A nucleic acid detection system and its use in detecting DNA mutations
Patent Information
- Application Number
- CN202210201735.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-02
- Publication Date
- 2026-09-22
- Estimated Expiration
- 2042-03-02
AI Technical Summary
[0003]上述检测方法均是基于Cas12a/Cas13a蛋白的共有附属活性(可切割ssDNA或ssRNA)进行开发,在识别目标突变标记后,可以非特异性切割其它ssRNA或ssDNA,使荧光素摆脱了淬灭剂的淬灭,释放出荧光从而指示基因突变,但仍存在以下几个技术难点:(1)需要在系统中提供连接荧光分子及其淬灭剂的单链核酸分子,单链核酸存在结构不稳定带来的假阳性、储存期短等不足;(2)整个体系的单碱基区分能力全部依赖于CRISPR系统的识别能力,存在一定的脱靶风险,在具有相似序列的位置也可能会发生切割,因此对待识别的单核苷酸突变会带来假阳性等不足;(3)每个待测突变靶点对应一个Cas蛋白,增加了系统复杂性和成本,难以实现多靶点同时检测,正交性差
[0060]本发明具有如下特点:(1) 相较于其他利用CRISPR-Cas蛋白的附属活性的检测方法,本发明利用Cas蛋白的主活性,而非附属活性;(2) 本发明可以达到检测单个拷贝的灵敏度和1%的区分度(突变型/野生型);(3) 本发明可以达到检测8bp的粘性末端(overhang),这在别的检测方法中是没有检测过的;(4) 与Cas12a-based 附属活性检测方法相比,本发明更易进行多重检测;(5) 本发明是基于对粘性末端的识别而实现的核酸突变检测。
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically a nucleic acid detection system and its application in detecting DNA mutations. Background Technology
[0002] Genetic testing plays a crucial role in medicine and health, disease prevention, and pathogen detection. Existing genetic testing methods mainly include sequencing and PCR, but these methods suffer from drawbacks such as complexity and time consumption. In recent years, gene editing technologies, represented by CRISPR, have played a significant role in advancing research in areas such as site-directed mutagenesis, target gene knockout, target gene silencing and activation, site-directed gene integration, and single-base substitution. In commonly used CRISPR type II technology, crRNA (CRISRP RNA) guides Cas proteins to recognize and edit specific DNA sequences. Through continuous experience, researchers have found that following certain rules when designing crRNA (the specificity of crRNA is mainly related to the 8-12 sequences adjacent to the PAM) or modifying the Cas protein can effectively reduce off-target rates, thereby effectively identifying single-base mutations and accurately identifying specific DNA. In recent years, CRISPR technology has been initially developed and applied in the field of in vitro gene detection, and in vitro diagnostic technologies based on CRISPR gene editing technology were selected as one of the top ten scientific and technological advances in the world in 2018. Professor Feng Zhang of MIT has developed a novel gene diagnostic technology based on CRISPR, which can be used to detect the presence of Zika virus or dengue virus and perform typing simultaneously. It has also been used to identify specific bacterial types and detect antibiotic resistance genes (Science. 2017;356(6336):438-442). Meanwhile, based on Cas12a (also known as Cpf1), Professor Jennifer A. Doudna of the University of California, Berkeley, developed a CRISPR trans-reporter detection system called DNA endonuclease-targeted, which can be used to quickly and accurately detect various subtypes of human papillomavirus (Science. 2018;360(6387):436-439). Similarly, Dr. Jin Wang and others from the Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, have also established an in vitro nucleic acid detection technology based on Cas12a and successfully used it to detect rabies virus and Japanese encephalitis virus (Cell Discovery 2018, 4(1):20).
[0003] The above detection methods are all developed based on the shared accessory activity of Cas12a / Cas13a proteins (they can cleave ssDNA or ssRNA). After recognizing the target mutation marker, they can non-specifically cleave other ssRNA or ssDNA, allowing the fluorescein to escape the quenching of the quencher and release fluorescence to indicate gene mutations. However, there are still several technical difficulties: (1) The system needs to provide single-stranded nucleic acid molecules that connect the fluorescent molecules and their quenchers. Single-stranded nucleic acids have shortcomings such as structural instability leading to false positives and short storage periods; (2) The single-base discrimination ability of the entire system depends entirely on the recognition ability of the CRISPR system, which has a certain off-target risk. Cleavage may also occur at positions with similar sequences, thus leading to false positives for the single nucleotide mutations to be identified; (3) Each mutation target corresponds to a Cas protein, which increases the complexity and cost of the system, making it difficult to achieve simultaneous detection of multiple targets and resulting in poor orthogonality. This limits the development of this method to some extent. Summary of the Invention
[0004] Based on the problems existing in the prior art, this invention selects the Cas12a protein for research to detect... EGFR Taking multi-site mutations in genes and the novel coronavirus as examples, this invention induces the Cas12a protein to generate an 8bp sticky end after recognizing and cleaving the target. This sticky end is then recognized by a toehold-mediated strand displacement reaction (TSDR). The strand displacement reaction is driven entirely by the complementary base pairing with the toehold, requiring no enzyme involvement. It eliminates the need to consider the relatively harsh reaction conditions required in the presence of enzymes and can be completed at room temperature, improving the versatility and throughput of the reaction. In other words, this invention develops a novel nucleic acid diagnostic method with high sensitivity, strong specificity, and the ability to simultaneously detect multiple targets.
[0005] To address the aforementioned technical problems, the present invention first provides a system for detecting DNA mutations or detecting DNA sequences, the system comprising: Cas12a, crRNA, and TSDR reagent; The spacer sequence of the crRNA can identify the target mutation (or the target nucleotide in the test DNA). The TSDR reagent is either TSDR reagent 1 or TSDR reagent 2; TSDR reagent 1 is composed of reagent A, reagent B, reagent C, reagent E, reagent F and reagent G; The reagent A is a single-stranded DNA obtained by sequentially linking A1, A2, A3, and A4, with the structural formula 5′-A1-A2-A3-A4-3′. The length of A1 is 15-30 nt, the length of A2 is 15-30 nt, and A3 is inversely complementary to the sticky end obtained by the Cas12a cleavage of the DNA to be tested under the guidance of the crRNA. The length of A3 is 8 nt, and the length of A4 is 15-30 nt. The reagent B is a single-stranded DNA that is reverse complementary to A4; The reagent C is a single-stranded DNA obtained by sequentially linking C1 and C2, with the structural formula 5′-C1-C2-3′. C1 and A2 are inversely complementary, and the length of C2 is 15-30 nt. The reagent E is a single-stranded DNA obtained by sequentially linking E1 and E2, with the structural formula 5′-E1-E2-3′. The four nucleotides at the 5′ end of E1 and A3 are inversely complementary. The sequence of E2 is completely or partially the same as that of C1. The length of E1 is 4nt and the length of E2 is 15-30nt. The reagent F is a single-stranded DNA whose sequence is inversely complementary to C2 and whose 3′ end is labeled with a fluorescent quencher or fluorescent group; The reagent G is a single-stranded DNA whose sequence is reverse complementary to A1 and whose 5′ end is labeled with a fluorescent group or a fluorescence quencher group; when the 3′ end of the reagent F is close to the 5′ end of the reagent G, no fluorescence signal is emitted, and when the two are far apart, either the reagent F or the reagent G can generate a fluorescence signal. A1, A2, A3, A4, B, C1, C2, E1, E2, F, and G are not the same as or complementary to each other except for the complementary cases described above, and are all not the same as or complementary to the DNA of the sample to be tested. The TSDR reagent 2 is composed of reagent A′, reagent B′, reagent C′, reagent E′, reagent F′ and reagent G′; The reagent A′ is a single-stranded DNA obtained by sequentially linking A1′, A2′, A3′, and A4′, with the structural formula 3′-A1′-A2′-A3′-A4′-5′. The length of A1′ is 15-30 nt, the length of A2′ is 15-30 nt, and A3′ is inversely complementary to the sticky end obtained by the Cas12a cleavage of the DNA to be tested under the guidance of the crRNA. The length of A3′ is 8 nt, and the length of A4′ is 15-30 nt. The reagent B′ is a single-stranded DNA that is reverse complementary to A4′; The reagent C′ is a single-stranded DNA obtained by sequentially linking C1′ and C2′, with the structural formula 3′-C1′-C2′-5′, where C1′ and A2′ are inversely complementary, and the length of C2′ is 15-30 nt. The reagent E′ is a single-stranded DNA obtained by sequentially linking E1′ and E2′, with the structural formula 3′-E1′-E2′-5′. The four nucleotides at the 5′ end of E1′ and A3′ are inversely complementary. The sequences of E2′ and C1′ are completely or partially identical. The length of E1′ is 4nt, and the length of E2′ is 15-30nt. The reagent F′ is a single-stranded DNA whose sequence is inversely complementary to C2′ and whose 5′ end is labeled with a fluorescence quencher or a fluorescent group; The reagent G′ is a single-stranded DNA whose sequence is reverse complementary to A1′ and whose 3′ end is labeled with a fluorescent group or a fluorescence quencher group; when the 5′ end of the reagent F′ is close to the 3′ end of the reagent G′, no fluorescence signal is emitted, and when the two are far apart, the reagent F′ or the reagent G′ can generate a fluorescence signal. A1′, A2′, A3′, A4′, B′, C1′, C2′, E1′, E2′, F′, and G′ are not identical or complementary to each other except for the complementary cases described above, and all of them are not identical or complementary to the DNA of the sample to be tested.
[0006] In the above system, A3 and A3′ are used to bind to the sticky ends of the DNA to be tested, which are cleaved by Cas12a under the guidance of crRNA, through reverse complementarity.
[0007] When C1 and A2 are combined, E2 can unlink C1 and A2 through the combination of E1 and A3, thereby enabling E2 to combine with A2.
[0008] When C1′ and A2′ are combined, E2′ can unlink C1′ and A2′ through the combination of E1′ and A3′, thereby enabling E2′ and A2′ to combine.
[0009] A1, A2, A3, and A4 are connected to form A. These four segments can be connected via join segments or directly. C1 and C2 are connected to form C. These two segments can be connected via join segments or directly. E1 and E2 are connected to form E. These two segments can be connected via join segments or directly.
[0010] A1′, A2′, A3′, and A4′ are connected to form A′. These four segments can be connected via join segments or directly. C1′ and C2′ are connected to form C′. These two segments can be connected via join segments or directly. E1′ and E2′ are connected to form E′. These two segments can be connected via join segments or directly.
[0011] A1, A2, A3, A4, reagents B, C1, C2, E1, E2, reagent F, and reagent G may each contain one or more nucleotide mutations, insertions, or deletions.
[0012] A1′, A2′, A3′, A4′, reagents B′, C1′, C2′, E1′, E2′, reagent F′, and reagent G′ may each contain one or more nucleotide mutations, insertions, or deletions.
[0013] The reagents A, B, C, E, F, and G are able to satisfy the requirement that these six reagents can form a mixture in the same system as described above. Figure 1 The structure shown indicates that reagent G can form double-stranded DNA with A1, reagent F can form double-stranded DNA with C2, no fluorescence signal is emitted after reagent G binds to A1 and reagent F binds to C2, C1 can form double-stranded DNA with A2, E2 can also form double-stranded DNA with A2, E1 can bind to A3, and reagent B can form double-stranded DNA with A4.
[0014] The reagents A′, B′, C′, E′, F′, and G′ are able to satisfy the requirement that these six reagents can form a mixture in the same system as described above. Figure 1 The structure shown indicates that reagent G′ can form double-stranded DNA with A1′, reagent F′ can form double-stranded DNA with C2′, no fluorescent signal is emitted after reagent G′ binds to A1′ and reagent F′ binds to C2′, C1′ can form double-stranded DNA with A2′, E2′ can also form double-stranded DNA with A2′, E1′ can bind to A3′, and reagent B′ can form double-stranded DNA with A4′.
[0015] The fluorescence quenching group can quench the fluorescence signal emitted by the fluorescent group.
[0016] In the above system, both A3 and A3′ can contain locked nucleic acid modifications.
[0017] The first nucleotide at the 5′ end of A3 can be the target mutated nucleotide (or the target nucleotide in the DNA to be tested). A3 contains 6 locked nucleic acid modifications. The locked nucleic acid modifications of A3 are located at the 1st, 3rd, 5th, 6th, 7th, and 8th nucleotides from the 5′ end.
[0018] The first nucleotide at the 3' end of A3′ can be the target mutated nucleotide (or the target nucleotide in the DNA to be tested). A3′ can contain 6 locked nucleic acid modifications. The locked nucleic acid modifications of A3′ are located at the 1st, 3rd, 5th, 6th, 7th, and 8th nucleotides from the 3' end.
[0019] In the above system, the lengths of A1 and A1′ can be 15-25nt or 15-20nt, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30nt.
[0020] The lengths of A2 and A2′ can both be 20-25nt, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30nt.
[0021] The lengths of A4 and A4′ can both be 20-25nt, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30nt.
[0022] The lengths of C2 and C2′ can be 15-25nt or 15-20nt, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30nt.
[0023] The lengths of E2 and E2′ can both be 20-25nt, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30nt.
[0024] In the above system, the sequences of A1 and A1′ can both be the 1st to 16th positions of sequence 3.
[0025] Both A2 and A2′ can be the 17th to 38th positions of sequence 3.
[0026] Both A3 and A3′ can be the 39th to 46th positions of sequence 3.
[0027] Both A4 and A4′ can be the 47th to 68th positions of sequence 3.
[0028] Both reagent B and reagent B′ have sequences of sequence 4.
[0029] Both C1 and C1′ can be the first 22nd positions of sequence 5.
[0030] Both C2 and C2′ can be the 23rd to 38th positions of sequence 3.
[0031] Both E2 and E2′ can be the 5th to 26th positions of sequence 6.
[0032] Both reagent F and reagent F′ can have the sequence 7.
[0033] Both reagent G and reagent G′ can have the sequence 8.
[0034] In the above system, the length of the spacer sequence of the crRNA can be 17 nt.
[0035] The non-spacer sequence of the crRNA can be GAAUUUCUACUGUUGUAGAU.
[0036] When the spacer sequence of the crRNA binds to the test DNA, it can cover the target mutation (such as a single nucleotide mutation, insertion, deletion, or insertion or deletion of two or more nucleotides) or a portion of the target mutation (such as an insertion or deletion of two or more nucleotides) or the test nucleotide in the test DNA. When the target mutation in the test DNA is an SNP mutation, the target mutation in the crRNA can be located at the 15th nucleotide from the 5′ end of the spacer sequence.
[0037] In the above system, the sequence of Cas12a can be Z1), Z2), or Z3). Z1) is a protein whose amino acid sequence is positions 1-1300 of sequence 2; Z2) A protein that has the same function as the amino acid sequence shown in positions 1-1300 of sequence 2 in the sequence listing, but with one or more amino acid residues replaced and / or deleted and / or added. Z3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of Z1) or Z2).
[0038] To facilitate the purification of proteins in Z1, tags as shown in the table below can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in positions 1-1300 of sequence 2 in the sequence listing.
[0039] Table: Sequence of Labels
[0040] The protein in Z2 above is a protein that has 75% or more identity with the amino acid sequence of the protein shown in positions 1-1300 of sequence 2 and has the same function. The 75% or more identity refers to 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.
[0041] The proteins in Z2 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0042] The gene encoding the protein in Z2 above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in positions 1-3900 of Sequence 1, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in the table above to its 5′ end and / or 3′ end. The DNA molecule shown in positions 1-3900 of Sequence 1 encodes the protein shown in positions 1-3900 of Sequence 1.
[0043] The system may also contain other cleavage reagents (such as buffers) required for the Cas12a to cleave DNA under the guidance of the crRNA.
[0044] The above system may also contain other TSDR reagents required for TSDR reactions (such as buffer solutions, Mg2+, etc.). 2+ Na + wait).
[0045] The system described above may also contain RPA (Recombinase Polymerase Amplification) primers, which can amplify DNA fragments containing the target mutation (or the nucleotide to be tested in the DNA to be tested).
[0046] The amplification product of the RPA amplification primers contains the PAM sequence required for Cas12a recognition, and the position of the PAM sequence satisfies the target mutation (or the target nucleotide) in the DNA to be tested by the crRNA. In the RPA amplification product, the PAM sequence may be located upstream of the first nucleotide of the spacer sequence.
[0047] The system may also contain other RPA reagents (such as enzymes, buffers, etc.) required for RPA amplification. The system may also contain other transcription reagents (such as primers, enzymes, buffers, etc.) required for RNA transcription.
[0048] Specifically, the system may consist of the Cas12a, the crRNA, and the TSDR reagent, or it may consist of the Cas12a, the crRNA, the TSDR reagent, and other cleavage reagents, or it may consist of the Cas12a, the crRNA, the TSDR reagent, and other TSDR reagents, or it may consist of the Cas12a, the crRNA, the TSDR reagent, other TSDR reagents, and other TSDR reagents.
[0049] The system may also consist of the Cas12a, the crRNA, the TSDR reagent, and the RPA amplification primers, or it may consist of the Cas12a, the crRNA, the TSDR reagent, the RPA amplification primers, and at least one of the following: other TSDR reagents, other TSDR reagents, other RPA reagents, and other transcription reagents.
[0050] The system can be a product.
[0051] The TSDR reagent 1 or the TSDR reagent 2 are also within the scope of protection of this invention.
[0052] The present invention also provides a method for detecting DNA mutations, the method comprising: 1) The DNA to be digested is digested using the Cas12a and the crRNA to obtain the digestion product; the DNA to be digested is the DNA to be tested or the RPA amplification product containing the PAM sequence required for Cas12a recognition obtained by RPA amplification of the DNA to be tested using the RPA amplification primers. 2) Add reagent A, reagent B, reagent C, reagent E, reagent F, and reagent G to the cleavage product to carry out a TSDR reaction, or add reagent A′, reagent B′, reagent C′, reagent E′, reagent F′, and reagent G′ to carry out a TSDR reaction to obtain the reaction product; 3) Determine whether the DNA to be tested contains the target mutation according to steps 31) or 32) below: 31) Detect the fluorescence signal in the reaction product. If there is no fluorescence signal in the reaction product, the DNA to be tested contains or is a candidate to contain the target mutation; if there is a fluorescence signal in the reaction product, the DNA to be tested does not contain or is a candidate to not contain the target mutation. 32) Compare the fluorescence signals in the reaction product and the control reaction product. If the fluorescence signal in the reaction product is lower than that in the control reaction product, the DNA to be tested contains or is a candidate to contain the target mutation; if the fluorescence signal in the reaction product is higher than that in the control reaction product, the DNA to be tested does not contain or is a candidate to not contain the target mutation. The control reaction product is the reaction product obtained by replacing the DNA to be tested in step 1) with DNA that does not contain the target mutation and following steps 1) and 2).
[0053] In step 2) of the above method, reagents A, B, C, F, and G can be added to the reaction system and incubated (e.g., incubated at 95°C for 2 min) and then cooled (e.g., to room temperature); then the cleavage product can be added to the system and incubated (e.g., incubated at room temperature for 1 h); then reagent E can be added to the system to complete the TSDR reaction; Alternatively, reagents A′, B′, C′, F′, and G′ can be added to the reaction system and incubated (e.g., at 95°C for 2 min) and then cooled (e.g., to room temperature); then the cleavage product can be added to the system and incubated (e.g., at room temperature (25-27°C) for 1 h); finally, reagent E′ can be added to the system to complete the TSDR reaction.
[0054] The above-mentioned methods for detecting DNA mutations can be used for non-diagnostic purposes.
[0055] This invention also provides any of the following applications: X1) The application of the system described therein in the preparation of products for detecting DNA mutations; X2) The application of the system described therein in the preparation of DNA sequence detection products; X3) Application of the system described above in the detection of DNA mutations; X4) Application of the system described in DNA sequence detection.
[0056] When the system is applied to detect DNA sequences, the nucleotide at the target mutation site mentioned above is the nucleotide to be detected.
[0057] This invention also provides any of the following applications: X1) The application of the TSDR reagent 1 or the TSDR reagent 2 in the preparation of products for detecting DNA mutations; X2) The application of TSDR reagent 1 or TSDR reagent 2 in the preparation of DNA sequence detection products; X3) The application of the TSDR reagent 1 or the TSDR reagent 2 in the detection of DNA mutations; X4) The application of the TSDR reagent 1 or the TSDR reagent 2 in the detection of DNA sequences.
[0058] When the TSDR reagent 1 or the TSDR reagent 2 is used to detect DNA sequences, the nucleotide at the target mutation site mentioned above is the nucleotide to be detected.
[0059] In this invention, the target mutation can be a deletion / insertion mutation or an SNV mutation (such as SNP).
[0060] The present invention has the following characteristics: (1) Compared with other detection methods that utilize the accessory activity of CRISPR-Cas protein, the present invention utilizes the main activity of Cas protein, rather than accessory activity; (2) The present invention can achieve the sensitivity of detecting a single copy and a discrimination of 1% (mutant / wild type); (3) The present invention can detect 8bp sticky ends (overhang), which has not been detected in other detection methods; (4) Compared with Cas12a-based accessory activity detection methods, the present invention is easier to perform multiplex detection; (5) The present invention is a nucleic acid mutation detection based on the recognition of sticky ends. Attached Figure Description
[0061] Figure 1 Schematic diagram of the RPA-Cas12a-TSD mutation detection method. Note: The dashed box represents the PAM sequence, the solid box represents the SNP site, and the triangle symbol represents LNA modification.
[0062] Figure 2Schematic diagram of TSDR system detection. a, Schematic diagram of TSDR system. b, Schematic diagram of TSDR reaction with 8bp-overhang. c, Schematic diagram of TSDR reaction without 8bp-overhang. Note: F represents fluorescent group, Q represents fluorescence quencher group; the origin represents nucleotide.
[0063] Figure 3 Amplification and cleavage of target nucleic acids. a, RPA amplification results. b, Cas12a recognition and cleavage. EGFR Schematic diagram of the L858R gene mutant. Note: SNP sites are marked in red; WT indicates wild type; MT indicates mutant type.
[0064] Figure 4 The RPA-Cas12a-TSDR system can effectively distinguish SNVs. The fluorescence signal detection results for mutants L858R, delE746-A750, and T790M are shown in ac, with the curves from top to bottom representing NO-D, Wild type, Mutant type, and NO-E, respectively. The ΔFU calculation results are also shown, where d represents mutant L858R, e represents delE746-A750, and f represents T790M.
[0065] Note: Wild Type represents wild type, Mutant Type represents mutant type; EW results are all mutant results, EM results are all wild type results. n=3 replicates, ***p<0.001, **p<0.01, *p<0.05.
[0066] Figure 5 TSDR detection system optimization. ac, Fluorescence detection results for different amounts of LNA modification. d, ΔFU results for different amounts of LNA modification. eg, Fluorescence detection results for different toe E1 lengths of the attack chain E. h, ΔFU results for different toe lengths of the attack chain E. ik, Fluorescence detection results at different incubation temperatures. l, Calculated ΔFU results at different incubation temperatures.
[0067] Note: In ac, eg, and ik, the curves from top to bottom represent NO-D, Wild type, Mutant type, and NO-E, respectively. Wild type represents wild-type, and Mutant type represents mutant type. In d, h, and l, EW represents mutant results, and EM represents wild-type results. There are single nucleotide differences between mutant and wild-type. The SNP site is located at the first nucleotide of the 8bp overhang; 3 LNA modifications are located at nucleotides 2, 4, and 6, respectively; and 6 LNA modifications are located at nucleotides 1, 3, 5, 6, 7, and 8, respectively. n=3 replicates, ***p<0.001, **p<0.01, *p<0.05.
[0068] Figure 6 The RPA-Cas12a-TSDR system's detection sensitivity. ac, The TSDR system can detect a 10 nM target overhang. The curves from top to bottom represent NO-D, 10 nM, 20 nM, 40 nM, 60 nM, 80 nM, 100 nM, and NO-E. a shows the fluorescence display results of the L858R mutant detected by TSDR; b shows the delE746-A750 mutant; c shows the T90M mutant. df, Linearization analysis of ΔFU corresponding to different target concentrations. d, L858R mutant; e, delE746-A750 mutant; f, T90M mutant.
[0069] Figure 7 The RPA-Cas12a-TSDR system can detect single-copy nucleic acid molecules. RPA amplifies single-copy nucleic acid molecules, M represents the DNA molecular weight standard, and 1-9 represent the dilutions of the DNA sample to be tested, with concentrations ranging from 10 to 10. 8 10 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0 Copy / µL. bd, fluorescence signal detection results of mutants L858R, delE746A750, and T790M; the detection target is obtained by Cas12a cleavage of a single copy of nucleic acid molecule RPA amplification product; Notarget indicates that the detection target (i.e., D in the TSDR system) was replaced with an equal volume of deionized water; the curves from top to bottom are No target, Wild Type, Mutant Type. e, ΔFU calculation results.
[0070] Note: M represents Marker, n=3 replicates, ***p<0.001, **p<0.01, *p<0.05. Wild Type represents wild type, Mutant Type represents mutant type; EW all represent mutant results, EM all represent wild type results.
[0071] Figure 8 Detection of low-abundance mutants using the RPA-Cas12a-TSDR system. ac, fluorescence signal detection results for mutants L858R, delE746-A750, and T790M; curves from top to bottom are No target, 100:0, 99:1, 95:5, and 90:10. df, ΔFU calculation results.
[0072] Note: n=3 replicates, ***p<0.001, **p<0.01, *p<0.05. WT represents wild type, MT represents mutant type.
[0073] Figure 9 Multiple detection results from the RPA-Cas12a-TSDR system. From left to right, these are targets 1-8.
[0074] Figure 10 RPA-Cas12a-TSDR system cell sample detection. ac, fluorescence signal detection results for mutants L858R, delE746-A750, and T790M; the curves from top to bottom represent NO-D, Wild type, Mutant type, and NO-E. d, ΔFU calculation results.
[0075] Note: n=3 replicates, ***p<0.001, **p<0.01, *p<0.05. Wild Type represents wild type, Mutant Type represents mutant type; EW all represent wild type results, EM all represent mutant results.
[0076] Figure 11 SARS-CoV-2 S Gene and its mutant detection. a, SARS-CoV-2 S Gene fluorescence signal detection results, the curves from top to bottom are NO-D, S a) Gene, NO-E; b) Fluorescence signal detection results of mutant N501Y, with curves from top to bottom representing NO-D, Wild type, Mutant type, and NO-E; c) Fluorescence signal detection results of D614G, with curves from top to bottom representing NO-D, Wild type, Mutant type, and NO-E; d) Calculated ΔFU results.
[0077] Note: n = 3 repetitions, ***p < 0.001, **p < 0.01, *p < 0.05. Wild Type refers to the wild type (i.e., S (Gene), Mutant Type indicates mutant type; EW results are all wild-type results, and EM results are all mutant results.
[0078] Figure 12 SARS-CoV-2 S Results of simultaneous detection of three targets: genes and their mutants. From left to right, targets 1-5 are listed. Detailed Implementation
[0079] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0080] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in triplicate, and the results were averaged.
[0081] The cell line H1975 used in the following examples (Zhang Meng. Study on the mechanism of action of miRNA-149-3p and miRNA-149-5p in lung cancer [D]. Beijing University of Chemical Technology, 2019. DOI:10.26939 / d.cnki.gbhgu.2019.001469.) is available to the public from the applicant with the consent of Professor Wang Yandong's research group at Beijing University of Chemical Technology. This biological material is only for repeating the relevant experiments of this invention and may not be used for other purposes.
[0082] The cell line H1650 used in the following examples: Hefei Yuanen Biotechnology Co., Ltd.
[0083] Example 1: Preparation of Cas12a fusion protein 1. Pet28a- FnCpf1 plasmid preparation Replace the DNA fragment between the recognition sequences of XbaI and NotI in pET-28a(+) with the sequence shown in Sequence 1. Cas12a Genes were extracted to obtain a recombinant vector, which was denoted as Pet28a- FnCpf1 Pet28a- FnCpf1 Containing the DNA fragment shown in Sequence 1 of the sequence listing, this recombinant vector is able to express the fusion protein of Cas12a and His tag shown in Sequence 2 (denoted as Cas12a fusion protein).
[0084] In sequence 1, positions 1-3900 are Cas12a The gene sequence, positions 3901-3936, is the sequence on the pET-28a(+) vector. The DNA fragment described in Sequence 1 (denoted as...) Cas12a The fusion gene encodes the Cas12a fusion protein shown in sequence 2, where positions 1-1300 of sequence 2 are the amino acid sequence of Cas12a.
[0085] Cas12a
[0086]
[0087] 2. Expression and purification of Cas12a Import the Pet28a-FnCpf1 obtained in step 1. E. coli In BL21(DE3), single colonies were picked and inoculated into 5 mL of LB liquid medium containing kanamycin, and cultured overnight at 37 °C and 180 rpm / min. The next day, 50 μL of the bacterial culture was inoculated into 5 mL of LB liquid medium containing kanamycin and cultured at 37 °C and 180 rpm / min until the OD600 of the bacterial culture reached 0.4–0.6. IPTG was added to a final concentration of 0.4 mM, and the culture was carried out at 16 °C and 180 rpm / min for 16 h. The bacterial cells were collected by centrifugation and reconstituted in 15 mL of lysis buffer (50 mM Tris-HCl (pH 8.0), 1 M NaCl, 1 mM DTT, 5% (v / v) glycerol). The cells were then disrupted using a low-temperature ultra-high pressure cell disruptor. After centrifugation at 4 °C and 12000 rpm / min for 1 h, the supernatant was filtered through a membrane, and the filtrate was collected. After equilibrating the nickel column with 5 column volumes of solution A (30 mM imidazole, 50 mM Tris-HCl (pH 8.0), 1 M NaCl, 1 mM DTT, 5% (v / v) glycerol), the sample was loaded using a peristaltic pump at a flow rate of 4 mL / min. The protein was purified using AKTA, and eluted sequentially for 10 column volumes with different volume percentages of solution B (1 M imidazole, 50 mM Tris-HCl (pH 8.0), 1 M NaCl, 1 mM DTT, 5% (v / v) glycerol) (elution buffer consisting of solution A and solution B or solution B alone). The purified samples were then collected and run on a gel electrophoresis apparatus. The purified sample containing the target protein was then collected in a dialysis bag and placed in a large beaker containing 500 mL of storage buffer (50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 1 mM DTT, and 10% (v / v) glycerol). The mixture was dialyzed overnight on a magnetic stirrer. After dialysis, the product was transferred to an ultrafiltration tube and centrifuged at 4000 rpm for 1 h to concentrate the protein, yielding the Cas12a fusion protein solution. This solution was aliquoted and stored at -80°C for later use.
[0088] Example 2: RPA-Cas12a-TSD detection EGFR Gene mutation sites The steps of the RPA-Cas12a-TSD mutation detection method in this embodiment are as follows: Figure 1As shown, the process consists of three steps. The first step involves isothermal amplification of the target nucleic acid molecule using RPA (Recombinase Polymerase Amplification), with RPA amplification primers used. The second step utilizes CRISPR / Cas12a to identify and cleave the amplified product. In this step, Cas12a exhibits high substrate specificity; mutant amplified products are completely cleaved, producing an 8bp overhang with SNP sites (Nucleic Acids Research, 2017, Vol. 45, No. 9 e74 doi: 10.1093 / nar / gkx018), while wild-type amplified products are not cleaved and therefore do not produce an 8bp overhang, effectively distinguishing between wild-type and mutant amplified products. The final step uses the TSDR (Toehold-mediated strand displacement report) system to detect the 8bp overhang generated by Cas12a cleavage.
[0089] I. Establishment of RPA-Cas12a-TSDR Detection Method 1. RPA amplification Amplification reactions were performed using the Twist-Amp basic kit (TwistDX, Britsh) RPA reaction kit. Each RPA amplification reaction included 29.5 µL buffer, 2.4 µL each of upstream and downstream RPA amplification primers (primer concentration 10 µM), 2 µL template DNA (i.e., the DNA to be tested), 2.5 µL magnesium acetate, and 11.2 µL water. After incubating the mixture at 39 °C for 15 minutes, the amplification products were purified by ethanol precipitation.
[0090] 2. crRNA transcription The templates required for crRNA transcription were obtained from the upstream and downstream primers listed in Table 3 ("F" indicates the upstream primer, and "R" indicates the downstream primer). CREATE was then performed using the T7 High Yield Transcription Kit (Thermo Fisher Scientific, America) at 37 °C overnight. Finally, the transcripts were purified using the RNA Clean & Concentrator™-5 purification kit (Zymo Research, America).
[0091] 3. Cas12a cleavage reaction The purified amplified product obtained in step 1 was cleaved using Cas12a. The Cas12a cleavage reaction system consisted of 500 nM of the Cas12a fusion protein obtained in Example 1, 500 nM of the purified transcript obtained in step 2, 2 µL of the purified amplified product obtained in step 1, 0.5 µL of RNase inhibitor (TaKaRa, Japan), NEB buffer 3.1, and water to a final volume of 20 µL. The reaction was carried out at 37°C for 15 minutes to obtain the cleavage product.
[0092] 4. TSDR reaction Prepare the TSDR reaction system according to Table 1 below: Add 10X TAE buffer and Mg to the obtained system. 2+ Na + A, B, C, F, and G were incubated at 95℃ for 2 min and then cooled to room temperature. D (8 bp-Overhang) was then added to the system and incubated at room temperature for 1 h. E was then added to the system, and fluorescence signal detection was performed rapidly to complete the TSDR reaction. Throughout the process, fluorescence signal detection was performed every 10 s / cycle using a quantitative fluorescence analyzer (ABI QuantStudio 3). Table 1 shows the 10X TAE buffer (400 mM Tris-acetic acid, 20 mM EDTA, pH adjusted to 8 with glacial acetic acid). A: A single-stranded DNA obtained by sequentially linking A1, A2, A3, and A4, with the structural formula 5′-A1-A2-A3-A4-3′. When the DNA sample to be tested contains the target mutation, A3 is inversely complementary to one of the two 8bp-overhangs generated by the Cas12a cleavage of the DNA sample to be tested (or the RPA amplification product of the sample to be tested). The sequence of A is 5′-TGCTGAGTCCGCGGCC ATTCATGTC TTCAGCCCTCAACNNNNNNNNAACCCGTGCTCATGTCCGATCG -3′ (Sequence 3), the bold part is A1, the single underline part is A2, the double underline part is A3, N is A, T, C, G, and the dashed underline part is A4; B: Single-stranded DNA reverse complementary to A4, sequence 5′- CGATCGGACATGAGCACGGGTT -3′ (Sequence 4); C: Single-stranded DNA obtained by sequentially linking C1 and C2, with the structural formula 5′-C1-C2-3′. C1 is inversely complementary to A2. The sequence of C is 5′- GTTGAGGGCTGAAGACATGAAT TATTCaaGtgacgact -3′ (Sequence 5), the underlined part is C1, and the italic part is C2; D: The cut product obtained in step 3; E: A single-stranded DNA obtained by sequentially linking E1 and E2, with the structural formula 5′-E1-E2-3′. The four nucleotides at the 5′ end of E1 are anticomplementary to those at the 5′ end of A3. The sequence of E2 is identical to that of C1. The sequence of E is 5′- NNNN GTTGAGGGCTGAAGACATGAAT-3′ (Sequence 6), N is A, T, C, G, the double underscore part is E1, and the ununderscore part is E2; F: Single-stranded DNA with a sequence reverse complementary to C2 and labeled with a fluorescence quencher Q at the 3′ end; sequence is 5′- AGTCGTCACTTGAATA -Q-3′ (sequence 7); G: A single-stranded DNA with a sequence that is reverse complementary to A1 and labeled with a fluorescent group F at the 5′ end, the sequence being 5′-F-GGCCGCGGACTCAGCA-3′ (Sequence 8); the fluorescence emitted by the fluorescent group F can be quenched by the fluorescence quenching group Q in F.
[0093] A1, A2, A3, A4, B, C1, C2, E1, E2, F, and G are not identical or complementary to each other except for the complementary cases described above, and are all not identical or complementary to the DNA of the sample to be tested.
[0094] The relationships between the sequences are as follows Figure 2 As shown in Figure a.
[0095] Table 1. TSDR Reaction System
[0096] Note: " / " indicates that the reagent is not added.
[0097] When the RPA amplification product of the DNA sample to be tested is cleaved by Cas12a to produce an 8bp-overhang (i.e., the DNA sample to be tested contains the target mutation), this 8bp-overhang can bind to A3, preventing the attacking strand E from binding to the A strand. This makes it difficult for the E strand to replace the C strand, thus the fluorescent group F is further quenched by the fluorescent quenching group Q. Figure 3 (b) This means that after the TSDR reaction, the system emits no fluorescence signal or only contains background fluorescence. However, when the RPA amplification product of the sample DNA is not cleaved by Cas12a (i.e., the sample DNA does not contain the target mutation), there is no 8bp-overhang in the system. The attacking strand E easily binds to the A strand and replaces the C strand. The fluorescence quencher Q cannot continue to quench the fluorescent group F, thus the fluorescent group F displays fluorescence. Figure 3 (c) means that after the TSDR reaction is completed, the system emits a high fluorescence signal.
[0098] II. RPA-Cas12a-TSDR can effectively detect mutations. Select EGFR The three common gene mutation sites (L858R, T790M, delE746-A750) were used as targets for detection. The synthesized sequence is shown in Figure 9. EGFR Wild-type gene and sequence 10 containing three mutation sites EGFR Mutant genes. The L858R mutation site is nucleotide 2573 of sequence 9, with T in the wild type and G in the mutant type; the T790M mutation site is nucleotide 2369 of sequence 9, with C in the wild type and T in the mutant type; the delE746-A750 mutation site is nucleotides 2236-2250 of sequence 9, with nucleotides 2236-2250 in the wild type and nucleotides 2236-2250 deleted in the mutant type.
[0099] 1. RPA amplification Following the RPA amplification method in step 1, the three primer pairs (L858R-RPA-F and L858R-RPA-R, T790M-RPA-F and T790M-RPA-R, and del-RPA-F and del-RPA-R) from Table 2 were used to synthesize... EGFR RPA amplification was performed using the wild-type gene as a template to obtain the wild-type amplification product at the L858R site. Figure 3 The a, EGFR-WT), T790M wild-type amplification product, and delE746-A750 wild-type amplification product were synthesized using the three primer pairs L858R-RPA-F and L858R-RPA-R, T790M-RPA-F and T790M-RPA-R, and del-RPA-F and del-RPA-R from Table 2, respectively. EGFR RPA amplification was performed using the mutant gene as a template to obtain the L858R site mutant amplification product. Figure 3 The amplification products were obtained from the following sites: α, EGFR-MT, T790M mutant amplification product, and delE746-A750 mutant amplification product. Then, each amplification product was purified according to the method described in step 1.
[0100] Table 2. RPA amplification primers
[0101] Note: Uppercase letters indicate the artificial introduction of mismatched nucleotides to obtain the PAM sequence required for Cas12a recognition. SNP mutation sites such as L858R are located 15 nucleotides downstream of the PAM sequence.
[0102] 2. crRNA transcription Following the crRNA transcription method in step 1, section 2, the double-stranded DNA molecules obtained by cross-amplification of crRNA-F and L858R-R in Table 3 were transcribed to obtain the L858R transcript. Then, the transcript was purified according to the method in step 1, section 2. The sequence of the L858R transcript is GAAUUUCUACUGUUGUAGAUCACAGAUUUUGGGCGGG.
[0103] Following the crRNA transcription method in step 1, section 2, the double-stranded DNA molecules obtained by cross-amplification of crRNA-F and T790M-R (Table 3) were transcribed to obtain the T790M transcript. The transcript was then purified according to the method in step 1, section 2. The sequence of the T790M transcript is GAAUUUCUACUGUUGUAGAUCGUGCAGCUCAUCAUGC.
[0104] Following the crRNA transcription method in step 1, section 2, the double-stranded DNA molecules obtained by cross-amplification of crRNA-F and del-R in Table 3 were transcribed to obtain the delE746-A750 transcript. Then, the transcript was purified according to the method in step 1, section 2. The sequence of the delE746-A750 transcript is GAAUUUCUACUGUUGUAGAUGGAGAUGUCUUGAUAGC.
[0105] Table 3. Primers required for crRNA transcription template
[0106] Note: The bolded portions of crRNA-F are inversely complementary to the bolded portions of L858R-R, T790M-R, del-R, SARS-R, N501Y-R, and D614G-R; the underlined portions specifically recognize RPA products.
[0107] 3. Cas12a cleavage reaction Following the method in step 1, section 3, the L858R mutant amplification product obtained in step 1 was used as the DNA to be tested. The purified L858R transcript obtained in step 2 and the Cas12a fusion protein obtained in Example 1 were used to perform a Cas12a cleavage reaction to obtain the L858R mutant cleavage product. Figure 3 (b) Using the wild-type amplification product of the L858R site obtained in step 1 as a control, the wild-type control cleavage product of L858R was obtained.
[0108] Following the method in step 1, section 3, the T790M mutant amplification product obtained in step 1 was used as the DNA to be tested. The purified T790M transcript obtained in step 2 and the Cas12a fusion protein obtained in Example 1 were used to perform a Cas12a cleavage reaction to obtain the T790M mutant cleavage product. The wild-type T790M amplification product obtained in step 1 was used as a control to obtain the T790M wild-type control cleavage product.
[0109] Following the method in step 1, section 3, the delE746-A750 mutant amplification product obtained in step 1 was used as the DNA to be tested. The purified delE746-A750 transcript obtained in step 2 and the Cas12a fusion protein obtained in Example 1 were used to perform a Cas12a cleavage reaction to obtain the delE746-A750 mutant cleavage product. The wild-type delE746-A750 amplification product obtained in step 1 was used as a control to obtain the delE746-A750 wild-type control cleavage product.
[0110] 4. TSDR reaction Following the method in step 1, section 4, the TSDR reaction fluorescence signal of each cleavage product obtained in step 3 was detected. For the detection of L858R mutant cleavage products and L858R wild-type control cleavage products, A is A-L858R(6LNA) in Table 4, E is E-L858R-4nt in Table 4, the fluorescence quencher Q in F is BHQ1, and the fluorescent group F in G is FAM; For the detection of T790M mutant cleavage products and T790M wild-type control cleavage products, A is A-T790M in Table 4, E is E-T790M in Table 4, the fluorescence quencher Q in F is BHQ1, and the fluorescent group F in G is FAM; For the detection of delE746-A750 mutant cleavage products and delE746-A750 wild-type control cleavage products, A is A-delE746-A750 in Table 4, E is E-delE746-A750 in Table 4, the fluorescence quencher Q in F is BHQ1, and the fluorescent group F in G is FAM.
[0111] The endpoint fluorescence value of each sample was selected for calculation ΔFU=
F(t)-F(NO-E)
[0112] Table 4. Nucleotide sequences of the TSDR system
[0113] Note: The bolded part is the 8bp-overhang complementary region; the underlined part is LNA modification.
[0114] The RPA-Cas12a-TSDR system for EGFR The detection results for the three gene mutation sites (L858R, T790M, delE746-A750) are as follows: Figure 4 As shown in Figure ac, there were significant differences in ΔFU between the wild-type and mutant types at all three mutation sites. Figure 4 The data (df) indicates that the RPA-Cas12a-TSDR system can effectively detect del deletion mutations and SNP mutations.
[0115] III. Optimization of the RPA-Cas12a-TSDR Detection Method 1. Optimization of 8bp-overhang locked nucleotides An 8bp overhang was formed by annealing two primers, and detection was performed using a TSDR system, which was then optimized. Because 8bp base pairing is unstable, the inventors introduced locked nucleic acid modifications into its complementary region and optimized the system by introducing different amounts of locked nucleic acid modifications.
[0116] Through testing EGFR The mutation site (L858R) of the gene was used to determine the effect of different numbers of locked nucleic acid modifications in the 8bp-overhang on the experimental results. Specifically, following the method in steps 1-4 of step 2, A-L858R(6LNA) was replaced with A-L858R(0LNA), A-L858R(3LNA), or A-L858R(6LNA), while keeping all other steps unchanged, and ΔFU was calculated.
[0117] Introducing different numbers of locked nucleic acids into the 8bp-overhang revealed differences in the detection results of the TSDR system. For example... Figure 5 As shown in Figure 1, when six locked nucleic acids were introduced and the modifications were located at SNP sites, the fluorescence difference was significant. This indicates that the fluorescence signal decreases with increasing number of locked nucleic acids introduced, and the TSDR system shows the most significant differentiation between wild-type and mutant types when the SNP site is modified with LNA.
[0118] 2. Optimization of the length of E1 in E Next, we optimize the attack chain E for different toe lengths (i.e., the length of E1). We select toes of 3, 4, and 5nt for testing. Specifically, following steps 1-4 in step two, we replace E-L858R-4nt with E-L858R-3nt, E-L858R-4nt, or E-L858R-5nt, keeping all other steps unchanged, and calculate ΔFU.
[0119] The results are as follows Figure 5As shown in Figure 1, the fluorescence signal increases with increasing toe length. When the toe length is 5 nt, both wild-type and mutant types exhibit high fluorescence signals, making effective differentiation impossible. At a toe length of 3 nt, wild-type and mutant types can be effectively distinguished, but their fluorescence signals are low, failing to achieve the expected results. However, when the toe length is 4 nt, both wild-type and control types show strong fluorescence signals, while the mutant type shows a lower fluorescence signal, indicating a significant difference between the two. Furthermore, ΔFU calculations revealed significant differences between wild-type and mutant types at toe lengths of 3 nt and 4 nt. Therefore, a toe length of 4 nt is considered the optimal length.
[0120] 3. Temperature optimization Finally, the effects of different incubation temperatures after adding D(8bp-overhang) on the TSDR detection system were investigated. Specifically, following the method in steps 1-4 of step 2, the incubation temperature in step 4 was replaced by 15℃, 20℃, 30℃, or 35℃ respectively, while keeping other steps unchanged, and ΔFU was calculated.
[0121] The results are as follows Figure 5 As shown in Figure 1, fluorescence signal detection results differ at different temperatures. When the temperature is too low, the difference between wild-type and mutant is not significant; when the temperature is too high, the difference between wild-type and mutant decreases. ΔFU calculations revealed that the difference between wild-type and mutant was most significant at 25℃. When the temperature increased to 30-35℃, the significance of the difference decreased. Therefore, the optimal incubation temperature is room temperature (25-27℃).
[0122] Example 3: Sensitivity of the RPA-Cas12a-TSDR system for detecting gene mutation sites First, we verified the minimum concentration of Cas12a cleavage products that the TSDR system could detect. Next, following steps 1-4 of Example 2, we used the TSDR system to... EGFR Three mutant targets of the gene were detected at different concentrations. The concentrations of the L858R mutant cleavage product, the T790M mutant cleavage product, and the delE746-A750 mutant cleavage product in the TSDR reaction system were all set to 10 nM (≈ 6 × 10⁻⁶). 9 (Copies / µL), 20 nM (1.2 × 10⁻⁶) 10 (Copies / µL), 40 nM (1.8 × 10⁻⁶) 10 (Copies / µL), 60 nM (3.6 × 10⁻⁶) 10 (Copies / µL), 80 nM (4.8 × 10⁻⁶) 10 (copy / µL), 100nM (6×10) 10 (Copy / µL), all other steps remain unchanged. Detection results are as follows: Figure 6As shown in the figure, the lowest TSDR system can detect 10 nM (≈ 6 × 10⁻⁶). 9 The cleavage product is 1 copy / µL.
[0123] In addition, linearization analysis was performed on the ΔFU values of different concentrations of the detection substrate, and its R... 2 All values reached above 0.9, proving that there is a good linear relationship between them. Figure 6 (df).
[0124] Next, the inventors tested the minimum number of nucleic acid molecules that the RPA-Cas12a-TSDR system could detect. Following steps 1-4 of Example 2, the substrate (i.e., the DNA sample to be tested) nucleic acid concentration was diluted to different gradient concentrations (i.e., 10... 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 (copy / µL), followed by RPA amplification. The RPA amplification products were verified by agarose gel electrophoresis, as shown in the figure. Figure 7 As shown in Figure a, RPA amplification can effectively amplify single-copy nucleic acid molecules. Finally, the Cas12a cleavage product of the single-copy amplification product was detected using the TSDR system, which showed that the system could effectively detect the fluorescence signal and clearly distinguish between wild-type and mutant types. Figure 7 (bd). Furthermore, ΔFU calculations revealed significant differences between wild-type and mutant types ( Figure 7 (e).
[0125] Detection of low-abundance mutants using the RPA-Cas12a-TSDR system: Following steps 1-4 of Example 2, the wild-type and mutant cleavage products of the three mutants were mixed in different proportions and added as D to the TSDR reaction system. All other steps remained unchanged, and the system was then used for detection. The molar ratio of wild-type to mutant cleavage products was set to 90:10, 95:5, 99:1, and 100:0.
[0126] Test results as follows Figure 8 As shown in Figure 1, the RPA-Cas12a-TSDR system can detect 1% of the mutant targets (molar ratio of wild-type to mutant cleavage products is 99:1). Furthermore, ΔFU calculations revealed a significant difference between the 1% mutant targets and the wild-type. Figure 8 (df).
[0127] Example 4: RPA-Cas12a-TSDR multiplex detection EGFR Three mutation sites of the gene Following the method described in steps 1-4 of Example 2, equal amounts of A-L858R(6LNA), A-T790M, and A-delE746-A750 were mixed. The resulting mixture (with a concentration of 100 nM for each of A-L858R(6LNA), A-T790M, and A-delE746-A750) was added to the TSDR reaction system, replacing A in Table 1. The G used for L858R mutation detection was designated G-L858R (fluorescent group: FAM, sequence same as G above), the G used for T790M mutation detection was designated G-T790M (fluorescent group: ROX, sequence same as G above), and the G used for delE746-A750 mutation detection was designated G-delE746-A750 (fluorescent group: HEX, sequence same as G above). Equal amounts of -L858R, G-T790M, and G-delE746-A750 were mixed, and the resulting mixture (with a concentration of 100 nM for each of G-L858R, G-T790M, and G-delE746-A750) was added to the TSDR reaction system, replacing the G in Table 1. The detection target was added to the TSDR reaction system as D. Equal amounts of E-L858R-4nt, E-T790M, and E-delE746-A750 were mixed, and the resulting mixture (with a concentration of 100 nM for each of E-L858R-4nt, E-T790M, and E-delE746-A750) was added to the TSDR reaction system, replacing the E in Table 1. All other steps remained unchanged, and the three mutations of L858R-790M and delE746-A750 were detected simultaneously.
[0128] The detection targets are: an equal volume mixture of L858R mutant cleavage product, T790M mutant cleavage product and delE746-A750 mutant cleavage product (denoted as detection target 1), with deionized water as detection target 2, an equal volume mixture of L858R mutant cleavage product and delE746-A750 mutant cleavage product (denoted as detection target 3), L858R mutant cleavage product (denoted as detection target 4), an equal volume mixture of L858R mutant cleavage product and T790M mutant cleavage product (denoted as detection target 5), an equal volume mixture of T790M mutant cleavage product and delE746-A750 mutant cleavage product (denoted as detection target 6), T790M mutant cleavage product (denoted as detection target 7), and delE746-A750 mutant cleavage product (denoted as detection target 8).
[0129] The results are as follows Figure 9As shown, the RPA-Cas12a-TSD system can simultaneously detect three targets and calculate their fluorescence values. All three mutant targets differ from the wild-type, and the orthogonality is good. Furthermore, the RPA-Cas12a-TSD system can detect different combinations of targets.
[0130] Example 5: Detection of cell samples using the RPA-Cas12a-TSDR system Cell line H1975 is EGFR The T790M and L858R double mutant strains and the H1650 cell line are delE746-A750 deletion mutant strains. Next, these two cell lines were cultured and nucleic acid was extracted. The extracted nucleic acid was used as the DNA sample to be tested and was detected according to the methods in steps 1-4 of Example 2. The three wild-type amplification products in step 2 of Example 2 were used as wild-type controls.
[0131] The detection results are shown in Figure 10 (ac). This system successfully detected both mutant cell lines. Fluorescence value calculations revealed significant differences between all three mutant types and the wild type. Figure 10 (d).
[0132] Example 6: Detection of SARS-CoV-2 using the RPA-Cas12a-TSDR system S Genes and their mutation sites Following steps 1-4 of Example 2, SARS-CoV-2 was respectively... S Gene (Nanjing Genscript Biotech Co., Ltd., its sequence is sequence 11 in the sequence listing), SARS-CoV-2 S The N501Y mutant of the gene (Nanjing Genscript Biotech Co., Ltd., its sequence is sequence 12 in the sequence listing), SARS-CoV-2 S The D614G mutant of the gene (Nanjing Genscript Biotech Co., Ltd., its sequence is sequence 12 in the sequence listing) was used as the DNA sample to be tested for SARS-CoV-2. SThe RPA amplification primers used for the gene were SARS-RPA-F and SARS-RPA-R from Table 2, and the crRNA transcription primers were crRNA-F and SARS-R from Table 3. The A primers used were A-SARS from Table 4, and the E primers were E-SARS from Table 4. The fluorescent group was FAM, and the fluorescence quencher was BHQ1. The RPA amplification primers used for the N501Y mutant were N501Y-RPA-F and N501Y-RPA-R, and the crRNA transcription primers were crRNA-F and SARS-R from Table 3. For N501Y-R, the A used is A-N501Y in Table 4, the E used is E-N501Y in Table 4, the fluorescent group is FAM, and the fluorescence quencher is BHQ1; for the D614G mutant, the RPA amplification primers used are D614G-RPA-F and D614G-RPA-R, the crRNA transcription primers used are crRNA-F and D614G-R in Table 3, the A used is A-D614G in Table 4, the E used is E-D614G in Table 4, the fluorescent group is FAM, and the fluorescence quencher is BHQ1.
[0133] Test results as follows Figure 11 As shown in Figure 1, this system can effectively combat SARS-CoV-2. S Genes and their mutants were analyzed, and ΔFU showed significant differences between mutant and wild types. Figure 11 (d).
[0134] In addition, the inventors also used different fluorescent groups to target SARS-CoV-2 according to the method in Example 4. S Simultaneous multiplex detection of genes and their mutants is performed as follows: Following the method described in steps 1-4 of Example 2, equal amounts of A-SARS, A-N501Y, and A-D614G from Table 4 were mixed. The resulting mixture (with concentrations of A-SARS, A-N501Y, and A-D614G all at 100 nM) was added to the TSDR reaction system, replacing A in Table 1. SARS-CoV-2 was then added to the reaction system. SThe G used for gene mutation detection is denoted as G-SARS (fluorescent group is FAM, sequence is the same as G above), the G used for N501Y mutation detection is denoted as G-N501Y (fluorescent group is HEX, sequence is the same as G above), and the G used for D614G mutation detection is denoted as G-D614G (fluorescent group is ROX, sequence is the same as G above). Equal amounts of G-SARS, G-N501Y, and G-D614G are mixed. The resulting mixture (G-SARS, G-N501Y, G-D614G) is... The concentrations of Y and G-D614G (both 100 nM) were added to the TSDR reaction system, replacing G in Table 1. The detection target was added as D to the TSDR reaction system. Equal amounts of E-SARS, E-N501Y, and E-D614G from Table 4 were mixed, and the resulting mixture (the concentrations of E-SARS, E-N501Y, and E-D614G were all 100 nM) was added to the TSDR reaction system, replacing E in Table 1. All other steps remained unchanged. SARS-CoV-2 was then tested. S Simultaneous detection of genes and their two mutations.
[0135] The detection targets are as follows: Detection Target 1: SARS-RPA-F and SARS-RPA-R against SARS-CoV-2 S Cas12a cleavage products of RPA amplification of the gene, N501Y-RPA-F and N501Y-RPA-R against SARS-CoV-2 S Cas12a cleavage products of RPA amplification products of the N501Y mutant gene, D614G-RPA-F and D614G-RPA-R against SARS-CoV-2 S An equal volume mixture of RPA amplification product of the D614G mutant and Cas12a cleavage product; Target 2: Deionized water; Detection Target 3: SARS-RPA-F and SARS-RPA-R against SARS-CoV-2 S Cas12a cleavage products of RPA amplification of the gene, N501Y-RPA-F and N501Y-RPA-R against SARS-CoV-2 S An equal volume mixture of RPA amplification product and Cas12a cleavage product of gene N501Y mutant; Detection Target 4: SARS-RPA-F and SARS-RPA-R against SARS-CoV-2 S Cas12a cleavage product of RPA amplification of gene; Detection Target 5: SARS-RPA-F and SARS-RPA-R against SARS-CoV-2 SThe Cas12a cleavage products D614G-RPA-F and D614G-RPA-R of the RPA amplification products of the gene are effective against SARS-CoV-2. S An equal volume mixture of RPA amplification product of the D614G mutant and Cas12a cleavage product.
[0136] The test results are shown in Figure 12. The system can successfully detect SARS-CoV-2. S Multiplex detection of the gene and its mutants was performed, and the ΔFU results showed a significant difference between the mutant and wild types with good orthogonality. Furthermore, the RPA-Cas12a-TSD system can detect different target combinations.
[0137] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Beijing University of Chemical Technology <120> A nucleic acid detection system and its application in detecting DNA mutations <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 3936 <212> DNA <213> Artificial sequence <400> 1 atgagtatct accaggaatt tgtcaataaa tacagcctgt ctaaaacgct ccgctttgaa 60 ctgattccac agggcaaaac actggagaac atcaaagccc gcggcctgat tctggacgat 120 gaaaaacgtg caaaggatta taaaaaagcc aaacagatca ttgacaagta tcatcaattc 180 tttattgagg aaattctctc tagtgtatgc atttcagagg atctgctgca aaactattcg 240 gatgtgtact ttaaactgaa gaaatctgat gatgacaact tgcagaagga ctttaagtcg 300 gctaaggaca ccatcaagaa acagattagt gaatatatta aagactccga aaaattcaaa 360 aatctgttta atcagaatct gattgacgcc aagaaaggcc aggaatcaga cctgatcctg 420 tggttgaaac agagtaagga taacggtatt gaacttttta aagcgaattc ggatattacc 480 gacatcgacg aagcattgga aattattaag agctttaaag gttggactac ttatttcaaa 540 ggatttcatg agaaccgcaa aaatgtgtat tcaagtaacg atattccgac aagcatcatt 600 taccgtattg tagacgataa cctgccgaaa tttctggaaa ataaagcgaa gtacgaaagc 660 cttaaagata aagcgcccga agccattaac tacgagcaga ttaaaaaaga tttggccgag 720 gaacttacct tcgatattga ttacaagacc tctgaagtca atcagcgtgt gttttcactg 780 gacgaagtct ttgagatcgc caacttcaac aactatctga accagtccgg cattacgaaa 840 tttaacacca ttatggcgg gaaattcgtt aatggtgaaa acactaagcg gaaaggcatt 900 aacgaata tcaatctgta ctcacagcaa atcaatgaca aaactttgaa aaaatacaag atgtctgtcc tcttcaaaca gattctctca gataccgaaa gcaaatcttt cgtcatcgac aaattagagg atgacagcga tgtcgtcact actatgcaga gcttttatga acaaattgcc gcgtttaaaa cggtagaaga gaaatcaatc aaagaaaccc tgtcgctcct gttcgatgat ctgaaagcgc agaaactcga cctgtctaag atttacttca aaaatgataa aagtctgacg gatctgagcc agcaggtctt tgacgactat tcagtaattg gcacggctgt attggaat atcactcaac agattgcccc gaaaaactta throwacccgt ctaaaaaga acaggaactg atcgctaaaa aaacagagaa agcaaaatat ctgagcttgg aaactatcaa attagcgctg gaggagttca ataaacaccg tgacattgat aaacagtgcc gctttgagga gattctggcg aacttcgcgg cgattcccat gatcttcgat gaattgcgc agaataaga taacttggca cagatcagca tcaaatatca aaaccaaggt aagaaagatt tgcttcaagc ttccgcggag gatgatgtga aggccatcaa ggatctgctg gatcagacca ataacctcct gcataaactt aaaattttcc atattagtca gtctgaagat aaagcgaata ttctggacaa agatgaacac 1680 tttttttag tgttcgaaga gtgcttttt gaactggcta acattgtccc gctgtacaac 1740 aagattcgta actatatcac tcagaaaccg tattccgacg aaaaattcaa gctcaatttc 1800 gaaaattcca cgctggcaaa cggttgggac aaaaacaaag aaccggataa tacagcgatc 1860 ttatttatca aagatgataa gtactatctc ggcgtgatga acaaaagaa caataagatt 1920 ttcgatgaca aggcaattaa agacaacaaa ggcgaaggct acaaaaaat cgtatataaa 1980 ctgctgccgg gtgcgaacaa aatgttacca aaagtgtttt tctcggcgaa aagtatcaaa 2040 ttttacaacc ctagcgagga catcttacgc attcgtaatc atagcacgca cactaaaaat 2100 ggatctccgc aaaaaaggata tgaaaagttt gaattcaaca ttgaagaattg ccgtaaattc 2160 attgatttct aaaacagag tatttccaaa catccggaat ggaaagactt tggttttcgt 2220 ttcagcgata ctcagcgcta taactcgatc gacgaattct accgtgaggt agaaaatcag 2280 ggctataaac tcacgtttga gaatattagt gagagctaca ttgattccgt ggtcaaccag 2340 gggaaattgt acctgtttca gatttataat aaagatttct cggcctatag taaaggtcgg 2400 ccaaacctgc ataccctgta ctggaaagcc ctgtttgatg aacgcaacct gcaggacgtc 2460 gtttacaaat taaacggcga agcggaactg tttatcgta aacagtctat tcctaaaaaa 2520 atcacgcatc ctgccaagga agctattgca aacaagaata aagataaccc aaagaaagaa 2580 tctgtcttcg aatatgatct tattaaagat aaacggttca cggaggacaa gtttttcttt 2640 cactgcccaa ttaccattaa tttcaaatct tcaggtgcta ataaattcaa cgatgaaatt 2700 aatttgttgc tgaaagaaaa agctaacgat gtgcatatcc tgtcgatcga tcgtggcgaa 2760 cgccatcttg cgtactacac cctcgtcgac ggcaagggaa atatcatcaa acaggacact 2820 tttaatatca ttgggaatga tcgtatgaaa acgaattacc atgataaact tgcagccatt 2880 gagaaggacc gggatagcgc gcggaaagac tggaagaaga ttaacaatat caaagagatg 2940 aaagaaggtt acctgagtca agtggtccat gagattgcta agcttgttat cgagtataac 3000 gcaattgtgg tcttcgaaga tcttaatttt ggttttaagc ggggtcgttt taaagtcgaa 3060 aaacaggtct atcagaaact ggagaaaatg ctgattgaaa aactgaacta tcttgtgttt 3120 aaagataacg aattcgataa aaccggcggc gttcttcgtg cctatcaact gacagcaccg 3180 ttcgaaacat ttaaaaaaat gggcaaacag accggaatca tttactatgt gcccgccggg 3240 ttcacctcaa agatttgtcc tgtgacgggc ttcgtcaatc aactctaccc aaaatacgaa 3300 tcggttagta aaagtcagga attcttctcc aagtttgata agatctgtta caacctggac 3360 aaagggtact ttgagtttag ctttgattac aaaaactttg gagacaaggc ggccaaagga 3420 aagtggacta tcgcttcctt tggcagtcgg ctgattaact tccgtaactc ggataagaac 3480 cacaactggg acacacgtga agtttatccg actaaggagc tggaaaaact gttgaaagat 3540 tactcgattg aatacggcca tggtgaatgc attaaagcag cgatttgtgg tgaaagtgat 3600 aagaaatttt tcgcaaaact gacgtcagta cttaacacga ttctgcagat gcgtaattcg 3660 aaaaccggca cggagctgga ttacttaatc tctcctgtgg cagatgtgaa cggcaatttt 3720 ttcgactcgc gtcaggcgcc gaaaaatatg ccgcaggatg ccgatgcgaa cggcgcgtat 3780 cacattggct tgaaggggct gatgttgctc gggcgcatta aaaacaatca agaaggcaaa 3840 aagttaaacc tggtcattaa aaacgaagag tacttcgaat ttgttcaaaa tcgcaataac 3900 gcggccgcac tcgagcacca ccaccaccac cactga 3936 <210> 2 <211> 1311 <212> PRT <213> Artificial Sequence <400> 2 Met Ser Ile Tyr Gln Glu Phe Val Asn Lys Tyr Ser Leu Ser Lys Thr 1 5 10 15 Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Glu Asn Ile Lys 20 25 30 Ala Arg Gly Leu Ile Leu Asp Asp Glu Lys Arg Ala Lys Asp Tyr Lys 35 40 45 Lys Ala Lys Gln Ile Ile Asp Lys Tyr His Gln Phe Phe Ile Glu Glu 50 55 60 Ile Leu Ser Ser Val Cys Ile Ser Glu Asp Leu Leu Gln Asn Tyr Ser 65 70 75 80 Asp Val Tyr Phe Lys Leu Lys Lys Ser Asp Asp Asp Asn Leu Gln Lys 85 90 95 Asp Phe Lys Ser Ala Lys Asp Thr Ile Lys Lys Gln Ile Ser Glu Tyr 100 105 110 Ile Lys Asp Ser Glu Lys Phe Lys Asn Leu Phe Asn Gln Asn Leu Ile 115 120 125 Asp Ala Lys Lys Gly Gln Glu Ser Asp Leu Ile Leu Trp Leu Lys Gln 130 135 140 Ser Lys Asp Asn Gly Ile Glu Leu Phe Lys Ala Asn Ser Asp Ile Thr 145 150 155 160 Asp Ile Asp Glu Ala Leu Glu Ile Ile Lys Ser Phe Lys Gly Trp Thr 165 170 175 Thr Tyr Phe Lys Gly Phe His Glu Asn Arg Lys Asn Val Tyr Ser Ser 180 185 190 Asn Asp Ile Pro Thr Ser Ile Ile Tyr Arg Ile Val Asp Asp Asn Leu 195 200 205 Pro Lys Phe Leu Glu Asn Lys Ala Lys Tyr Glu Ser Leu Lys Asp Lys 210 215 220 Ala Pro Glu Ala Ile Asn Tyr Glu Gln Ile Lys Lys Asp Leu Ala Glu 225 230 235 240 Glu Leu Thr Phe Asp Ile Asp Tyr Lys Thr Ser Glu Val Asn Gln Arg 245 250 255 Val Phe Ser Leu Asp Glu Val Phe Glu Ile Ala Asn Phe Asn Asn Tyr 260 265 270 Leu Asn Gln Ser Gly Ile Thr Lys Phe Asn Thr Ile Ile Gly Gly Lys 275 280 285 Phe Val Asn Gly Glu Asn Thr Lys Arg Lys Gly Ile Asn Glu Tyr Ile 290 295 300 Asn Leu Tyr Ser Gln Gln Ile Asn Asp Lys Thr Leu Lys Lys Tyr Lys 305 310 315 320 Met Ser Val Leu Phe Lys Gln Ile Leu Ser Asp Thr Glu Ser Lys Ser 325 330 335 Phe Val Ile Asp Lys Leu Glu Asp Asp Ser Asp Val Val Thr Thr Met 340 345 350 Gln Ser Phe Tyr Glu Gln Ile Ala Ala Phe Lys Thr Val Glu Glu Lys 355 360 365 Ser Ile Lys Glu Thr Leu Ser Leu Leu Phe Asp Asp Leu Lys Ala Gln 370 375 380 Lys Leu Asp Leu Ser Lys Ile Tyr Phe Lys Asn Asp Lys Ser Leu Thr 385 390 395 400 Asp Leu Ser Gln Gln Val Phe Asp Asp Tyr Ser Val Ile Gly Thr Ala 405 410 415 Val Leu Glu Tyr Ile Thr Gln Gln Ile Ala Pro Lys Asn Leu Asp Asn 420 425 430 Pro Ser Lys Lys Glu Gln Glu Leu Ile Ala Lys Lys Thr Glu Lys Ala 435 440 445 Lys Tyr Leu Ser Leu Glu Thr Ile Lys Leu Ala Leu Glu Glu Phe Asn 450 455 460 Lys His Arg Asp Ile Asp Lys Gln Cys Arg Phe Glu Glu Ile Leu Ala 465 470 475 480 Asn Phe Ala Ala Ile Pro Met Ile Phe Asp Glu Ile Ala Gln Asn Lys 485 490 495 Asp Asn Leu Ala Gln Ile Ser Ile Lys Tyr Gln Asn Gln Gly Lys Lys 500 505 510 Asp Leu Leu Gln Ala Ser Ala Glu Asp Asp Val Lys Ala Ile Lys Asp 515 520 525 Leu Leu Asp Gln Thr Asn Asn Leu Leu His Lys Leu Lys Ile Phe His 530 535 540 Ile Ser Gln Ser Glu Asp Lys Ala Asn Ile Leu Asp Lys Asp Glu His 545 550 555 560 Phe Tyr Leu Val Phe Glu Glu Cys Tyr Phe Glu Leu Ala Asn Ile Val 565,570,575 Pro Leu Tyr Asn With Arg Asn Tyr With Thr Gln Lys Pro Tyr Ser 580,585,590 Asp Glu Lys Phe Lys Leu Asn Phe Glu Asn Ser Thr Leu Ala Asn Gly 595,600,605 Trp Asp Lys Asn Lys Glu Pro Asp Asn Thr Ala Ile Leu Phe Ile Lys 610 615 620 Asp Asp Lys Tyr Leu Gly Val Met Lys Lys Asn Asn Lys Ile 625 630 635 640 Phe Asp Asp Lys Ala Ile Lys Glu Asn Gly Glu Gly Tyr Lys Lys 645,650,655 Ile Val Tyr Lys Leu Leu Pro Gly Ala Asn Lys Met Leu Pro Lys Val 660,665,670 Phe Phe Ser Ala Lys Ser Ile Lys Phe Tyr Asn Pro Ser Glu Asp Ile 675,680,685 Leu Arg Ile Arg Asn His Ser Thr His Thr Lys Asn Gly Ser Pro Gln 690,695,700 Lys Gly Tyr Glu Lys Phe Glu Phe Asn Ile Glu Asp Cys Arg Lys Phe 705 710 715 720 Asp Phe Tyr Lys Gln Ser Ile Ser Lys His Pro Glu Trp Lys Asp 725 730 735 Phe Gly Phe Arg Phe Ser Asp Thr Gln Arg Tyr Asn Ser Ile Asp Glu 740,745,750 Phe Tyr Arg Glu Val Glu Asn Gln Gly Tyr Lys Leu Thr Phe Glu Asn 755,760,765 Ser Glu Ser Tyr and Asp Ser Val Val Asn Gln Gly Lys Tyr 770,775,780 Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ser Ala Tyr Ser Lys Gly Arg 785,790,795,800 Pro Asn Leu His Thr Leu Tyr Trp Lys Ala Leu Phe Asp Glu Arg Asn 805 810 815 Gln Asp Val Val Tyr Lys Gln Gl Glu Ala Glu Phe Tyr 820 825 830 Arg Lys Gln Ser Ile Pro Lys Lys Ile Thr His Pro Ala Lys Glu Ala 835 840 845 Ile Ala Asn Lys Asn Lys Asp Asn Pro Lys Lys Glu Ser Val Phe Glu 850 855 860 Tyr Asp Leu Ile Lys Asp Lys Arg Phe Thr Glu Asp Lys Phe Phe 865 870 875 880 His Cys Pro Ile Thr Ile Asn Phe Lys Ser Ser Gly Ala Asn Lys Phe 885 890 895 Asn Asp Glu Ile Asn Leu Leu Leu Lys Glu Lys Ala Asn Asp Val His 900 905 910 Ile Leu Ser Ile Asp Arg Gly Glu Arg His Leu Ala Tyr Tyr Thr Leu 915 920 925 Val Asp Gly Lys Gly Asn Ile Ile Lys Gln Asp Thr Phe Asn Ile Ile 930 935 940 Gly Asn Asp Arg Met Lys Thr Asn Tyr His Asp Lys Leu Ala Ala Ile 945 950 955 960 Glu Lys Asp Arg Asp Ser Ala Arg Lys Asp Trp Lys Lys Ile Asn Asn 965 970 975 Ile Lys Glu Met Lys Glu Gly Tyr Leu Ser Gln Val Val His Glu Ile 980 985 990 Ala Lys Leu Val Ile Glu Tyr Asn Ala Ile Val Val Phe Glu Asp Leu 995 1000 1005 Asn Phe Gly Phe Lys Arg Gly Arg Phe Lys Val Glu Lys Gln Val 1010 1015 1020 Tyr Gln Lys Leu Glu Lys Met Leu Ile Glu Lys Leu Asn Tyr Leu 1025 1030 1035 Val Phe Lys Asp Asn Glu Phe Asp Lys Thr Gly Gly Val Leu Arg 1040 1045 1050 Ala Tyr Gln Leu Thr Ala Pro Phe Glu Thr Phe Lys Lys Met Gly 1055 1060 1065 Lys Gln Thr Gly Ile Ile Tyr Tyr Val Pro Ala Gly Phe Thr Ser 1070 1075 1080 Lys Ile Cys Pro Val Thr Gly Phe Val Asn Gln Leu Tyr Pro Lys 1085 1090 1095 Tyr Glu Ser Val Ser Lys Ser Gln Glu Phe Phe Ser Lys Phe Asp 1100 1105 1110 Lys Ile Cys Tyr Asn Leu Asp Lys Gly Tyr Phe Glu Phe Ser Phe 1115 1120 1125 Asp Tyr Lys Asn Phe Gly Asp Lys Ala Ala Lys Gly Lys Trp Thr 1130 1135 1140 Ile Ala Ser Phe Gly Ser Arg Leu Ile Asn Phe Arg Asn Ser Asp 1145 1150 1155 Lys Asn His Asn Trp Asp Thr Arg Glu Val Tyr Pro Thr Lys Glu 1160 1165 1170 Leu Glu Lys Leu Leu Lys Asp Tyr Ser Ile Glu Tyr Gly His Gly 1175 1180 1185 Glu Cys Ile Lys Ala Ala Ile Cys Gly Glu Ser Asp Lys Lys Phe 1190 1195 1200 Phe Ala Lys Leu Thr Ser Val Leu Asn Thr Ile Leu Gln Met Arg 1205 1210 1215 Asn Ser Lys Thr Gly Thr Glu Leu Asp Tyr Leu Ile Ser Pro Val 1220 1225 1230 Ala Asp Val Asn Gly Asn Phe Phe Asp Ser Arg Gln Ala Pro Lys 1235 1240 1245 Asn Met Pro Gln Asp Ala Asp Ala Asn Gly Ala Tyr His Ile Gly 1250 1255 1260 Leu Lys Gly Leu Met Leu Leu Gly Arg Ile Lys Asn Asn Gln Glu 1265 1270 1275 Gly Lys Lys Leu Asn Leu Val Ile Lys Asn Glu Glu Tyr Phe Glu 1280 1285 1290 Phe Val Gln Asn Arg Asn Asn Ala Ala Ala Leu Glu His His His 1295 1300 1305 His His His 1310 <210> 3 <211> 68 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (39)..(46) <223> n is a, c, g, or t <400> 3 tgctgagtcc gcggccattc atgtcttcag ccctcaacnn nnnnnnaacc cgtgctcatg tccgatcg 68 <210> 4 <211> 22 <212> DNA <213> Individual sequence(Artificial sequence) <400> 4 cgatcggaca tgagcacggg tt <210> 5 <211> 38 <212> DNA <213> Individual sequence(Artificial sequence) <400> 5 gttgagggct gaagacatga attack tgacgact <210> 6 <211> 26 <212> DNA <213> Individual sequence(Artificial sequence) <220> <221> misc_feature <222> (1)..(4) <223> n is a, c, g, or t <400> 6 nnnngttgag ggctgaagac atgaat <210> 7 <211> 16 <212> DNA <213> Individual sequence(Artificial sequence) <400> 7 agtcgtcact tgaata <210> 8 <211> 16 <212> DNA <213> Artificial sequence <400> 8 ggccgcggac tcagca 16 <210> 9 <211> 3633 <212> DNA <213> Artificial sequence <400> 9 atgcgaccct ccgggacggc cggggcagcg ctcctggcgc tgctggctgc gctctgcccg 60 gcgagtcggg ctctggagga aaagaaagtt tgccaaggca cgagtaacaa gctcacgcag 120 ttgggcactt ttgaagatca ttttctcagc ctccagagga tgttcaataa ctgtgaggtg 180 gtccttggga atttggaaat tacctatgtg cagaggaatt atgatctttc cttcttaaag 240 accatccagg aggtggctgg tttgtcctc attgccctca acacagtgga gcgaattcct 300 ttggaaaacc tgcagatcat cagaggaaat atgtactacg aaaattccta tgccttagca 360 gtcttatcta actatgatgc aaataaaacc ggactgaagg agctgcccat gagaaattta 420 caggaaatcc tgcatggcgc cgtgcggttc agcaacaacc ctgccctgtg caacgtggag 480 to catch ggcgggacat to catch gactttctca gcaacatgtc gatggacttc 540 cagaaccacc tgggcagctg ccaaaagtgt gatccaagct gtcccaatgg gagctgctgg ggtgcaggag aggagaactg ccagaaactg accaaaatca tctgtgccca gcagtgctcc gggcgctgcc gtggcaagtc ccccagtgac tgctgccaca accagtgtgc tgcaggctgc 720 acaggccccc gggagagcga ctgcctggtc tgccgcaaat tccgagacga agccacgtgc 780 aaggacacct gccccccact catgctctac aaccccacca cgtaccagat ggatgtgaac cccgagggca fathercagctt tggtgccacc tgcgtgaaga agtgtccccg fathertgtg gtgacagatc acggctcgtg cgtccgagcc tgtggggccg acagctatga gatggagga gacggcgtcc gcaagtgtaa gaagtgcgaa gggccttgcc gcaaagtgtg taacggaata ggtattggtg father ctcactctcc father cgate acacttcaaa aactgcacct ccatcagtgg cgatctccac atcctgccgg tggcatttag gggtgactcc ttcacacata ctcctcctct ggatccacag gaactggata ttctgaaaac cgtaagga atcacagggt ttttgctgat tcaggcttgg cctgaaaaca ggacggacct ccatgccttt 1260. gagaacctag aaatcatacg cggcaggacc aagcaacatg gtcagttttc tcttgcagtc gtcagcctga acataacatc cttgggatta cgctccctca aggagataag tgatggagat gtgataattt cage aaatttgtgc tatgcaata caataactg gaaaaaactg tttgggacct ccggtcagaa aaccaaaatt ataagcaaca gaggtgaaaa cagctgcaag gccacaggcc aggtctgcca tgccttgtgc tcccccgagg gctgctgggg cccggagccc 1560 agggactgcg tctcttgccg gaatgtcagc cgaggcaggg aatgcgtgga caagtgcaac cttctggagg gtgagccaag ggagtttgtg gagaactctg agtgcataca gtgccaccca gagtgcctgc ctcaggccat gaacatcacc tgcacaggac ggggaccaga caactgtatc cagtgtgccc actacattga cggcccccac tgcgtcaaga cctgcccggc aggagtcatg ggagaaaca acaccctggt ctggaagtac gcagacgccg gccatgtgtg ccacctgtgc catccaaact gcacctacgg atgcactggg ccaggtcttg aaggctgtcc aacgaatggg cctaagatcc cgtccatcgc cactgggatg gtgggggccc tcctctgct gctgtggtg 1980 gccctgggga tcggctctt catgcgaagg cgccacatcg ttcggaagcg cacgctgcgg 2040 aggctgctgc aggaggga gcttgtggag cctcttacac ccagtggaga agctcccac 2100 caagctctct tgaggatctt gaaggaact gattcaaa agatcaagt gctgggctcc 2160 ggtgcgttcg gcacggtgta taagggactc tggatcccag aaggtgagaa agttaaaatt 2220 cccgtcgcta tcaggaatt agagaagca acatctccga aagccaaca ggaatccctc 2280 gatgaagcct acgtgatggc cagcgtggac aacccccacg tgtgccgcct gctgggcatc 2340 tgcctcacct cccaccgtgca gctcatcacg cagctcatgc ccttcggctg cctcctggac 2400 tatgtccggg aacacaaaga caatattggc tcccagtacc tgctcaactg gtgtgtgcag 2460 atcgcaaagg gcatgaacta cttgaggac cgtcgcttgg tgcaccgcga cctggcagcc 2520 aggaacgtac tggtgaaaac accgcagcat gtcagatca cagattttgg gctggccaaa 2580 ctgctgggtg cggagagaa agaataccat gcagaaggag gcaagtgcc tatcaagtgg 2640 atggcattgg aatcaatttt acacagaatc tatacccacc agagtgatgt ctggagctac 2700 ggggtgaccg tttgggagtt gatgaccttt ggatccaagc catatgacgg aatccctgcc 2760 agcgagatct cctccatcct ggagaaagga gaacgcctcc ctcagccacc catatgtacc 2820 atcgatgtct acatgatcat ggtcaagtgc tggatgatag acgcagatag tcgcccaaag 2880 ttccgtgagt tgatcatcga attctccaaa atggcccgag acccccagcg ctaccttgtc 2940 attcaggggg atgaaagaat gcatttgcca agtcctacag actccaactt ctaccgtgcc 3000 ctgatggatg aagaagacat ggacgacgtg gtggatgccg acgagtacct catcccacag 3060 cagggcttct tcagcagccc ctccacgtca cggactcccc tcctgagctc tctgagtgca 3120 accagcaaca attccaccgt ggcttgcatt gatagaaatg ggctgcaaag ctgtcccatc 3180 aaggaagaca gcttcttgca gcgatacagc tcagacccca caggcgcctt gactgaggac 3240 agcatagacg acaccttcct cccagtgcct gaatacataa accagtccgt tcccaaaagg 3300 cccgctggct ctgtgcagaa tcctgctat cacaatcagc ctctgaaccc cgcgcccagc 3360 agagacccac actaccagga cccccacagc actgcagtgg gcaaccccga gtatctcaac 3420 actgtccagc ccacctgtgt caacagcaca ttcgacagcc ctgcccactg ggcccagaaa 3480 ggcagccacc aaattagcct ggacaaccct gactaccagc aggacttctt tcccaaggaa 3540 gccaagccaa atggcatctt tagggctcc acagctgaaa atgcagaata cctaagggtc 3600 gcgccacaaa gcagtgaatt tattggagca tga 3633 <210> 10 <211> 3618 <212> DNA <213> Artificial sequence <400> 10 atgcgaccct ccgggacggc cggggcagcg ctcctggcgc tgctggctgc gctctgcccg 60 gcgagtcggg ctctggagga aaagaaagtt tgccaaggca cgagtaacaa gctcacgcag 120 ttgggcactt ttgaagatca ttttctcagc ctccagagga tgttcaataa ctgtgaggtg 180 gtccttggga atttggaaat tacctatgtg cagaggaatt atgatctttc cttcttaaag 240 accatccagg aggtggctgg tttgtcctc attgccctca acacagtgga gcgaattcct 300 ttggaaaacc tgcagatcat cagaggaaat atgtactacg aaaattccta tgccttagca 360 gtcttatcta actatgatgc aaataaaacc ggactgaagg agctgcccat gagaaattta caggaaatcc tgcatggcgc cgtgcggttc agcaacaacc ctgccctgtg caacgtggag to catch ggcgggacat to catch gactttctca gcaacatgtc gatggacttc 540 cagaaccacc tgggcagctg ccaaaagtgt gatccaagct gtcccaatgg gagctgctgg ggtgcaggag aggagaactg ccagaaactg accaaaatca tctgtgccca gcagtgctcc gggcgctgcc gtggcaagtc ccccagtgac tgctgccaca accagtgtgc tgcaggctgc 720 acaggccccc gggagagcga ctgcctggtc tgccgcaaat tccgagacga agccacgtgc 780 aaggacacct gccccccact catgctctac aaccccacca cgtaccagat ggatgtgaac cccgagggca fathercagctt tggtgccacc tgcgtgaaga agtgtccccg fathertgtg gtgacagatc acggctcgtg cgtccgagcc tgtggggccg acagctatga gatggagga gacggcgtcc gcaagtgtaa gaagtgcgaa gggccttgcc gcaaagtgtg taacggaata ggtattggtg father ctcactctcc father cgate acacttcaaa aactgcacct ccatcagtgg cgatctccac atcctgccgg tggcatttag gggtgactcc ttcacacata ctcctcctct ggatccacag gaactggata ttctgaaaac cgtaagga atcacagggt ttttgctgat tcaggcttgg cctgaaaaca ggacggacct ccatgccttt 1260. gagaacctag aaatcatacg cggcaggacc aagcaacatg gtcagttttc tcttgcagtc gtcagcctga acataacatc cttgggatta cgctccctca aggagataag tgatggagat gtgataattt cage aaatttgtgc tatgcaata caataactg gaaaaaactg tttgggacct ccggtcagaa aaccaaaatt ataagcaaca gaggtgaaaa cagctgcaag gccacaggcc aggtctgcca tgccttgtgc tcccccgagg gctgctgggg cccggagccc 1560 agggactgcg tctcttgccg gaatgtcagc cgaggcaggg aatgcgtgga caagtgcaac cttctggagg gtgagccaag ggagtttgtg gagaactctg agtgcataca gtgccaccca gagtgcctgc ctcaggccat gaacatcacc tgcacaggac ggggaccaga caactgtatc cagtgtgccc actacattga cggcccccac tgcgtcaaga cctgcccggc aggagtcatg ggagaaaaca acaccctggt ctggaagtac gcagacgccg gccatgtgtg ccacctgtgc 1860 catccaaact gcacctacgg atgcactggg ccaggtcttg aaggctgtcc aacgaatggg 1920 cctaagatcc cgtccatcgc cactgggatg gtgggggccc tcctcttgct gctggtggtg 1980 gccctgggga tcggcctctt catgcgaagg cgccacatcg ttcggaagcg cacgctgcgg 2040 aggctgctgc aggagaggga gcttgtggag cctcttacac ccagtggaga agctcccaac 2100 caagctctct tgaggatctt gaaggaaact gaattcaaaa agatcaaagt gctgggctcc 2160 ggtgcgttcg gcacggtgta taagggactc tggatcccag aaggtgagaa agttaaaatt 2220 cccgtcgcta tcaagacatc tccgaaagcc aacaaggaaa tcctcgatga agcctacgtg 2280 atggccagcg tggacaaccc ccacgtgtgc cgcctgctgg gcatctgcct cacctccacc 2340 gtgcagctca tcatgcagct catgcccttc ggctgcctcc tggactatgt ccgggaacac 2400 aaagacaata ttggctccca gtacctgctc aactggtgtg tgcagatcgc aaagggcatg 2460 aactacttgg aggaccgtcg cttggtgcac cgcgacctgg cagccaggaa cgtactggtg 2520 aaaacaccgc agcatgtca gatcacagat ttggggcgg gccaactgct gggtgcggaa 2580 gagaaagaat accatgcaga aggaggcaa gtgcctatca agtggatggc attggaatca 2640 attacaca gatctatac ccaccagt gatgtctgga gctacggggt gaccgttttgg 2700 gagttgatga cctttggatc caagccatat gacggaatcc ctgccagcga gatctcctcc 2760 atcctggaga aaggaacg cctccctcag ccaccatat gtaccatcga tgtctacatg 2820 atcatggtca agtgctggat gatagacgca gatagtcgcc caaagttccg tgagttgatc 2880 atcgaatttct ccaaaatgc ccgagacccc cagcgctacc ttgtcattca gggggatgaa 2940 agaatgcatt tgccaagtcc tacagactcc aacttctacc gtgccctgat ggatgaagaa 3000 gataggacg acgtggtgga tgccgacgag tacctcatcc cacagcagggg cttcttcagc 3060 agcccctcca cgtcacggac tcccctcctg agctctctga gtgcaccag caacattcc 3120 accgtggctt gcattgatag aaatgggctg caaagctgtc ccatcagga agacagcttc 3180 ttgcagcgat acagctcaga cccacaggc gccttgactg aggacagcat agacgacacc 3240 ttcctcccag tgcctgaata cataaaccag tccgttccca aaaggcccgc tggctctgtg 3300 cagaatcctg tctatcacaa tcagcctctg aaccccgcgc ccagcagaga cccacactac 3360 caggaccccc acagcactgc agtgggcaac cccgagtatc tcaacactgt ccagcccacc 3420 tgtgtcaaca gcacattcga cagccctgcc cactgggccc agaaaggcag ccaccaaatt 3480 agcctggaca accctgacta ccagcaggac ttctttccca aggaagccaa gccaaatggc 3540 atctttaagg gctccacagc tgaaaatgca gaatacctaa gggtcgcgcc acaaagcagt 3600 gaatttattg gagcatga 3618 <210> 11 <211> 3822 <212> DNA <213> Artificial sequence <400> 11 atgttcgttt tcctggttct gctgccgctg gttagcagcc aatgcgtgaa tctgaccacc 60 cgcacccaac tgccgccggc gtacaccaac agcttcaccc gtggtgttta ctatccggac 120 aaagtttttc gtagcagcgt gctgcacagc acccaggacc tgttcctgcc gttctttagc 180 aacgttacct ggttccacgc gatccacgtg agcggcacca acggcaccaa gcgtttcgac 240 aacccggtgc tgccgtttaa cgatggtgtt tacttcgcga gcaccgagaa gagcaacatc 300 attcgtggtt ggatttttgg caccaccctg gacagcaaaa cccagagcct gctgatcgtt 360 aacaacgcga ccaacgtggt tattaaggtg tgcgagttcc aattttgcaa cgatccgttc 420 ctgggcgttt actatcacaa gaacaacaaa agctggatgg agagcgaatt tcgtgtttat 480 agcagcgcga acaactgcac ctttgagtac gtgagccagc cgttcctgat ggacctggaa 540 ggcaagcaag gcaacttcaa aaacctgcgt gagttcgtgt tcaagaacat tgatggttac 600 ttcaaaatct acagcaagca caccccgatc aacctggttc gtgacctgcc gcagggtttt 660 agcgcgctgg agccgctggt tgacctgccg atcggtatta acatcacccg ttttcaaacc 720 ctgctggcgc tgcaccgtag ctacctgacg ccgggtgaca gcagcagcgg ttggaccgct 780 ggtgctgcgg cgtactatgt tggttacctg caaccgcgta ccttcctgct gaaatacaac 840 gaaaacggca ccatcaccga tgcggttgat tgcgcgctgg acccgctgag cgaaaccaag 900 tgcaccctga agagcttcac cgtggagaag ggtatttatc agaccagcaa cttccgtgtg 960 caaccgaccg aaagcattgt tcgttttccg aacatcacca acctgtgccc gtttggcgag 1020 gttttcaacg cgacccgttt cgcgagcgtg tatgcgtgga accgtaaacg tatcagcaac 1080 tgcgttgcgg actatagcgt gctgtacaac agcgcgagct tcagcacctt taagtgctat 1140 ggtgtgagcc cgaccaaact gaacgatctg tgctttacca acgtttacgc ggatagcttc 1200 gtgattcgtg gcgacgaggt tcgtcagatc gcgccgggtc aaaccggcaa gattgcggac 1260 tacaactata aactgccgga cgatttcacc ggctgcgtta tcgcgtggaa cagcaacaac 1320 1380 ctgaaaccgt tcgagcgtga cattagcacc gaaatctacc aggcgggtag caccccgtgc 1440 aacggtgttg agggctttaa ctgctatttc ccgctgcaaa gctacggttt ccaaccgacc 1500 aacggtgttg gttaccagcc gtaccgtgtg gttgtgctga gctttgaact gctgcacgcg 1560 ccggcgaccg tgtgcggccc gaagaagc accaacctgg tgaagaacaa atgcgtgaac 1620 ttcaacttta acggcctgac cggcaccggc gtgctgaccg agagcaacaa gaaattcctg 1680 ccgtttcagc aattcggtcg tgacatcgcg gataccaccg atgcggtgcg tgacccgcag 1740. accctggaga tcctggacat caccccgtgc agcttcggtg gcgttagcgt gatcacgccg ggcaccaaca ccagcaacca ggttgcggtg ctgtatcaag acgttaactg caccgaagtt ccggtggcga ttcacgcgga tcagctgacc ccgacctggc gtgtgtacag caccggcagc aacgttttcc aaacccgtgc gggttgcctg attggtgcgg agcacgtgaa caacagctat gaatgcgaca ttccgatcgg tgcgggcatt tgcgcgagct accagaccca aaccaacagc ccgcgtcgtg cgcgtagcgt tgcgagccag agcatcattg cgtatacgat gagcctgggt gcggaaaca gcgtggcgta cagcaacac agcattgcga tcccgacca cttcaccatt agcgtgacca ccgagatcct gccggttagc atgaccaaaa ccagcgtgga ctgcaccatg fatherctgcg gcgatagcc cgaatgcgc aacctgctgc tgcaatacgg tagcttttgc acccaactga accgtgcgct gaccggcatt gcggttgagc aggataaaa caccaaga gttttcgcgc aggtgagca aatttacaaa accccgccga tcaaggactt tggtggcttc aactttagcc agatcctgcc ggacccgagc aagccgagca aacgtagctt tattgaggac 2460 ctgctgttca acaaggttac cctggcggat gcgggtttca tcaaacagta tggtgattgc 2520 ctgggcgaca ttgcggcgcg tgacctgatc tgcgcgcaaa agtttaacgg cctgaccgtg 2580 ctgccgccgc tgctgaccga tgaaatgatt gcgcagtaca ccagcgcgct gctggcgggc 2640 accattacca gcggttggac ctttggtgcg ggtgcggcgc tgcaaatccc gtttgcgatg 2700 caaatggcgt atcgtttcaa cggtattggc gttacccaga acgtgctgta cgagaaccag 2760 aagctgatcg cgaaccaatt taacagcgcg attggtaaaa tccaggatag cctgagcagc 2820 accgcgagcg cgctgggcaa actgcaagat gttgtgaacc agaacgcgca agcgctgaac 2880 accctggtta agcagctgag cagcaacttc ggtgcgatta gcagcgtgct gaacgacatc 2940 ctgagccgtc tggacaaagt tgaggcggaa gtgcaaattg accgtctgat caccggccgt 3000 ctgcaaagcc tgcaaaccta tgtgacccag caactgattc gtgcggcgga aattcgtgcg 3060 agcgcgaacc tggcggcgac caagatgagc gagtgcgttc tgggtcagag caagcgtgtg 3120 gacttttgcg gtaaaggcta tcacctgatg agcttcccgc agagcgcgcc gcacggcgtt 3180 gtgtttctgc acgttaccta cgtgccggcg caagaaaaga actttaccac cgcgccggcg 3240 atctgccatg atggtaaagc gcactttccg cgtgaaggtg ttttcgtgag caacggcacc 3300 cactggtttg ttacccagcg taactttac gagccgcaaa tcattaccac cgacaacacc 3360 ttcgtgagcg gtaactgcga tgttgtgatt ggcatcgtta aaacaccgt gtatgacccg 3420 3480 agcccggacg ttgatctggg tgacattagc ggcatcaacg cgagcgttgt gaacattcaa 3540 aaggagatcg accgtctgaa cgaagtggcg aaaaacctga acgaaagcct gatcgacctg 3600 caagagctgg ccaagtatga acaatacatt aaatggccgt ggtacatttg gctgggtttc 3660 atcgcgggcc tgattgcgat cgttatggtg accatcatgc tgtgctgcat gaccagctgt 3720 tgcagctgcc tgaagggttg ttgcagctgc ggcagctgct gcaagtttga tgaggacgat 3780 agcgagccgg ttctgaaagg cgtgaagctg cattacacct aa 3822 <210> 12 <211> 3822 <212> DNA <213> Artificial sequence <400> 12 atgttcgttt tcctggttct gctgccgctg gttagcagcc aatgcgtgaa tctgaccacc 60 cgcacccaac tgccgccggc gtacaccaac agcttcaccc gtggtgttta ctatccggac 120 aaagttttc gtagcagcgt gctgcacagc acccaggacc tgttcctgcc gttctttagc 180 aacgttacct ggttccacgc gatccacgtg agcggcacca acggcaccaa gcgtttcgac 240 aacccggtgc tgccgtttaa cgatggtgtt tacttcgcga gcaccgagaa gagcaacatc 300 attcgtggtt ggatttttgg caccaccctg gacagcaaaa cccagagcct gctgatcgtt 360 aacaacgcga ccaacgtggt tattaaggtg tgcgagttcc aattttgcaa cgatccgttc 420 ctgggcgttt actatcacaa gaacaacaaa agctggatgg agagcgaatt tcgtgttat 480 agcagcgcga acaactgcac ctttgagtac gtgagccagc cgttcctgat ggacctggaa 540 ggcaagcaag gcaacttcaa aaacctgcgt gagttcgtgt tcaagaacat tgatggttac 600 ttcaaaatct acagcaagca caccccgatc aacctggttc gtgacctgcc gcagggtttt 660 agcgcgctgg agccgctggt tgacctgccg atcggtatta acatcacccg ttttcaaacc 720 ctgctggcgc tgcaccgtag ctacctgacg ccgggtgaca gcagcagcgg ttggaccgct 780 ggtgctgcgg cgtactatgt tggttacctg caaccgcgta ccttcctgct gaaatacaac 840 gaaaacggca ccatcaccga tgcggttgat tgcgcgctgg acccgctgag cgaaaccaag 900 tgcaccctga agagcttcac cgtggagaag ggtatttatc agaccagcaa cttccgtgtg 960 caaccgaccg aaagcattgt tcgttttccg aacatcacca acctgtgccc gtttggcgag 1020 gttttcaacg cgacccgttt cgcgagcgtg tatgcgtgga accgtaaacg tatcagcaac 1080 tgcgttgcgg actatagcgt gctgtacaac agcgcgagct tcagcacctt taagtgctat 1140 ggtgtgagcc cgaccaaact gaacgatctg tgctttacca acgtttacgc ggatagcttc 1200 gtgattcgtg gcgacgaggt tcgtcagatc gcgccgggtc aaaccggcaa gattgcggac 1260 tacaactata aactgccgga cgatttcacc ggctgcgtta tcgcgtggaa cagcaacaac 1320 ctggatagca aagtgggtgg caactacaac tatctgtacc gtctgtttcg taagagcaac 1380 ctgaaaccgt tcgagcgtga cattagcacc gaaatctacc aggcgggtag caccccgtgc 1440 aacggtgttg agggctttaa ctgctatttc ccgctgcaaa gctacggttt ccaaccgacc 1500 tacggtgttg gttaccagcc gtaccgtgtg gttgtgctga gctttgaact gctgcacgcg 1560 ccggcgaccg tgtgcggccc gaagaagc accaacctgg tgaagaacaa atgcgtgaac 1620 ttcaacttta acggcctgac cggcaccggc gtgctgaccg agagcaacaa gaaattcctg 1680 ccgtttcagc aattcggtcg tgacatcgcg gataccaccg atgcggtgcg tgacccgcag 1740 accctggaga tcctggacat caccccgtgc agcttcggtg gcgttagcgt gatcacgccg 1800 ggcaccaaca ccagcaacca ggttgcggtg ctgtatcaag gcgttaactg caccgaagtt 1860 ccggtggcga ttcacgcgga tcagctgacc ccgacctggc gtgtgtacag caccggcagc 1920 aacgttttcc aaacccgtgc gggttgcctg attggtgcgg agcacgtgaa caacagctat 1980 gaatgcgaca ttccgatcgg tgcgggcatt tgcgcgagct accagaccca aaccaacagc 2040 ccgcgtcgtg cgcgtagcgt tgcgagccag agcatcattg cgtatacgat gagcctgggt 2100 gcggaaaca gcgtggcgta cagcaacac agcattgcga tcccgacca cttcaccatt agcgtgacca ccgagatcct gccggttagc atgaccaaaa ccagcgtgga ctgcaccatg fatherctgcg gcgatagcc cgaatgcgc aacctgctgc tgcaatacgg tagcttttgc acccaactga accgtgcgct gaccggcatt gcggttgagc aggataaaa caccaaga gttttcgcgc aggtgagca aatttacaaa accccgccga tcaaggactt tggtggcttc aactttagcc agatcctgcc ggacccgagc aagccgagca aacgtagctt tattgaggac ctgctgttca acaaggttac cctggcggat gcggggtttca tcaaacagta tggtgattgc ctgggcgaca ttgcggcgcg tgacctgatc tgcgcgcaaa agtttaacgg cctgaccgtg 2580. ctgccgccgc tgctgaccga tgaaatgatt gcgcagtaca ccagcgcgct gctggcgggc 2640. accattacca gcggttggac ctttggtgcg ggtgcggcgc tgcaaatccc gtttgcgatg caaatggcgt atcgtttcaa cggtattggc gttacccaga acgtgctgta cgagaaccag aagctgatcg cgaaccaatt taacagcgcg attggtaaaa tccaggatag cctgagcagc accgcgagcg cgctgggcaa actgcaagat gttgtgaacc agaacgcgca agcgctgaac 2880 accctggtta agcagctgag cagcaacttc ggtgcgatta gcagcgtgct gaacgacatc 2940 ctgagccgtc tggacaaagt tgaggcggaa gtgcaaattg accgtctgat caccggccgt 3000 ctgcaaagcc tgcaaaccta tgtgacccag caactgattc gtgcggcgga aattcgtgcg 3060 agcgcgaacc tggcggcgac caagatgagc gagtgcgttc tgggtcagag caagcgtgtg 3120 gacttttgcg gtaaaggcta tcacctgatg agcttcccgc agagcgcgcc gcacggcgtt 3180 gtgtttctgc acgttaccta cgtgccggcg caagaaaaga actttaccac cgcgccggcg 3240 atctgccatg atggtaaagc gcactttccg cgtgaaggtg ttttcgtgag caacggcacc 3300 cactggtttg ttacccagcg taacttctac gagccgcaaa tcattaccac cgacaacacc 3360 ttcgtgagcg gtaactgcga tgttgtgatt ggcatcgtta acaacaccgt gtatgacccg 3420 ctgcaaccgg agctggacag cttcaaagag gaactggata aatacttcaa gaaccacacc 3480 agcccggacg ttgatctggg tgacattagc ggcatcaacg cgagcgttgt gaacattcaa 3540 aaggagatcg accgtctgaa cgaagtggcg aaaaacctga acgaaagcct gatcgacctg 3600 caagagctgg ccaagtatga acaatacatt aaatggccgt ggtacatttg gctgggtttc 3660 atcgcgggcc tgattgcgat cgttatggtg accatcatgc tgtgctgcat gaccagctgt 3720 tgcagctgcc tgaagggttg ttgcagctgc ggcagctgct gcaagtttga tgaggacgat 3780 agcgagccgg ttctgaaagg cgtgaagctg cattacacct aa 3822
Claims
1. A system comprising: Cas12a, crRNA and TSDR reagent; The spacer sequence of the crRNA can identify the target mutation or the target nucleotide in the DNA to be tested; The TSDR reagent is either TSDR reagent 1 or TSDR reagent 2; TSDR reagent 1 is composed of reagent A, reagent B, reagent C, reagent E, reagent F and reagent G; The reagent A is a single-stranded DNA obtained by sequentially linking A1, A2, A3, and A4, with the structural formula 5′-A1-A2-A3-A4-3′. The length of A1 is 16nt, the length of A2 is 22nt, and A3 is inversely complementary to the sticky end obtained by the Cas12a cleavage of the DNA to be tested under the guidance of the crRNA. The length of A3 is 8nt, and the length of A4 is 22nt. The reagent B is a single-stranded DNA that is reverse complementary to A4; The reagent C is a single-stranded DNA obtained by sequentially linking C1 and C2, with the structural formula 5′-C1-C2-3′. C1 and A2 are inversely complementary, and the length of C2 is 16nt. The reagent E is a single-stranded DNA obtained by sequentially linking E1 and E2, with the structural formula 5′-E1-E2-3′. The four nucleotides at the 5′ end of E1 and A3 are inversely complementary. The sequence of E2 is exactly the same as that of C1. The length of E1 is 4nt and the length of E2 is 22nt. The reagent F is a single-stranded DNA whose sequence is inversely complementary to C2 and whose 3′ end is labeled with a fluorescent quencher or fluorescent group; The reagent G is a single-stranded DNA whose sequence is reverse complementary to A1 and whose 5′ end is labeled with a fluorescent group or a fluorescence quencher group; when the 3′ end of the reagent F is close to the 5′ end of the reagent G, no fluorescence signal is emitted, and when the two are far apart, either the reagent F or the reagent G can generate a fluorescence signal. A1, A2, A3, A4, B, C1, C2, E1, E2, F, and G are not the same as or complementary to each other except for the complementary cases described above, and are also not the same as or complementary to the DNA of the sample to be tested. The TSDR reagent 2 is composed of reagent A′, reagent B′, reagent C′, reagent E′, reagent F′ and reagent G′; The reagent A′ is a single-stranded DNA obtained by sequentially linking A1′, A2′, A3′, and A4′, with the structural formula 3′-A1′-A2′-A3′-A4′-5′. The length of A1′ is 16nt, the length of A2′ is 22nt, and A3′ is inversely complementary to the sticky end obtained by the Cas12a cleavage of the DNA to be tested under the guidance of the crRNA. The length of A3′ is 8nt, and the length of A4′ is 22nt. The reagent B′ is a single-stranded DNA that is reverse complementary to A4′; The reagent C′ is a single-stranded DNA obtained by sequentially linking C1′ and C2′, with the structural formula 3′-C1′-C2′-5′, where C1′ and A2′ are inversely complementary, and the length of C2′ is 16nt. The reagent E′ is a single-stranded DNA obtained by sequentially linking E1′ and E2′, with the structural formula 3′-E1′-E2′-5′. The four nucleotides at the 5′ end of E1′ and A3′ are inversely complementary. The sequences of E2′ and C1′ are completely identical. The length of E1′ is 4nt and the length of E2′ is 22nt. The reagent F′ is a single-stranded DNA whose sequence is inversely complementary to C2′ and whose 5′ end is labeled with a fluorescence quencher or a fluorescent group; The reagent G′ is a single-stranded DNA whose sequence is reverse complementary to A1′ and whose 3′ end is labeled with a fluorescent group or a fluorescence quencher group; when the 5′ end of the reagent F′ is close to the 3′ end of the reagent G′, no fluorescence signal is emitted, and when the two are far apart, the reagent F′ or the reagent G′ can generate a fluorescence signal. A1′, A2′, A3′, A4′, B′, C1′, C2′, E1′, E2′, F′, and G′ are not identical to each other and are not complementary, except for the complementary cases described above. Furthermore, they are all not identical to or complementary to the DNA of the sample to be tested. Among them, A3 and A3′ contain 6 locked nucleic acid modifications. The locked nucleic acid modifications of A3 are located at the 1st, 3rd, 5th, 6th, 7th and 8th nucleotides starting from the 5′ end, and the locked nucleic acid modifications of A3′ are located at the 1st, 3rd, 5th, 6th, 7th and 8th nucleotides starting from the 3′ end.
2. The system according to claim 1, characterized in that: The sequences of A1 and A1′ are both the first 16th positions of sequence 3; And / or, the sequences of A2 and A2′ are both positions 17-38 of sequence 3; And / or, the sequences of A3 and A3′ are both the 39th to 46th positions of sequence 3; And / or, the sequences of A4 and A4′ are both the 47th to 68th positions of sequence 3; And / or, the sequences of reagent B and reagent B′ are both sequence 4; And / or, the sequences of C1 and C1′ are both the first 22nd positions of sequence 5; And / or, the sequences of C2 and C2′ are both positions 23-38 of sequence 5; And / or, the sequences of E2 and E2′ are both the 5th to 26th positions of sequence 6; And / or, the sequences of reagent F and reagent F′ are both sequence 7; And / or, the sequences of reagent G and reagent G′ are both sequence 8.
3. The system according to claim 1 or 2, characterized in that: The spacer sequence of the crRNA is 17 nt in length.
4. The system according to claim 1 or 2, characterized in that: The system also contains RPA amplification primers, which can amplify DNA fragments containing the target mutation or the nucleotide to be tested.
5. A TSDR reagent, characterized in that: The TSDR reagent is TSDR reagent 1 or TSDR reagent 2 in the system described in claim 1 or 2.
6. A method for detecting DNA mutations for non-diagnostic purposes, comprising: 1) The DNA to be digested is digested using the Cas12a and crRNA in any of the systems described in claims 1-3 to obtain the digestion product; The DNA to be digested is either the DNA to be tested or an RPA amplification product containing the PAM sequence required for Cas12a recognition obtained by RPA amplification of the DNA to be tested using the RPA amplification primers in the system of claim 4. 2) Add reagent A, reagent B, reagent C, reagent E, reagent F, and reagent G from the system of claim 1 or 2 to the cleavage product to carry out a TSDR reaction, or add reagent A′, reagent B′, reagent C′, reagent E′, reagent F′, and reagent G′ from the system of claim 1 or 2 to carry out a TSDR reaction to obtain the reaction product; 3) Determine whether the DNA to be tested contains the target mutation according to 31) or 32) below: 31) Detect the fluorescence signal in the reaction product. If there is no fluorescence signal in the reaction product, the DNA to be tested contains or is a candidate to contain the target mutation; if there is a fluorescence signal in the reaction product, the DNA to be tested does not contain or is a candidate to not contain the target mutation. 32) Compare the fluorescence signals in the reaction product and the control reaction product. If the fluorescence signal in the reaction product is lower than that in the control reaction product, the DNA to be tested contains or is a candidate to contain the target mutation; if the fluorescence signal in the reaction product is higher than that in the control reaction product, the DNA to be tested does not contain or is a candidate to not contain the target mutation. The control reaction product is the reaction product obtained by replacing the DNA to be tested in step 1) with DNA that does not contain the target mutation and following steps 1) and 2).
7. The method according to claim 6, characterized in that: The TSDR reaction was carried out at 25-27°C.
8. Any of the following applications: X1) The use of the system according to any one of claims 1-4 in the preparation of products for detecting DNA mutations; X2) The use of the system according to any one of claims 1-4 in the preparation of products for detecting DNA sequences.
9. Any of the following applications: X1) The use of the TSDR reagent according to claim 5 in the preparation of products for detecting DNA mutations; X2) The use of the TSDR reagent of claim 5 in the preparation of DNA sequence detection products.