1 hour, 2 hours, and 4 hours grew normally and could all be stained blue. Figure 2 A, B). Among them, the seedling tissue infected with bacterial suspension for 2 hours showed the deepest staining and the largest area (A, B). Figure 2 A).

[0042] Using sunflower leaf tissue cDNA as a template, the relative expression level of the GUS gene was detected by qRT-PCR (primers are shown in Table 1). Actin and EF-1 were used as internal control genes. The reaction system was 20 μL, including 1 μL of template, 0.4 μL each of gene-specific upstream and downstream primers (GUS-F and GUS-R) (0.01 mmol / L), 8.2 μL of water, and 10 μL of qPCR Mix (TransGen Biotech Co., Ltd.) (total system). The reaction program was 94℃ pre-denaturation for 30 s; 94℃ denaturation for 5 s, 58℃ annealing for 15 s, and 72℃ extension for 10 s, for 40 cycles. The results showed that, normalized to GUS expression after 1 h of infection, the relative expression level of GUS was highest at 2 h of infection, reaching 2.7 (mg / L). Figure 2 C) indicates that this infection time is most favorable for the transformation of exogenous genes in sunflowers. The transformation efficiency reaches a maximum of 95%. Figure 2 D).

[0043] Table 1 Primers for qRT-PCR

[0044] GUS-F SEQ ID NO.1 AGACTGTAACCACGCGTCTG GUS-R SEQ ID No.2 TGTCTGGCTTTTGGCTGTGA Actin-F SEQ ID No. 3 CCCATCCATTGTCCACCGAA Actin-R SEQ ID No. 4 CCGCATACCGATGCATGAAC EF-1-F SEQ ID No. 5 AGCCTCTTCGTCTCCCACTTC EF-1-R SEQ ID No. 6 ACCATACCGGGCTTGATCAC

[0045] Step 5: Detecting transient conversion efficiency and duration: After the infected sunflowers finished growing in a low-light environment, they were transferred to a 26℃ environment with 16 hours of light and 8 hours of darkness. GUS expression in the tissues was observed every 2 days. A total of 6 days were recorded. The results showed that GUS expression was still present in the plants on day 6; and the sunflower seedlings showed the deepest staining and largest staining area between 2 and 4 days of growth, indicating the highest GUS expression level, which is the optimal period for studying the function of exogenous genes. Figure 5 A).

[0046] Example 3: Sunflower transformation by injection method

[0047] Step 1: Obtaining seedlings with fully opened cotyledons in soil: Sow sunflower seeds with shells in a mixed substrate of nutrient soil: vermiculite: perlite = 3:1:1 (v:v:v), and grow them at 26℃ for 16 hours of light and 8 hours of darkness until both cotyledons are fully opened.

[0048] Step 2, Preparation of bacterial suspension: Monoclonal Agrobacterium EHA105 carrying the pBI121-GUS plasmid (purchased from Beijing Solarbio Science & Technology Co., Ltd.) was inoculated into liquid YEB medium containing 50 mg / L kanamycin and 25 mg / L rifampin, and grown at 28℃ and 220 rpm for 16 h. When the bacterial suspension OD... 600At step 1.2, the bacterial pellet was collected by centrifugation at 5000 rpm for 10 min. The pellet was resuspended in liquid MS medium containing 0.1 mmol / L acetosyringone, and washed three times to remove residual YEB medium components. The pellet was then resuspended again in sucrose-free liquid MS medium, 10 mmol / L MgCl2, 10 mmol / L MES, 0.1 mmol / L acetosyringone, and 0.02% SILWETL-77 (pH 5.8), and the bacterial suspension concentration was adjusted to OD0.05. 600 0.8, used for cotyledon injection in seedlings.

[0049] Step 3, Injection: Gently make a small incision on the back of the sunflower cotyledon with the syringe needle, but do not pierce the front. Slowly inject the bacterial solution through the incision. When water stains appear on the front of the cotyledon, the injection is successful. Then, water the seedlings thoroughly, cover them with plastic wrap to maintain moisture, and incubate in the dark for 3 days before transferring them to a normal environment to continue growing.

[0050] Step 4: Detecting transient transformation efficiency and duration: After the Agrobacterium resuspension was injected into sunflower cotyledons and the plants were placed under a 26℃ light / dark cycle of 16h and 8h, respectively, and GUS expression was observed every 3 days. A total of 9 days were recorded. The results showed that GUS expression was still present in the plants on day 9. The staining depth and area were greatest 3–5 days after transformation, indicating the highest GUS expression level, which is the optimal period for studying the function of the exogenous gene. Figure 5 B).

[0051] Example 4: Ultrasonic vacuum method for converting sunflowers

[0052] Step 1: Obtain germinated sterile sunflower seeds: Shelled and sterile sunflower seeds are grown in a petri dish containing liquid MS until the cotyledons unfold, and grown for 3 days in the dark at 26°C.

[0053] Step 2, Preparation of bacterial suspension: Monoclonal Agrobacterium EHA105 carrying the pBI121-GUS plasmid (purchased from Beijing Solarbio Science & Technology Co., Ltd.) was inoculated into liquid YEB medium containing 50 mg / L kanamycin and 25 mg / L rifampin, and grown at 28℃ and 220 rpm for 16 h. When the bacterial suspension OD... 600 At step 1.2, the bacterial pellet was collected by centrifugation at 5000 rpm for 10 min. The pellet was resuspended in liquid MS medium containing 0.1 mmol / L acetosyringone, and washed three times to remove residual YEB medium components. The pellet was then resuspended again in liquid MS medium and 0.1 mmol / L acetosyringone (pH 5.8) to achieve an OD concentration of [missing value]. 600 0.8, which is infiltrated into the seedlings through a vacuum.

[0054] Step 3, Ultrasonic treatment: The seedlings are placed in an Erlenmeyer flask containing sterile water and treated with ultrasound at 40 Hz for 1 minute to create micro-incisions.

[0055] Step 4, Vacuum Treatment: Place the seed in a resuspension of Agrobacterium containing the exogenous gene expression vector and vacuum filter under 0.05 kPa pressure for 5 minutes; absorb any residual bacterial solution from the seed surface with absorbent paper. Figure 4 B).

[0056] Under aseptic conditions, seeds were placed in petri dishes containing liquid MS and 0.1 mmol / L acetylsyleugenol and cultured in the dark at 26°C for 3 days. Finally, they were transplanted into pots containing a mixture of potting soil, vermiculite, and perlite in a ratio of 3:1:1 (v:v:v) and continued to grow under 16h light / 8h dark conditions at 26°C. Figure 4 ).

[0057] Step 4: Detect instantaneous conversion efficiency: Same as step 4 in Example 2. The results showed that, normalized to GUS expression after 1 hour of infection in Example 2, the relative expression level of GUS was highest at 1 minute of sonication, reaching 3.1 (…). Figure 4 C) indicates that this condition is most favorable for infecting sunflowers. The conversion efficiency reaches a maximum of 100%. Figure 4 D).

[0058] Step 5: Detecting transient transformation efficiency and duration: After the sunflower seedlings under ultrasonic vacuum treatment completed their dark growth period, they were transferred to a 26℃ light / dark cycle of 16h and 8h, and GUS expression in their tissues was observed every 2 days. A total of 9 days were recorded. The results showed that GUS expression was still present in the plants on day 9; and the staining depth and area were greatest during 3–5 days of post-transformation culture, indicating the highest GUS expression level, which is the optimal period for studying the function of exogenous genes. Figure 5 C).

Claims

1. A method for instantaneous transformation of sunflowers, characterized by: Implement this using one of the following methods: A. The infection method is adopted, specifically including the following steps: Sunflowers are planted hydroponically until both cotyledons are fully unfolded; seedlings are infected with Agrobacterium resuspension containing a plant expression vector of exogenous genes; they are cultured in low light conditions and then transferred to a normal environment to continue growth; the infection is carried out under dark conditions at 26±2 ℃, with seedlings infected in Agrobacterium resuspension for 2 hours; the low light culture operation is as follows: after infection, the seedlings are placed in 1 / 4 Hoagland nutrient solution, with the roots completely submerged below the liquid surface, and continue to grow in a low light environment at 26±2 ℃ for 2-3 days; the hydroponic sunflower planting operation is as follows: select seeds with plump, undamaged shells, grow them in a petri dish containing three layers of filter paper soaked in tap water until the cotyledons open, then transfer them to a hydroponic pot with 1 / 4 Hoagland nutrient solution, and grow them at 26±2 ℃ under light for 16 hours and darkness for 8 hours until the cotyledons are fully unfolded and green; B. The injection method includes the following steps: Plant sunflowers until the two cotyledons are fully expanded. Use a needle-free syringe to draw up Agrobacterium resuspension containing a plant expression vector of exogenous genes. Gently make a non-penetrating wound on the back of the sunflower cotyledon with the syringe needle, and slowly inject the Agrobacterium resuspension through the wound. When water stains appear on the front of the cotyledon, the injection is successful. Water the seedlings thoroughly with tap water, cover them with plastic wrap to keep them moist, and incubate them in the dark for 3 days. Then, transfer them to a normal environment to continue growing. The specific operation for planting sunflowers is as follows: Sow sunflower seeds with shells in a mixed substrate of nutrient soil: vermiculite: perlite = 3:1:1 (v:v:v). Incubate at 26±2 ℃ for 16 h of light and 8 h of darkness until the two cotyledons are fully expanded. C. The ultrasonic vacuum method is adopted, specifically including the following steps: Shelled and sterile sunflower seeds are grown in petri dishes containing filter paper soaked in MS liquid medium at 26±2 ℃ in the dark for 2–3 days until the cotyledons are fully expanded; seedlings are placed in containers containing sterile water and ultrasonically treated at 40 Hz for 1–2 min to create micro-injuries; then placed in Agrobacterium resuspension containing a plant expression vector of exogenous genes and vacuum filtered at 0.05 kPa pressure for 5–10 min; absorbent paper is used to remove residual bacterial solution from the surface of the seedlings; under sterile conditions, the seedlings are placed in petri dishes containing liquid MS and 0.1–0.2 mmol / L acetylsyl syringone and cultured in the dark at 26±2 ℃ for 2–3 days; finally, they are transplanted into flowerpots containing a nutrient soil:vermiculite:perlite = 3:1:1 (v:v:v) mixed substrate and continued to grow at 26±2 ℃ under 16 h light / 8 h dark conditions; The preparation of the Agrobacterium tumefaciens bacterial culture containing the plant expression vector with the exogenous gene is as follows: Single clones are picked. EHA105 Agrobacterium was inoculated into liquid YEB medium containing 50 mg / L kanamycin and 25 mg / L rifampin and grown at 28°C with shaking at 220 rpm for 16 h; when the bacterial culture OD... 600 When the concentration is between 0.8 and 1.2, collect the bacterial pellet by centrifugation at 5000 rpm for 5–15 min using a high-speed centrifuge; wash the bacterial pellet three times with liquid MS medium containing 0.1–0.2 mmol / L acetylsuccinyl syringone; then resuspend; the resuspension procedure is one of the following: In Method A, the resuspension is performed as follows: The bacterial pellet is resuspended in liquid MS medium, 7% sucrose, 50 mmol / L CaCl2, 0.1 mg / L ascorbic acid, 0.1–0.2 mmol / L acetylsuccine, and 0.02% SILWETL-77. The solution is adjusted to pH 5.8, and the bacterial pellet is resuspended until the bacterial concentration reaches OD0.

05. 600 0.8~1.0; In Method B, the resuspension is performed as follows: The solution is adjusted to pH 5.8 using sucrose-free liquid MS medium, 10 mmol / L MgCl2, 10 mmol / L LMES, 0.1–0.2 mmol / L acetylsuccine, and 0.02% SILWETL-77. The bacterial pellet is then resuspended, and the bacterial suspension concentration is adjusted to OD0.

05. 600 0.8–1.0; In Method C, the resuspension is as follows: the bacterial precipitate is resuspended in liquid MS medium and 0.1–0.2 mmol / L acetylsyringone (pH 5.8) to achieve an OD concentration of 0.8–1.

0. 600 0.8~1.0.

Images