Thioredoxin 1 epitopes and monoclonal antibodies specifically binding thereto

Abstract

The present application relates to an epitope of a thioredoxin 1 (Trx1) antigen and a use thereof, and more specifically, provides the above-mentioned epitope and an antibody or an antigen-binding fragment binding thereto. The epitope site of the human Trx1 antigen confirmed in the present application can be effectively utilized in the development of an improved antibody for improving the binding affinity of an anti-Trx1 antibody. Also, the improved antibody of the present application has excellent binding affinity to thioredoxin 1, and has very high sensitivity and specificity as compared to the existing anti-Trx1 antibody, and thus is advantageous in improving the performance of a breast cancer diagnostic kit. In addition, the sensitivity and specificity of detecting thioredoxin 1 using the antibody of the present application that specifically binds to thioredoxin 1 are significantly superior to detecting the existing CA15-3 as another breast cancer diagnostic biomarker, and thus can significantly improve the accuracy and reliability of breast cancer diagnosis.

Description

[0001] Cross-reference to related applications

[0002] This application is a divisional application of application number 201880066028.1 (PCT / KR2018 / 012069) filed on October 12, 2018, entitled "Thioredoxin 1 epitope and monoclonal antibody specifically binding thereto".

[0003] This application claims priority and benefit to Korean Patent Application No. 10-2017-0132536, filed on October 12, 2017. The entire contents of this application are incorporated herein by reference. Technical Field

[0004] This invention relates to epitopes of thioredoxin 1 (Trx1) antigen and monoclonal antibodies that specifically bind to them, and more specifically, to the epitopes and monoclonal antibodies or antigen-binding fragments thereof that bind to them, nucleic acid molecules encoding heavy and / or light chains of the antibodies or antigen-binding fragments thereof, recombinant vectors containing the nucleic acid molecules, host cells, methods for preparing the antibodies or antigen-binding fragments thereof, diagnostic kits for breast cancer, and methods for providing information required for breast cancer diagnosis. Background Technology

[0005] Thioredoxins (Trx) are small redox proteins of approximately 12 kDa that undergo NADPH-dependent reduction via thioredoxin reductases. These include mammalian thioredoxin 1 (Trx1) and thioredoxin 2 (Trx2). Thioredoxins function as growth factors, removing hydrogen peroxide, which produces toxins within cells. In bacteria, they act as ribonucleotide reductases, playing a crucial role in binding DNA to essential elements associated with transcription. In eukaryotic cells, they influence the activity of NF-κB (nuclear transcription factor κB), a transcription-related factor. Therefore, thioredoxins play a vital role in regulating cancer cell growth due to their effects on apoptosis and tumorigenesis by cleaving disulfide bonds in oxidized proteins to restore their reduced activity. Thioredoxin 1 and thioredoxin 2 enzymes influence apoptosis by removing nitric oxide from cysteine ​​in mammalian cells and have potential importance in various diseases, including inflammatory diseases, cardiac arrest, and cancer. Furthermore, in immunohistochemical analysis using anti-thioredoxin antibodies, thioredoxin expression was observed in human cancer tissues including the liver, colon, pancreas, and cervix, suggesting the potential involvement of thioredoxin in the tumor induction process.

[0006] Against this backdrop, the inventors, in the process of researching diagnostic markers for breast cancer that can predict the diagnosis or prognosis of breast cancer at an early stage, discovered that thioredoxin 1 is expressed at low levels in normal breast tissue but at very high levels in breast cancer tissue, and confirmed that thioredoxin 1 is very useful as a diagnostic marker for breast cancer (Korean Patent No. 10-1058230).

[0007] To develop in vitro diagnostics (IVD) based on enzyme-linked immunosorbent assay (ELISA) with high accuracy and precision, two antibody pairs with high affinity for other sites of the same antigen protein are required. Simultaneously, a system for producing antibodies with specified affinity at low cost on a per-use basis is also needed. In this invention, two high-performance recombinant monoclonal antibodies were developed to detect thioredoxin-1 (Trx1) present in human serum. These antibodies effectively and specifically bind to thioredoxin-1, thus confirming their potential for screening breast cancer patients. Furthermore, the binding sites of these two antibodies to the human Trx1 antigen were identified, thereby completing this invention. Summary of the Invention

[0008] Technical issues

[0009] The present invention is proposed to solve the problems described above, and provides a monoclonal antibody or antigen-binding fragment thereof that can diagnose breast cancer with high sensitivity and specificity.

[0010] Another object of the present invention is to provide a nucleic acid molecule for encoding the heavy chain and / or light chain of the above-mentioned monoclonal antibody or its antigen-binding fragment.

[0011] Another object of the present invention is to provide a recombinant vector comprising the above-mentioned nucleic acid molecules.

[0012] Another object of the present invention is to provide a host cell comprising the above-described recombinant vector.

[0013] Another object of the present invention is to provide an epitope of human thioredoxin 1 antigen that binds to the above-mentioned monoclonal antibody or its binding fragment, a nucleic acid molecule encoding the above-mentioned nucleic acid molecule, a recombinant vector comprising the above-mentioned nucleic acid molecule, and a host cell comprising the above-mentioned recombinant vector.

[0014] Another object of the present invention is to provide a method for preparing a monoclonal antibody or antigen-binding fragment thereof that specifically binds to thioredoxin 1, including the step of culturing the above-described host cells.

[0015] Another object of the present invention is to provide a breast cancer diagnostic kit comprising the above-described monoclonal antibody or its antigen-binding fragment.

[0016] Another object of the present invention is to provide a method for providing necessary information for the diagnosis of breast cancer using the above-described monoclonal antibody or its antigen-binding fragment.

[0017] Problem-solving methods

[0018] To address the problems described above, the present invention provides a monoclonal antibody or antigen-binding fragment thereof that specifically binds to thioredoxin 1, comprising: a light chain variable region comprising a light chain CDR1 formed by an amino acid sequence of sequence 1, a light chain CDR2 formed by an amino acid sequence of sequence 2, and a light chain CDR3 formed by an amino acid sequence of sequence 3; and a heavy chain variable region comprising a heavy chain CDR1 formed by an amino acid sequence of sequence 4, a heavy chain CDR2 formed by an amino acid sequence of sequence 5, and a heavy chain CDR3 formed by an amino acid sequence of sequence 6.

[0019] According to a preferred embodiment of the present invention, the antibody may include a light chain variable region formed by the amino acid sequence of sequence 13 and a heavy chain variable region formed by the amino acid sequence of sequence 14.

[0020] According to another preferred embodiment of the present invention, the antibody may comprise a light chain formed by the amino acid sequence of sequence 17 and a heavy chain formed by the amino acid sequence of sequence 18.

[0021] The present invention also provides a monoclonal antibody or antigen-binding fragment thereof that specifically binds to thioredoxin 1, comprising: a light chain variable region comprising light chain CDR1 formed by the amino acid sequence of sequence 7, light chain CDR2 formed by the amino acid sequence of sequence 8, and light chain CDR3 formed by the amino acid sequence of sequence 9; and a heavy chain variable region comprising heavy chain CDR1 formed by the amino acid sequence of sequence 10, heavy chain CDR2 formed by the amino acid sequence of sequence 11, and heavy chain CDR3 formed by the amino acid sequence of sequence 12.

[0022] According to a preferred embodiment of the present invention, the antibody may comprise a light chain variable region formed by the amino acid sequence of sequence 15 and a heavy chain variable region formed by the amino acid sequence of sequence 16.

[0023] According to another preferred embodiment of the present invention, the antibody may comprise a light chain formed by the amino acid sequence of sequence 19 and a heavy chain formed by the amino acid sequence of sequence 20.

[0024] According to another preferred embodiment of the present invention, the antibody may comprise a light chain formed by the amino acid sequence of sequence 25 and a heavy chain formed by the amino acid sequence of sequence 26.

[0025] According to another preferred embodiment of the present invention, the antibody may comprise an IgG1 heavy chain and a κ light chain.

[0026] According to another preferred embodiment of the present invention, the antigen-binding fragment can be Fab, F(ab'), F(ab')2, Fv or a single-chain antibody molecule.

[0027] According to another preferred embodiment of the present invention, the antibody may be a chimeric antibody, a humanized antibody, or a human antibody.

[0028] The present invention also provides nucleic acid molecules for encoding heavy and / or light chains of the antibodies described above or their antigen-binding fragments.

[0029] According to a preferred embodiment of the present invention, the nucleic acid molecule encoding the light chain described above may be formed from the nucleotide sequence of sequence 21, the nucleotide sequence of sequence 23, or the nucleotide sequence of sequence 37.

[0030] According to a preferred embodiment of the present invention, the nucleic acid molecule encoding the above-mentioned heavy chain may be formed from the nucleotide sequence of sequence 22, the nucleotide sequence of sequence 24, or the nucleotide sequence of sequence 28.

[0031] The present invention also provides a recombinant vector comprising a nucleic acid molecule for encoding the above-mentioned heavy chain, a nucleic acid molecule for encoding the above-mentioned light chain, or a nucleic acid molecule for encoding the above-mentioned heavy chain and light chain, and a host cell comprising the thereof.

[0032] The present invention also provides an epitope of human thioredoxin 1 antigen formed by an amino acid sequence selected from the group consisting of sequences 32 to 34 and sequences 172 to 176, and a nucleic acid molecule encoding the same.

[0033] According to a preferred embodiment of the present invention, the above-mentioned nucleic acid molecule may be formed from a nucleotide sequence selected from the group consisting of sequences 35 to 37 and 177 to 181.

[0034] The present invention also provides a recombinant vector containing the above-mentioned nucleic acid molecules and a host cell containing the same.

[0035] The present invention also provides a method for preparing a monoclonal antibody or an antigen-binding fragment thereof that specifically binds to thioredoxin 1, the method comprising the step of culturing a host cell comprising a nucleic acid molecule containing a heavy chain for encoding the antibody, a nucleic acid molecule for encoding a light chain, or a nucleic acid molecule for encoding both the heavy and light chains.

[0036] The present invention also provides a breast cancer diagnostic kit comprising the above-described antibody or its antigen-binding fragment.

[0037] According to a preferred embodiment of the present invention, the above kit can be an enzyme-linked immunosorbent assay (ELISA) kit.

[0038] According to another preferred embodiment of the present invention, the above-mentioned enzyme-linked immunosorbent assay (ELISA) can be one or more selected from the group consisting of direct ELISA, indirect ELISA, direct sandwich ELISA, and indirect sandwich ELISA.

[0039] The present invention provides a method for providing information for the diagnosis of breast cancer, the method comprising: step (a) contacting the monoclonal antibody or its antigen-binding fragment with a biological sample isolated from an individual suspected of having breast cancer; step (b) detecting the protein expression level of thioredoxin 1 bound to the monoclonal antibody or its antigen-binding fragment in the biological sample by forming an antigen-antibody complex; and step (c) comparing the protein expression level of thioredoxin 1 detected in step (b) with a control group, wherein if the protein expression level is higher than that of the control group, the patient is identified as having breast cancer.

[0040] Furthermore, the present invention provides a method for providing information required for the diagnosis of breast cancer, the method comprising: step (a) coating a solid support with a monoclonal antibody or antigen-binding fragment thereof comprising the light chain CDR1 to CDR3 and heavy chain CDR1 to CDR3 of antibody B266 or B266-1, a monoclonal antibody or antigen-binding fragment thereof comprising the light chain variable region and heavy chain variable region of antibody B266 or B266-1, or antibody B266 or B266-1 or antigen-binding fragment thereof; step (b) applying a biological sample isolated from an individual suspected of having breast cancer to the coated solid support; step (c) removing unbound sample; step (d) ... The method involves using monoclonal antibodies containing the light chain CDR1 to CDR3 and heavy chain CDR1 to CDR3 of antibody B264, or monoclonal antibodies containing the light chain variable region and heavy chain variable region of antibody B264, or antibody B264 or its antigen-binding fragment, on a solid support; step (e) removing unbound monoclonal antibodies or their antigen-binding fragments; step (f) detecting the expression level of thioredoxin 1 protein; and step (g) comparing the expression level of thioredoxin 1 protein detected in step (f) with that of a control group. If the expression level of the protein is higher than that of the control group, the patient is identified as a breast cancer patient.

[0041] According to a preferred embodiment of the present invention, the expression level of the above-mentioned thioredoxin 1 protein can be detected by one or more of the following methods: Western blotting, enzyme-linked immunosorbent assay (ELISA), sandwich ELISA, radioimmunoassay, radioimmunodiffusion, agar two-way immunodiffusion, immunoprecipitation, complement fixation, immunochromatography, fluorescence activated cell sorting (FACS), and protein chip methods.

[0042] According to another preferred embodiment of the present invention, the isolated biological sample may be one or more selected from the group consisting of whole blood, serum, plasma, breast tissue, and breast cells.

[0043] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used in this invention is well-known and commonly used in the art.

[0044] The definitions of the main terms used in this article are as follows.

[0045] The term "antigen" refers to a molecule or part of a molecule that can be used in animals to produce antibodies that can bind to the epitopes of the antigen. An antigen may have more than one epitope.

[0046] The term "antibody" or "Ab" refers to an immunoglobulin molecule located in the variable region of an immunoglobulin molecule that recognizes and binds to specific targets or antigens such as carbohydrates, polynucleotides, lipids, and peptides through one or more antigen recognition sites. As described herein, the term "antibody" includes, but is not limited to, monoclonal antibodies; polyclonal antibodies; "antigen-binding fragments" of antibodies such as Fab, Fab', F(ab')2, Fd, Fv, and Fc that have the ability to specifically bind to a particular antigen (e.g., Trx1); single complementarity-determining regions (CDRs); bispecific antibodies; heterozygous conjugate antibodies and their mutants; fusion proteins containing antibodies or their antigen-binding fragments (e.g., domain antibodies); single-chain (ScFv) and single-domain antibodies [e.g., shark and camel antibodies]; macrobody, minibody, intrabody, diabody, and triabody. Antibodies can be of any type, including tetrabody, v-NAR, and bis-scFv; humanized antibodies; chimeric antibodies; and any other variant spatial conformation of immunoglobulin molecules containing the desired specific antigen recognition site (including glycosylated variants, amino acid sequence variants, and covalently modified antibodies). Antibodies can be derived from murine, rat, human, or any other antibody (including chimeric or humanized antibodies).

[0047] In the relevant technical fields, the term "specific binding" to a specific target or antigen (e.g., the Trx1 protein) is widely understood, and the methods for determining this specific binding are also well-known in the relevant technical fields. "Specific binding" refers to a specific molecule reacting or binding to a particular cell or substance more frequently, more rapidly, with greater persistence, and / or greater affinity, compared to a specific molecule reacting or binding to other cells or substances. Similarly, "specific binding" to a specific target or antigen refers to a specific antibody binding with greater affinity, binding activity, more rapidly, and / or with greater persistence, compared to a specific antibody reacting or binding to other substances.

[0048] The terms "binding affinity" or "K" used in this article are... D "K" refers to the equilibrium dissociation constant of a specific antigen-antibody interaction. D The dissociation velocity (also known as the "detachment velocity" or "k-dissociation velocity") d ") and the combination speed, or "start-up speed" or "k a The ratio of "(Association rate constant)" to "(Association rate constant)". Therefore, K D For kd / k a K is expressed as molar concentration (M). D The smaller the value, the stronger the binding affinity. Therefore, 1 μM K D K compared to 1nM D It exhibits weak binding affinity. K, associated with antibodies. D The value can be determined using well-known methods in the relevant technical field. The K value used to determine the antibody... D One method is to use, such as Typical biosensor systems, such as those using surface plasmon resonance (SPR) methods, are employed.

[0049] The term "vector" refers to a nucleic acid molecule capable of transporting linked other nucleic acids. One form of vector is the "plasmid," which is a circular double-stranded DNA loop that can bind an additional DNA fragment. Other forms of vectors include viral vectors, in which the additional DNA fragment binds to a viral genome. Some vectors can replicate autonomously in the host cells to which they are transduced (e.g., bacterial vectors with bacterial origin and cell-free mammalian vectors). When other vectors (e.g., non-cell-free mammalian vectors) are transduced into host cells, they can merge with the host cell's genome, thereby replicating the host genome. Furthermore, some vectors can instruct the expression of their operatively linked genes. The aforementioned vectors are referred to in this specification as "recombinant expression vectors" (or simply "expression vectors"). Typically, expression vectors useful in recombinant DNA technology are often in the form of plasmids. In this specification, "plasmid" and "vector" are used interchangeably as plasmids are the most commonly used form of vector. However, the present invention includes other forms of expression vectors with equivalent functions, such as viral vectors (e.g., replication-deficient retroviruses, adenoviruses, and adeno-associated viruses).

[0050] The term "host cell" refers to a cell capable of expressing, or capable of expressing, a selected gene of interest after transformation from a nucleic acid sequence. As long as the selected gene is present, the term includes offspring of the mother cell, regardless of whether they are morphologically or genetically identical to their parents.

[0051] The effects of the invention

[0052] The monoclonal antibody of this invention binds effectively and specifically to thioredoxin 1 due to its excellent binding affinity, and can be usefully used in the screening of breast cancer patients due to its very high sensitivity and specificity. Furthermore, compared to detecting CA15-3, which is a conventional biomarker for breast cancer diagnosis, using the monoclonal antibody of this invention that specifically binds to thioredoxin 1 to detect thioredoxin 1 significantly improves the accuracy and reliability of breast cancer diagnosis due to its excellent sensitivity and specificity. The epitope site of the human Trx1 antigen bound by the antibody of this invention is effectively applicable to the development of modified antibodies used to improve the binding affinity of anti-Trx1 antibodies. Attached Figure Description

[0053] Figure 1 The image shows the enzyme digestion diagram of the recombinant vector expressing the thioredoxin 1 antigen and the isotyping results of the antibody obtained from Example 1.

[0054] Figure 2 The light chain (a) and heavy chain (b) amino acid sequences of the 9G7 (AB1) antibody obtained from Example 1 are shown.

[0055] Figure 3 The light chain (a) and heavy chain (b) amino acid sequences of the 2B4 (AB2) antibody obtained from Example 1 are shown.

[0056] Figure 4 The enzyme digestion diagrams of the recombinant vector expressing the light chain (a) and heavy chain (b) of the antibody B264, which exhibits excellent affinity, are shown.

[0057] Figure 5 The enzyme digestion diagrams of the recombinant vector expressing the light chain (a) and heavy chain (b) of the antibody B266, which exhibits excellent affinity, are shown.

[0058] Figure 6 To confirm the reduced (+) and non-reduced (-) states of the antibody obtained using SDS-PAGE, Figure 6 Part (a) shows antibody B264. Figure 6 Part (b) shows antibody B266.

[0059] Figure 7 To confirm the reduced (+) and non-reduced (-) states of antibody B266-1 obtained by SDS-PAGE, the above antibody B266-1 is an antibody in which the Fc portion of antibody B266 is converted into human IgG1.

[0060] Figures 8a to 8d The results of the IMTG GAP arrangement of the light and heavy chains of antibody B266-1 and antibody B264 are shown in sequence.

[0061] Figure 9 The results of the affinity analysis for antibodies B266-1 and B264 are shown. Figure 9 Section (A) shows the response values ​​and corresponding graphs based on antibody concentration. Figure 9 Part (B) presents the results of analyzing the affinity of antibodies using the Prism procedure.

[0062] Figure 10 The results of ROC calculation for sensitivity and specificity are shown for the results obtained by enzyme-linked immunosorbent assay (ELISA) using antibodies B266-1 and B264.

[0063] Figure 11 A comparison of the amino acid sequence similarities between human Trx1 and golden mole Trx1 is shown.

[0064] Figure 12 To confirm the plasmids that cloned CaTrx1 and whether the clones were treated with restriction enzymes (Sfi I and XhoI) using electrophoresis, lane 1 represents the plasmids that cloned CaTrx1 and lane 2 represents the plasmids that were treated with restriction enzymes.

[0065] Figure 13 The expression level of CaTrx1 protein secreted from the cell line is shown by transforming the CaTrx1 plasmid into animal cells and analyzing the results.

[0066] Figure 14 The analysis shows the affinity of antibodies B266-1 and B264 to hTrx1 and CaTrx1.

[0067] Figure 15a A comparison of the amino acid sequences of CaTrx1 and hTrx1 is shown.

[0068] Figure 15b The mutation positions are shown based on the comparison of the amino acid sequences of CaTrx1 and hTrx1.

[0069] Figure 15c The diagram shows a fusion PCR used to prepare the mutant gene of hTrx1, in which DNA fragment amplification and overlap PCR are performed sequentially.

[0070] Figure 15d The amplification results of the DNA fragment used to set the mutation location are shown.

[0071] Figure 15e The results show the preparation of cassettes using the prepared DNA fragments and overlapping PCR.

[0072] Figure 15fThe expression of eight hTrx1 mutant genes was confirmed by transforming plasmids containing cloned hTrx1 mutant genes into 293F cells.

[0073] Figure 16 To confirm the proteins secreted from the culture medium after the genes obtained through the transformation shown in Figure 15 were transduced into HEK293 human cells and cultured, SDS-PAGE technology was used. Trx1 is approximately 12 kDa in size, thus confirming proteins of the corresponding size. This confirmed the expression of the eight transformed genes and their secretion as proteins into the culture medium.

[0074] Figure 17 To purify the above Figure 16 The expression levels of eight hTrx1 mutant proteins were analyzed.

[0075] Figures 18a to 18c Analysis of the binding ability of anti-Trx1 antibodies to the eight hTrx1 mutant proteins of this invention.

[0076] Figure 19 This is a schematic diagram illustrating the general principle of epitope detection using the overlapping peptide scanning method employed in Example 17.

[0077] Figure 20 An image of a microarray cultured using one of the antibody samples from Example 17.

[0078] Figures 21a to 21d To display the degree of reaction with the control group and all probe peptides in the antibody sample, a heatmap is generated, with the y-axis representing the peptide sequences in the library and the x-axis representing the concentration of the applicable antibody sample. MMC2 values ​​are represented by a color code ranging from white (0 or low intensity) through yellow (medium intensity) to red (high intensity).

[0079] Figures 22a to 22f The location of the epitope in the tertiary structure of the hTrx1 protein was confirmed. Detailed Implementation

[0080] The present invention will now be described in more detail.

[0081] As described above, the inventors discovered through previous studies that thioredoxin 1 is expressed at low levels in normal breast tissue but at very high levels in breast cancer tissue, and confirmed that thioredoxin 1 is very useful as a marker for breast cancer diagnosis.

[0082] In response, the inventors have further developed a monoclonal antibody that effectively and specifically binds to thioredoxin 1 for screening breast cancer patients. The monoclonal antibody of this invention binds effectively and specifically to thioredoxin 1 due to its excellent binding affinity, and its high sensitivity and specificity make it useful for screening breast cancer patients. Furthermore, compared to detecting CA15-3, another conventional biomarker for breast cancer diagnosis, using the monoclonal antibody of this invention that specifically binds to thioredoxin 1 significantly improves the accuracy and reliability of breast cancer diagnosis due to its excellent sensitivity and specificity. Moreover, the epitope site of the human Trx1 antigen bound by the above-mentioned antibody is effectively applicable to the development of modified antibodies to improve the binding affinity of anti-Trx1 antibodies.

[0083] This invention provides a monoclonal antibody or its antigen-binding fragment that specifically binds to human thioredoxin-1 (Trx1).

[0084] The monoclonal antibodies of the present invention can be prepared using a variety of techniques known in the art, such as hybridoma, recombinant, and phage display technologies or combinations thereof. For example, monoclonal antibodies can be prepared using hybridoma techniques known in the art. In this document, the term "monoclonal antibody" is not limited to antibodies produced by hybridoma technology. The term "monoclonal antibody" refers to monoclonal antibodies derived from any eukaryotic, prokaryotic, or phage clone, and not to the method of their production.

[0085] Methods for producing and screening specific antibodies using hybridoma technology are conventional and well-known in the art. As a non-limiting example, mice can be immunized using a target antigen or cells expressing that antigen. If an immune response is detected, for example, by detecting antibodies specific to the antigen in mouse serum, the mouse spleen is recovered to isolate spleen cells. The spleen cells are then fused with any suitable myeloma cells, such as P3U1, P3X63-Ag8, 3X63-Ag8-U1, P3NS1-Ag4, SP2 / O-Ag14, or P3X63-Ag8-653, using known techniques. Hybridomas are screened and cloned using limiting dilutions. The hybridoma clones are then evaluated for whether they secrete antibodies that can bind to the antigen using methods known in the art. Typically, ascites containing high levels of antibodies can be prepared by inoculating a positive hybridoma clone into the peritoneal cavity of a mouse. In a preferred embodiment of the invention, the cells containing... Figure 1The recombinant vector of the restriction enzyme diagram in part (a) was transfected into E. coli to prepare the Trx1 antigen. Subsequently, the spleens of mice immunized with the antigen were isolated and the cells producing antibodies that react with Trx1 by fusing with myeloma cells (sp2 / 0) were confirmed by enzyme-linked immunosorbent assay.

[0086] The monoclonal antibody or its antigen-binding fragment in a preferred embodiment of the present invention may comprise (a) or (b) below, which may be referred to herein as B264 and B266-1, respectively:

[0087] (a) A light chain variable region comprising a light chain CDR1 formed by the amino acid sequence of sequence 1, a light chain CDR2 formed by the amino acid sequence of sequence 2, and a light chain CDR3 formed by the amino acid sequence of sequence 3, and a heavy chain variable region comprising a heavy chain CDR1 formed by the amino acid sequence of sequence 4, a heavy chain CDR2 formed by the amino acid sequence of sequence 5, and a heavy chain CDR3 formed by the amino acid sequence of sequence 6; or

[0088] (b) A light chain variable region comprising light chain CDR1 formed by the amino acid sequence of sequence 7, light chain CDR2 formed by the amino acid sequence of sequence 8, and light chain CDR3 formed by the amino acid sequence of sequence 9, and a heavy chain variable region comprising heavy chain CDR1 formed by the amino acid sequence of sequence 10, heavy chain CDR2 formed by the amino acid sequence of sequence 11, and heavy chain CDR3 formed by the amino acid sequence of sequence 12.

[0089] In this specification, the term "CDR (complementarity determining region)" refers to the amino acid sequence of the hypervariable region of the immunoglobulin heavy and light chains. The heavy chain (CDRH1, CDRH2, and CDRH3) and the light chain (CDRL1, CDRL2, and CDRL3) each contain three CDRs, which provide the major contact residues in antibody-antigen or epitope binding.

[0090] The preferred monoclonal antibody or its antigen-binding fragment of the present invention may comprise (c) or (d) below, which may be referred to herein as B264, B266, or B266-1, respectively:

[0091] (c) The light chain variable region formed by the amino acid sequence of sequence 13 and the heavy chain variable region formed by the amino acid sequence of sequence 14; or

[0092] (d) The light chain variable region formed by the amino acid sequence of sequence 15 and the heavy chain variable region formed by the amino acid sequence of sequence 16.

[0093] The preferred monoclonal antibody or its antigen-binding fragment of the present invention may comprise (e), (f), or (g) below, and may be referred to herein as B264, B266, or B266-1, respectively:

[0094] (e) Light chains formed by the amino acid sequence of sequence 17 and heavy chains formed by the amino acid sequence of sequence 18;

[0095] (f) The light chain formed by the amino acid sequence of sequence 19 and the heavy chain formed by the amino acid sequence of sequence 20; or

[0096] (g) Light chains formed by the amino acid sequence of sequence 25 and heavy chains formed by the amino acid sequence of sequence 26.

[0097] The preferred monoclonal antibodies of this invention are designated as B264, B265, B266, B267, B268, or B269, and more preferably, as B264 or B266-1. B266-1 is a monoclonal antibody in which the Fc portion of B266 is modified to human IgG1.

[0098] Spontaneous antibody structural units typically consist of tetramers. These tetramers are usually composed of a pair of two identical polypeptide chains, each pair having a full-length light chain (typically with a molecular weight of about 15 kDa) and a full-length heavy chain (typically with a molecular weight of about 50 kDa to 70 kDa). The amino-terminal sites of both the light and heavy chains typically contain a variable region of about 100 to about 110 or more amino acids involved in antigen recognition. The carboxyl-terminal sites of each chain typically define a constant region involved in effector function. Human light chains are typically classified as κ light chains and λ light chains. Heavy chains are typically classified as μ, δ, γ, α, or υ, with antibody isotypes defined as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has several subclasses including IgG1, IgG2, IgG3, and IgG4, but is not limited to these. IgM has subclasses including IgM1 and IgM2, but is not limited to these. Similarly, IgA is subdivided into IgA1 and IgA2, but is not limited thereto. Within the full-length light and heavy chains, variable and invariant regions are typically linked by a "J" region of about 12 or more amino acids, and the heavy chain contains a "D" region of about 10 or more amino acids. The variable regions of each light / heavy chain pair typically form antigen-binding sites. According to a preferred embodiment of the invention, the heavy chain of the monoclonal antibody of the present invention may be an isotype of IgG1, IgG2a, IgG2b, IgG3, IgA, or IgM, and the light chain may be a κ chain and a λ chain, preferably a κ light chain and an IgG1 heavy chain.

[0099] In the monoclonal antibody or its antigen-binding fragment of the present invention, "its antigen-binding fragment" refers to a fragment with antigen-binding function, including Fab, F(ab'), F(ab')2, and Fv or single-chain antibody molecules, etc. In the antibody-binding fragment, Fab has a structure consisting of the variable regions of the light and heavy chains, the invariant region of the light chain, and the first invariant region (CH1) of the heavy chain, possessing one antigen-binding site. The difference between F(ab') and Fab is that F(ab') contains a hinge region with one or more cysteine ​​residues at the C-terminus of the CH1 domain of the heavy chain. F(ab')2 is generated during the formation of disulfide bonds from the cysteine ​​residues in the hinge region of Fab'. Fv refers to the smallest antibody fragment possessing only the variable regions of the heavy and light chains. Such antibody fragments can be obtained using proteases; for example, Fab can be obtained by cleaving the entire antibody with papain, and F(ab')2 can be obtained by cleaving it with pepsin. Preferably, it can be produced using recombinant gene technology.

[0100] The preferred antibody of the present invention may be a chimeric antibody, a humanized antibody, or a fully human antibody.

[0101] Chimeric antibodies can be prepared by combining variable light and heavy chain regions (VL and VH) obtained from one type of antibody-generating cell with invariant light and heavy chain regions obtained from another type using recombinant methods. Typically, chimeric antibodies utilize rodent or rabbit variable regions and human invariant regions primarily to generate antibodies with human domains. Such chimeric antibody generation is well-known in the art and can be achieved using standard methods. It is also conceivable that the human invariant regions of the chimeric antibodies of the present invention can be selected from the invariant regions of IgG1, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgG10, IgG11, IgG12, IgG13, IgG14, IgG15, IgG16, IgG17, IgG18, or IgG19.

[0102] To enable humanized antibodies to contain immunoglobulin domains more closely resembling those of human antibodies, engineering processes are employed to include only the complementarity-determining regions of animal-derived antibodies. This is achieved by further examining the transvariable loop sequence of the variable region of the monoclonal antibody and adapting this sequence to the structure of the human antibody chain.

[0103] Human antibodies are antibody molecules derived from the human genome that contain the entire sequence of both the CDR and the light and heavy chains.

[0104] Furthermore, the present invention provides nucleic acid molecules for encoding the heavy and / or light chains of the monoclonal antibody or its antigen-binding fragment of the present invention.

[0105] The term "nucleic acid molecule" as used in this invention encompasses both DNA (gDNA and cDNA) and RNA molecules. Nucleotides, the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogues with modified sugar or base sites. The sequences of the nucleic acid molecules of this invention encoding the variable regions of the heavy and light chains are variable. These variations include the addition, deletion, or non-conservative or conserved substitutions of nucleotides.

[0106] The nucleic acid molecule of the present invention is interpreted as further comprising a nucleotide sequence that produces substantial identity with the above-described nucleotide sequence. Substantial identity refers to a nucleotide sequence that, when aligned with any other sequence in a manner that maximizes correspondence, exhibits at least 80% similarity, in one specific instance at least 90% similarity, and in other specific instances at least 95% similarity when the aligned sequence is analyzed using algorithms commonly used in the art.

[0107] According to a preferred embodiment of the present invention, the nucleic acid molecule for encoding the light chain of the monoclonal antibody may be formed from the nucleotide sequence of sequence 21, and the nucleic acid molecule for encoding the heavy chain may be formed from the nucleotide sequence of sequence 22.

[0108] According to another preferred embodiment of the present invention, the nucleic acid molecule for encoding the heavy chain of the monoclonal antibody may be formed by the nucleotide sequence of sequence 23, and the nucleic acid molecule for encoding the light chain may be formed by the nucleotide sequence of sequence 24.

[0109] In another preferred embodiment of the present invention, the nucleic acid molecule for encoding the light chain of the monoclonal antibody may be formed from the nucleotide sequence of sequence 27, and the nucleic acid molecule for encoding the heavy chain may be formed from the nucleotide sequence of sequence 28.

[0110] Furthermore, the present invention provides a recombinant vector comprising a nucleic acid molecule for encoding the heavy chain of the aforementioned monoclonal antibody and a nucleic acid molecule for encoding the light chain, or all of the aforementioned nucleic acid molecules.

[0111] The recombinant vector system of the present invention can be constructed using a variety of methods known in the art. The vector of the present invention can be constructed from typical vectors for cloning or vectors for expression. Furthermore, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as the host, it typically contains a strong promoter capable of transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter, etc.), a ribosome-binding site for initiating detoxification, and a transcription / detoxification termination sequence. When using E. coli (e.g., HB101, BL21, DH5α, etc.) as the host cell, the promoter and operon sites of the E. coli tryptophan biosynthesis pathway and the left-hand promoter of phage λ (pLλ promoter) can be used as regulatory sites. When using Bacillus as a host cell, the promoter of the toxin protein gene of Bacillus thuringiensis, or any promoter that can be expressed in Bacillus, can also be used as a regulatory site.

[0112] On the other hand, the recombinant vector of the present invention can be prepared by manipulating plasmids (e.g., pCL, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, etc.), bacteriophages (e.g., λgt4·λB, λ-Charon, λΔz1, and M13, etc.) or viruses (e.g., SV40, etc.) used in the art.

[0113] When the vector of the present invention is an expression vector and a eukaryotic cell is used as the host, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter, actin promoter, human globulin promoter, and human creatine promoter) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, HSV tk promoter, mouse mammary cancer virus (MMTV) promoter, HIV LTR promoter, Moloney virus promoter, EB virus (EBV) promoter, and respiratory syncytial virus (RSV) promoter) can be used as transcription termination sequences, which typically have polyadenylated sequences.

[0114] The recombinant vector of the present invention can also be fused with other sequences to facilitate the purification of the antibody expressed therefrom. For example, fusion sequences include glutathione S-transferase (Amersham Pharmacia Biotech, USA); maltose-binding protein (NEB, USA); FLAG (IBI, USA); tag sequences such as 6xHis (hexahistidine; Qiage n, USA), Pre-S1, c-Myc, etc.; and leader sequences such as ompA, pelB, etc. Furthermore, since the protein expressed by the vector of the present invention is an antibody, the expressed antibody can be easily purified using a protein A column or similar method even without additional sequences for purification.

[0115] On the other hand, the recombinant vector of the present invention includes antibiotic resistance genes commonly used in the art as selective markers, such as resistance genes to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, genimycin, neomycin, and tetracycline.

[0116] The vector for antibody expression of the present invention can realize a vector system in which light and heavy chains are simultaneously expressed in a single vector, or a system in which light and heavy chains are expressed in separate vectors. In the latter case, the two vectors are introduced into host cells via co-transformation and targeted transformation. Co-transformation is a method of simultaneously introducing the DNA of each vector encoding the light and heavy chains into host cells and then screening for cells that express both the light and heavy chains. Targeted transformation is a method of ultimately screening for cells that express both the light and heavy chains by selecting cells converted to vectors containing the light chain (or heavy chain) and then converting the selected cells expressing the light chain back into vectors containing the heavy chain (or light chain).

[0117] Furthermore, the present invention provides host cells comprising the recombinant vector of the present invention. The aforementioned host cells are cells transformed from the recombinant vector of the present invention. Host cells capable of stably and continuously cloning and expressing the vector of the present invention are known in the art; therefore, any host cell can be used, including, for example, strains of Bacillus spp. such as Escherichia coli, Bacillus subtilis, and B. thuringensis, prokaryotic host cells such as Streptomyces, Pseudomonas (e.g., Pseudomonas putida), Proteus mirabilis, or Staphylococcus (e.g., Staphylococcus carnosus), but not limited thereto.

[0118] Suitable eukaryotic host cells for the aforementioned vectors include multicellular fungi such as Aspergillus spp. and Neurospora crassa belonging to the phylum Ascomycota, unicellular fungi such as yeasts such as Pichia pastoris, Saccharomyces cerevisiae, and Schizosaccharomyces, lower eukaryotic cells, higher eukaryotic cells such as insect cells, and cells derived from plants or mammals.

[0119] As used in this invention, the term "transfection" refers to the process of introducing a gene into a host cell using the recombinant vector of this invention, and has the same meaning as "transformation." Therefore, any method, including the introduction of nucleic acids "transfected" and / or "transformed" into host cells into an organism, cell, tissue, or organ, as is known in the art, can be performed using a suitable standard technique depending on the host cell. Such methods include, but are not limited to, electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring using silicon carbide fibers, transformation mediated by transformation of Pseudomonas aeruginosa using recombinant plasmids, PEG, dextran sulfate, liposomes, and drying / inhibition-mediated transformation methods.

[0120] The present invention also provides an epitope of human thioredoxin 1 antigen formed by an amino acid sequence selected from the group consisting of sequences 32 to 34 and 172 to 176.

[0121] The inventors have demonstrated that although hTrx1 and CaTrx1 share 82% amino acid similarity, the two antibodies against hTrx1 in this invention do not bind relative to CaTrx1. Figure 11 and Figure 15a Therefore, eight amino acid sequences that differ between hTrx1 and CaTrx1 were identified. Figure 15b They also prepared and cloned a gene preparation cassette for expressing the mutant protein against hTrx1. Figures 15c to 15f The cloned products were transformed into the N293F cell line, and the expression of eight hTrx1 mutant proteins was confirmed. Figure 16 After purifying the mutant proteins, respectively ( Figure 17 The binding ability between antibody B266-1 (hTrx1-hIgG1) and antibody B264 (hTrx1-mIgG1) was confirmed.

[0122] like Figures 18a to 18c As shown, the binding of antibody B266-1 to the M4 mutant protein (YSNVIFGNMV) was reduced compared to hTrx1, and the binding of antibody B264 to M1 (QIESKTAEIEGKED), M2 (QEALDA HAALSS), and the M4 mutant protein was also reduced compared to hTrx1. Therefore, it is highly likely that antibody B266-1 and B264 share the M4 portion (YSNVI) at their binding sites.

[0123] In addition, a microarray was constructed using 108 peptides prepared by overlapping the amino acid sequence of the hTrx1 protein with one amino acid residue. Figure 19 and 20 Epitopes of antibodies B266-1 and B264 were derived through heatmap evaluation, as shown in Table 25. Figures 21a to 21d and 22a to 22f).

[0124] The present invention also provides a nucleic acid molecule for encoding an epitope of the above-mentioned thioredoxin 1 antigen, a recombinant vector containing the above-mentioned recombinant vector, and a host cell containing the above-mentioned recombinant vector.

[0125] The nucleic acid molecule of the present invention for encoding the epitope of thioredoxin 1 antigen can be formed from an amino acid sequence selected from the group consisting of sequences 32 to 34 and 172 to 176.

[0126] The descriptions of the nucleic acid molecules encoding the above-mentioned epitopes, the recombinant vectors containing them, and the host cells containing the recombinant vectors are the same as those described above regarding the antibodies of the present invention, and therefore are omitted here.

[0127] Furthermore, the present invention provides a method for preparing a monoclonal antibody or antigen-binding fragment thereof that specifically binds to thioredoxin 1, including the step of culturing the aforementioned host cells.

[0128] The culture of host cells used to prepare antibodies or their antigen-binding fragments can be performed according to appropriate culture media and conditions known in the art. This culture process can be easily adapted and used by anyone skilled in the art, depending on the selected strain. Cell culture is classified into suspension culture and attachment culture based on cell growth mode, and into batch, fed-batch, and continuous culture methods based on culture method. The culture medium used in the culture needs to appropriately meet specific requirements.

[0129] The culture media used in animal cell culture contain a variety of carbon sources, nitrogen sources, and trace elements. Examples of usable carbon sources include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These carbon sources can be used alone or in combination. Examples of usable nitrogen sources include organic nitrogen sources such as peptone, yeast extract, meat broth, malt extract, corn extract (CSL), and soybean and wheat, as well as inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources can be used alone or in combination. In the above culture media, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium salts can be included as phosphorus sources. Metal salts such as magnesium sulfate or ferric sulfate can also be included. In addition, amino acids, vitamins, and appropriate precursors can be included.

[0130] During cultivation, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid are added to the culture in an appropriate manner to adjust the pH. Furthermore, antifoaming agents such as polyethylene glycol esters of fatty acids can be used to suppress bubble formation during cultivation. Additionally, oxygen or oxygen-containing gas (e.g., air) is injected into the culture to maintain its respiration. The culture temperature is typically between 20°C and 45°C, preferably between 25°C and 40°C.

[0131] Antibodies obtained by culturing host cells can be used in an unpurified state. They can be further purified to high purity using various conventional methods such as dialysis, salt precipitation, and chromatography. Among these, chromatography is the most commonly used method. The type and sequence of columns can be selected from ion exchange chromatography, size exclusion chromatography, affinity chromatography, etc., depending on the characteristics of the antibody and the culture method.

[0132] Furthermore, the present invention provides a breast cancer diagnostic kit comprising the monoclonal antibody of the present invention or its antigen-binding fragment, and a method for using the kit to provide the necessary information for breast cancer diagnosis.

[0133] In this invention, the term "diagnosis" refers to the confirmation of the presence or characteristics of a pathological state. For the purposes of this invention, diagnosis is the confirmation of whether or not breast cancer has developed.

[0134] Thioredoxin 1 protein, a diagnostic marker for breast cancer, is highly expressed in breast cancer tissue compared to normal breast tissue.

[0135] According to a preferred embodiment of the present invention, the above-mentioned breast cancer diagnostic kit may be an enzyme-linked immunosorbent assay (ELISA) kit, preferably, it may be one or more selected from the group consisting of direct ELISA, indirect ELISA, direct sandwich ELISA, and indirect sandwich ELISA. In a preferred embodiment of the present invention, of the two antibodies included in the sandwich ELISA kit, monoclonal antibody B266-1 is the coating antibody, and monoclonal antibody B264 is the detection antibody.

[0136] The breast cancer diagnostic kit of the present invention may also include, in addition to antibodies related to Trx1, other known instruments or reagents in the art for use in immunological analysis.

[0137] The aforementioned immunological analysis can encompass all methods that can detect the binding of antigens and antibodies. These methods are those well-known in the art, including, for example, Western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, radioimmunodiffusion, immunofluorescence assay, immunoblotting, agar double immunodiffusion, rocket immunoelectrophoresis, immunohistochemistry, immunoprecipitation, complement fixation, immunochromatography, fluorescence-activated cell sorting, and protein chip methods, but are not limited to these.

[0138] The apparatus or reagents used in immunological analysis may include suitable carriers or supports, markers capable of generating detectable signals, solvents, cleaning agents, and stabilizers. As a suitable carrier, when the marker is an enzyme, it may include a matrix capable of detecting enzyme activity, appropriate buffer solutions, chromogenic enzymes, and reaction terminators, but is not limited to these.

[0139] Preferably, the Trx1-related antibody contained in the kit of the present invention can be immobilized on a suitable carrier or support using various methods disclosed in the literature. Examples of suitable carriers or supports include PBS, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluoropolymer, agarose, cellulose, nitrocellulose, plasma substitute, cross-linked glucose, agarose, liposomes, carboxymethyl cellulose, polyacrylamide, polystyrene, grit, filter paper, ion exchange resin, plastic film, plastic tube, poly(methyl vinyl ether / maleic acid) copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or magnetic particles. Other solid matrices include cell culture plates, enzyme-linked immunosorbent assay (ELISA) plates, tubes, and polymeric membranes. The aforementioned supports can have any shape, such as spherical (microbeads), cylindrical (test tube or well inner surface), or planar (sheet, strip).

[0140] Markers capable of generating detectable signals can qualitatively or quantitatively detect the formation of antigen-antibody complexes. Examples include enzymes, fluorescent substances, ligands, luminescent materials, microparticles, redox molecules, and radioactive isotopes. Enzymes include β-glucuronidase, β-D-glucosidase, urease, peroxidases (such as horseradish peroxidase), alkaline phosphatase, acetylcholinesterase, glucose oxidase, hexokinase, malic acid oxidase, glucose-6-phosphate dehydrogenase, sucrase, and luciferase. Fluorescent substances include luciferin, isothiocyanate, rhodamine, phycobilins, phycocyanin, allophycocyanin, and luciferin isothiocyanate. Ligands include biotin derivatives. Luminescent substances include acridinium esters and luciferin. As microparticles, they include colloidal gold and colored latex; as redox molecules, they include ferrocene, ruthenium complexes, violetine, quinones, Ti ions, Cs ions, diimides, 1,4-benzoquinone, and hydroquinone; as radioactive isotopes, they include... 3 H, 14 C 32 P, 35 S, 36 Cl、 51 Cr 57 Co、 58 Co、 59 Fe、 90 Y、125 I, 131 I, 186 Re, etc. However, apart from those exemplified above, there are no particular restrictions as long as they can be used for immunological analysis.

[0141] As a chromogenic substrate for enzyme development, for example, when horseradish peroxidase (HRP) is selected as the enzyme marker, a solution containing 3-amino-9-ethylcarbazole, 5-aminosalicylic acid, 4-chloro-1-naphthol, o-phenylenediamine, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 3,3-diaminobenzidine, 3,3',5,5'-tetramethylbenzidine, dimethoxyaniline, or 3,3'-dimethoxybenzidine can be used as the substrate. Furthermore, when alkaline phosphatase is selected as the enzyme marker, a solution containing 5-bromo-4-chloro-3-indolyl phosphate, nitroblue tetrazolium, or p-nitrophenol phosphate can be used as the substrate. And, when β-D-glucosidase is selected as the enzyme marker, a solution containing o-nitrophenyl-β-D-galactoside or 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside can be used as the substrate. In addition, a variety of enzymes and enzyme chromogenic substrates known in the art can be used.

[0142] According to a preferred embodiment of the present invention, the method of the present invention for providing necessary information for breast cancer diagnosis may include: step (a) contacting a monoclonal antibody or an antigen-binding fragment thereof of the present invention with a biological sample isolated from an individual suspected of having breast cancer; step (b) detecting the protein expression level of thioredoxin 1 bound to the monoclonal antibody or its antigen-binding fragment in the biological sample by forming an antigen-antibody complex; and step (c) comparing the protein expression level of thioredoxin 1 detected in step (b) with a control group, wherein if the protein expression level is higher than that of the control group, the patient is identified as having breast cancer.

[0143] According to another preferred embodiment of the present invention, the method of the present invention for providing necessary information for breast cancer diagnosis may include: step (a) coating a solid support with a monoclonal antibody or antigen-binding fragment thereof as described in claim 2, 4 or 6; step (b) applying a biological sample isolated from an individual suspected of having breast cancer to the coated solid support; step (c) removing unbound sample; step (d) applying a monoclonal antibody or antigen-binding fragment thereof as described in claim 1, 3 or 5 to the solid support; step (e) removing unbound monoclonal antibody or antigen-binding fragment thereof; step (f) detecting the protein expression level of thioredoxin 1; and step (g) comparing the protein expression level of thioredoxin 1 detected in step (f) with a control group, wherein if the protein expression level is higher than that of the control group, the patient is identified as having breast cancer.

[0144] According to another preferred embodiment of the present invention, the method of the present invention for providing the required information for breast cancer diagnosis may include: step (a) coating a solid support with a monoclonal antibody or antigen-binding fragment thereof comprising the light chain CDR1 to CDR3 and heavy chain CDR1 to CDR3 of antibody B266 or B266-1, a monoclonal antibody or antigen-binding fragment thereof comprising the light chain variable region and heavy chain variable region of antibody B266 or B266-1, or antibody B266 or B266-1 or antigen-binding fragment thereof; step (b) applying a biological sample isolated from an individual suspected of having breast cancer to the coated solid support; step (c) removing unbound sample; step ( d) Using monoclonal antibodies or antigen-binding fragments thereof containing the light chain CDR1 to CDR3 and heavy chain CDR1 to CDR3 of antibody B264, or monoclonal antibodies or antigen-binding fragments thereof containing the light chain variable region and heavy chain variable region of antibody B264, or antibody B264 or its antigen-binding fragments thereof, applied to a solid support; step (e) removing unbound monoclonal antibodies or their antigen-binding fragments; step (f) detecting the expression level of thioredoxin 1 protein; and step (g) comparing the expression level of thioredoxin 1 protein detected in step (f) above with the control group. If the expression level of the protein is higher than that of the control group, the patient is identified as a breast cancer patient.

[0145] In this invention, the term "isolated biological sample" includes tissues (breast tissue), cells (breast cells), whole blood, plasma, serum, blood, saliva, synovial fluid, urine, sputum, lymph, cerebrospinal fluid, autopsy samples (brain, skin, lymph nodes, spinal cord, etc.), cell culture supernatant, or ruptured eukaryotic cells, etc., which exhibit differential Trx1 protein expression levels as a marker for breast cancer. This includes not only samples derived from primary cancer lesions but also samples derived from metastatic lesions. Trx1 protein expression levels can be confirmed by reacting these biological samples, in an induced or uninduced state, with the monoclonal antibody of this invention.

[0146] The term "individual" in this invention includes mammals such as cattle, pigs, sheep, chickens, dogs, and humans, as well as birds, and there is no particular limitation on individuals suspected of having breast cancer.

[0147] The present invention will now be described in detail through embodiments, etc., to aid in understanding. However, the embodiments of the present invention can be modified in many other ways, and it should be understood that the scope of the invention is limited to the following embodiments. The embodiments of the present invention are provided to those skilled in the art for the purpose of further illustrating the invention.

[0148] Embodiments of the present invention

[0149] Example 1

[0150] Preparation of human thioredoxin 1 (Trx1) antigen

[0151] 1-1. Preparation of Trx1 expression vector

[0152] To express the gene encoding human thioredoxin 1 protein in *E. coli*, the gene was synthesized according to *E. coli* codon usage. The synthesized human thioredoxin 1 gene sequence is shown in Table 1 below.

[0153] Table 1

[0154]

[0155] The primer sequences used to amplify the human thioredoxin 1 gene are shown in List 2 below.

[0156] Table 2

[0157] hTrx1-Rev CACCAGTTCGTTAATCGTGGTAATGAAAGCT (sequence 31)

[0158] PCR (Polymerase chain reaction) was performed to clone the gene into the plasmid and amplify it. 10 pmol of the synthesized gene, 10 pmol of primers (hTrx1-For, hTrx1-Rev), dNTPs (2.5 mM each), Exprime Taq polymerase, and buffer were added and mixed to serve as a template. The solution was incubated at 95°C for 2 minutes, followed by incubation at 95°C for 30 seconds, 55°C for 30 seconds, and 70°C for 20 seconds, repeated 35 times. Finally, the reaction was stopped at 70°C for 2 minutes. After purifying the amplified gene, it was purified using the restriction enzyme corresponding to the plasmid treatment to clone it to the EcoRV position of the multi-cloning site (MCS) of the pUC57 plasmid. The purified gene, restriction enzyme-treated plasmid, ligase, and buffer were mixed and the reaction was performed. To convert the plasmid to E. coli DH5α, E. coli DH5α competitive cell lines were dissolved at 4°C, mixed with the plasmid mixture, and reacted at 4°C for 30 minutes. After the reaction, a heat shock was applied at 42°C for 30 seconds, followed by stabilization at 4°C for 2 minutes. The mixture was then poured into LB (Luria-Burtani) solid medium containing an antibiotic (50 μg / ml ampicillin) for uniform absorption and cultured at 37°C for 16 hours. Plasmids containing the human thioredoxin 1 gene were screened from the colonies grown in the culture medium.

[0159] 1-2. Expression and purification of Trx1

[0160] After purification of the plasmid containing the selected human thioredoxin 1 gene, E. coli strain BL21 was transformed with the method described above for protein expression. To express thioredoxin 1 protein from the transformed strain, the strain was cultured at 37°C in LB liquid medium containing antibiotics until OD. 600 After reaching a concentration of 0.5, IPTG (Isopropylβ-D-thiogalactopyranoside) was added and the cells were cultured for another 3 hours to achieve a concentration of 1 mM. Protein expression was then confirmed by SDS-PAGE. To purify the protein, the obtained cell lines were lysed using sonication and centrifuged (12000 rpm, 30 minutes, 4°C) to obtain the supernatant. A commercially available anti-thioredoxin I antibody (LF-MA0055, Abfrontier) was added to the supernatant to bind to the expressed thioredoxin I. Protein A / G PLUS-Agarose (sc-2003, Santa Cruz), which is bound to the antibody, was then added and centrifuged again for purification. Purity and quantification were then confirmed by SDS-PAGE.

[0161] Example 2

[0162] Production and purification of monoclonal antibodies specific to Trx1

[0163] 2-1. Immunization in mice

[0164] The purified human thioredoxin 1 protein was mixed with an adjuvant and injected into mice. Blood samples were collected from the mice, and the presence of antibodies was confirmed by enzyme-linked immunosorbent assay (ELISA). After two immunizations, the potential for antibody production (1:5000) was appropriately increased.

[0165] 2-2. Cell fusion and preparation of hybridomas

[0166] Spleens were harvested from immunized mice, and B lymphocytes were isolated and fused with cultured myeloma cells (sp2 / 0). The fused cells were then cultured in HAT medium supplemented with hypoxanthine, aminopterine, and thymidine to selectively screen for myeloma and hybridoma cells containing only B lymphocytes.

[0167] 2-3. Screening for hybridoma cells that produce monoclonal antibodies specific to Trx1

[0168] Enzyme-linked immunosorbent assay (ELISA) was used to identify three antibodies that react with human thioredoxin 1 in the obtained hybridoma cells. Cells that showed a positive reaction in ELISA were then screened using a limiting dilution method to identify hybridomas that produce antibodies that react with the antigen.

[0169] 2-4. Production and purification of monoclonal antibodies

[0170] Ascites fluid was obtained by injecting the three types of hybridomas into mice, and purified using Protein Affinity chromatography. The purified antibody was confirmed by SDS-PAGE.

[0171] Example 3

[0172] Isotype confirmation of monoclonal antibodies

[0173] The isotypes of the three antibodies obtained in Example 2 above were confirmed using the Rapid enzyme-linked immunosorbent assay (ELISA) Mouse mAbs Isotyping Kit (Pierce, Cat. 37503).

[0174] The result, such as Figure 1 As shown in section (b), the heavy chain of monoclonal antibody 2B4 was confirmed to be IgG1, the heavy chain of monoclonal antibody 8F3 to be IgG12a, and the heavy chain of monoclonal antibody 9G7 to be IgG2b. The light chains were confirmed to be κ chains in all cases.

[0175] Example 4

[0176] Amino acid sequence analysis of monoclonal antibodies 9G7 (AB1) and 2B4 (AB2)

[0177] The heavy and light chain amino acid sequences of 9G7 (AB1) and 2B4 (AB2) in the three monoclonal antibodies obtained in Example 2 above were analyzed. Sequences suitable for fusion with the Fc region for backtranslation and recombination expression were determined as amino acid sequences. The determined sequences were arranged using IMTG GAP alignment, and hypermutation tables were used to identify hypermutated and intact CDR3 regions. The sequences were confirmed using accurate mass peptide maps, etc. Figure 2 and Figure 3The high mutation and CDR3 were confirmed using MS / MS spectra.

[0178] Example 5

[0179] Affinity comparison and antibody determination using enzyme-linked immunosorbent assay (ELISA)

[0180] Positions in the amino acid sequences obtained through the above process that allow for hypermutation were selected. Genes were then synthesized by altering the base sequence using four different combinations of 9G7 (AB1) (B266, B297, B268, and B269) and two combinations of 2B4 (AB2) (B264 and B265). The affinity of the obtained six antibodies (B264–B269) for the respective antigens was confirmed by enzyme-linked immunosorbent assay (ELISA) (the numbers after T in Tables 3 to 5 indicate the batch numbers).

[0181] Affinities for three types of antigens—naked Trx1, Trx1 bound to Fc (Trx1-Fc), and Trx1 bound to the His tag (Trx1-His)—were confirmed by direct enzyme-linked immunosorbent assay (ELISA), and the results are shown in Tables 3 through 5. As shown in Tables 3 through 5, B264 in IgG1(κ) and B266 in IgG2b(κ) exhibited the best affinity for all three antigens.

[0182] Table 3

[0183] Response results to Trx1 antigen that has not bound to anything

[0184] AB264-T150514-7 2.0575 B265-T150514-10 1.3225 AB264-T150514-8 1.1635 B265-T150514-9 0.9515 B267-T150519-5 0.8155 B269-T150519-9 0.735 B268-T150519-8 0.716 B268-T150519-7 0.670 B266-T150519-3 0.6625 B266-T150519-4 0.6615 B269-T150519-10 0.626 B267-T150519-6 0.522

[0185] Table 4

[0186] Response results to Trx1-Fc antigen

[0187] AB264-T150514-7 1.171 AB264-T150514-8 0.494 B265-T150514-10 0.378 B265-T150514-9 0.273 B266-T150519-3 0.198 B266-T150519-4 0.181 B267-T150519-5 0.043 B267-T150519-6 0.023 B268-T150519-8 0.015 B268-T150519-7 0.003 B269-T150519-9 0.002 B269-T150519-10 -0.001

[0188] Table 5

[0189] Response results to Trx1-His antigen

[0190] AB264-T150514-7 1.996 B265-T150514-10 1.465 AB264-T150514-8 1.142 B265-T150514-9 1.03 B267-T150519-5 0.857 B268-T150519-8 0.783 B269-T150519-9 0.77 B268-T150519-7 0.761 B269-T150519-10 0.717 B266-T150519-3 0.696 B266-T150519-4 0.667 B267-T150519-6 0.554

[0191] The amino acid sequences of antibodies B264 and B266, which have high affinity, are shown in Table 6 below.

[0192] Table 6

[0193]

[0194]

[0195] Example 6

[0196] Production of antibody B264 and antibody B266

[0197] 6-1. Preparation of expression plasmids for antibodies B264 and B266

[0198] As shown in Table 6 above, since the amino acid sequences of antibodies B264 and B266 have been revealed, the genes corresponding to the light and heavy chains of these antibodies can be chemically synthesized. The synthesized gene sequences are shown in Table 7 below. The synthesized genes were cloned into pcDNA3.0.

[0199] Table 7

[0200]

[0201]

[0202]

[0203] 6-2. Expression and purification of antibodies B264 and B266

[0204] To express the B264 antibody, pcDNA3-SSJ11-L and pcDNA3-SSJ11-H were co-transfected into HEK293 cell lines, and to express the B266 antibody, pcDNA3-SSJ12-L and pcDNA3-SSJ12-H were co-transfected and cultured for 7 days. The cell lines were cultured, and recombinant monoclonal antibodies secreted from the culture medium were obtained and purified using protein A chromatography. The eluent containing the recombinant monoclonal antibodies was concentrated by ultrafiltration and filtered through a 0.2 μm sterile filter to obtain high-purity antibodies.

[0205] The purity and size of the purified antibody were confirmed by SDS-PAGE. The SDS-PAGE results are shown below. Figure 6 As shown, antibodies B264 and B266 exhibit a heavy chain size of 47 kDa and a light chain size of 25 kDa under reducing conditions, and a light chain size of 150 kDa under non-reducing conditions, thus confirming that they are expressed at the expected sizes.

[0206] Example 7

[0207] The pairing of two monoclonal antibodies obtained by sandwich enzyme-linked immunosorbent assay (ELISA) was confirmed.

[0208] Mix 100 μl of coating buffer (0.015 M Na₂CO₃, 0.035 M NaHCO₃, 0.003 M NaN₃, pH 9.6) and 100 ng of coating antibody (B266) into each well and incubate at 4 °C under O / N conditions. Add 200 μl of PBS (PBSA; isolation buffer) containing 1% BSA to each well and incubate at room temperature for 60 minutes. Then, add 20 μl of antigen (50 ng, 25 ng, 12.5 ng, or 0 ng), add 80 μl of detection antibody (Biotin-labeled B264; B264-B), and incubate at 37 °C for 90 minutes. After removing the reaction solution, pour 200 μl of PBS (PBST; washing buffer) containing 0.05% Tween 20 into each well and wash. Repeat the above process 3 times.

[0209] After treating each well with 100 μl of streptavidin-HRP diluted 1:200, the mixture was reacted at 37°C for 30 minutes. After removing the reaction solution, 200 μl of PBS (PBST; washing buffer) containing 0.05% Tween 20 was added to each well for washing. This process was repeated 3 times.

[0210] After adding 100 μl of TMB solution to each well, the reaction was carried out in the dark at room temperature for 10 minutes. After treating each well with 100 μl of 2.5 M sulfuric acid solution (H2SO4; stop buffer), the results were confirmed at 450 nm.

[0211] The results, as shown in Table 8, indicate that the antigen reaction value increases with concentration, thus confirming that these antibodies detect the antigen. However, the OD detection value is high in the absence of antigen; therefore, experiments to improve antibody performance are needed.

[0212] Table 8

[0213] A sandwich enzyme-linked immunosorbent assay (ELISA) was performed using B266 as the coating antibody and B264 as the detection antibody.

[0214] O.D. 450nm ]]> 0.828 1.226 1.506 2.257

[0215] Example 8

[0216] Fc partial isotype modification for antibody performance enhancement

[0217] The antibody expression system utilizes transient transfection of recombinant plasmids, rather than hybridoma transfection. Therefore, plasmids containing heavy chains from the recombinant plasmids are co-transfected with plasmids containing other homotypes of heavy chains. Specifically, plasmids containing genes encoding other heavy chains (not pcDNA3-SSJ12-H) from pcDNA3-SSJ12-L and pcDNA3-SSJ12-H, used for expressing 9G7(AB1), are co-transfected.

[0218] This method yielded an antibody (B266-1) that converted the Fc portion of B266 to human IgG1. The characteristics of this antibody were confirmed by SDS-PAGE. Figure 7 ).

[0219] Finally, the CDR sequences of the selected monoclonal antibodies B264 and B266-1 were determined by appropriate Fc region fusion for back translation and recombinant expression.

[0220] IMTG GAP alignment is an alignment with "determined sequences" in the IMTG database. The closest germline sequence and hypermutation are displayed through a database search. The IMTG GAP alignment results for the light and heavy chains of antibodies B266-1 and B264 are shown below. Figures 8a to 8d The amino acid sequences of the light chain CDR1 to CDR3 and the heavy chain CDR1 to CDR3 are shown in Table 9, and the amino acid sequences of the variable regions of the light chain and the heavy chain are shown in Table 10. Furthermore, the amino acid sequences and gene sequences of the B266-1 light and heavy chains are shown in Table 11.

[0221] Table 9

[0222] B264 Light Chain CDR1 QSIVHSNGNTY (Sequence 1) B264 Light Chain CDR2 KVS (Sequence 2) B264 Light Chain CDR3 CFQGSHVPYT (Sequence 3) B264 heavy chain CDR1 GYTFTSYT (Sequence 4) B264 heavy chain CDR2 INPTSDYTN (Sequence 5) B264 heavy chain CDR3 FCASEGGFLYYFDY (Sequence 6) B266-1 Light Chain CDR1 SRISY (Sequence 7) B266-1 Light Chain CDR2 DTS (Sequence 8) B266-1 Light Chain CDR3 CHQRSSYPTF (Sequence 9) B266-1 Heavy Chain CDR1 GFNIKDTF (Sequence 10) B266-1 Heavy Chain CDR2 IDPANGNT (Sequence 11) B266-1 Heavy Chain CDR3 CALLQYSAMDY (Sequence 12)

[0223] Table 10

[0224]

[0225]

[0226] Table 11

[0227]

[0228]

[0229]

[0230] Example 9

[0231] The pairing of monoclonal antibodies against B266-1 and B264 obtained by sandwich enzyme-linked immunosorbent assay (ELISA) was confirmed.

[0232] Mix 100 μl of coating buffer and 100 ng of coating antibody (B266-1) and pour into each well. Incubate the reaction at 4 °C under O / N conditions. After removing the reaction solution, pour 200 μl of washing buffer into each well and wash. Repeat this process twice.

[0233] After adding 200 μl of PBSA to each well, the reaction was carried out at room temperature for 120 minutes. Then, 20 μl of antigen (25 ng or 0 ng) and 80 μl of detection antibody (B264-B) were added, and the reaction was carried out at 37°C for 90 minutes. After removing the reaction solution, 200 μl of washing buffer was added to each well for washing. This process was repeated three times.

[0234] After treating each well with 100 μl of streptavidin-HRP diluted 1:200, the mixture was reacted at 37 °C for 30 minutes. After removing the reaction solution, 200 μl of washing buffer was added to each well for washing. This process was repeated 3 times.

[0235] After adding 100 μl of TMB solution to each well, the reaction was carried out in the dark at room temperature for 10 minutes. After treating each well with 100 μl of stop buffer, the results were confirmed at 450 nm.

[0236] The results, as shown in Table 12, indicate that the antigen was reacted appropriately, and a decrease in blank value was confirmed compared to the antibody used in Example 6.

[0237] Table 12

[0238] Sandwich enzyme-linked immunosorbent assay (ELISA) using B266-1 as the coating antibody and B264 as the detection antibody.

[0239]

[0240] Example 10

[0241] Affinity analysis of monoclonal antibodies against antigens

[0242] Two monoclonal antibodies specific to the antigen Trx1 were stably produced by expression using a transient plasmid transfection system. To confirm the affinity for the antigen, an enzyme-linked immunosorbent assay (ELISA) was performed (part (a) of Figure 8).

[0243] After mixing 100 μl of coating buffer and 100 ng of Trx1 and pouring the mixture into each well, the mixture was incubated at 4 °C for at least 16 hours. After removing the reaction solution, 200 μl of PBSA was added to each well, and the mixture was incubated at 37 °C for 120 minutes. After removing the reaction solution, 100 μl of the prepared antibody B266-1 or antibody B264 was diluted 1 / 5 from 0.1 μM and added to each well, and the mixture was incubated at 37 °C for 120 minutes. After removing the reaction solution, 200 μl of washing buffer was added to each well for washing. This process was repeated three times.

[0244] Human IgG-HRP (diluted 1:4000) was used as antibody B266-1, and mouse IgG-HRP (diluted 1:4000) was used as antibody B264. 100 μl of each antibody was added, and the mixture was incubated at 37°C for 60 minutes. After removing the reaction solution, 200 μl was added to each well for washing. This process was repeated three times.

[0245] After adding 100 μl of TMB solution to each well, the reaction was carried out in the dark at room temperature for 10 minutes. After adding 100 μl of stop buffer to each well, the results were confirmed at 450 nm. The obtained results were analyzed using Prism (Graphpad) (Figure 8, part (b)).

[0246] Analysis of the affinity results for coated antibody B266-1 and detection antibody B264 confirmed that the high blank value was due to the reactivity of B266-1, but the binding degree of B266-1 and B264 increased with antigen concentration. This indicates that B266-1 and B264 bind to the antigen. If K is calculated based on the analysis using the Prism program... D If the (equilibrium dissociation constant) value is given, then B266-1 is 1.1 × 10⁻⁶. -11 B264 is 1.3 × 10 -10 K D Value at 10 -10 Up to 10 -12 In the case of [condition], it was evaluated as having sensitivity to antigens at the picomolar (pM) level. Therefore, it can be concluded that B266-1 and B264 have sensitivity to high levels of antigens.

[0247] Example 11

[0248] Sandwich enzyme-linked immunosorbent assay (ELISA) in the serum of breast cancer patients

[0249] The sandwich enzyme-linked immunosorbent assay (ELISA) using the coated antibody (B266-1) was prepared by the procedure described below.

[0250] Prepare a 1 μg / ml coated antibody solution by adding 100 ml of coating buffer and 0.1 ml of 1 mg / ml B266-1. Pour 100 μl of the prepared coated antibody solution into each well of a 96-well plate and incubate at 4 °C for 12 hours. Remove the antibody solution, pour 200 μl of 0.05% PBST into each well, and wash. Repeat this washing process three times. Add 200 μl of PBSA to each well and incubate at 4 °C for 4 hours (isolation step). Remove the PBSA and dry the 96-well plate in a temperature and humidity control (20 °C, 30% RH) for 3 hours.

[0251] Then, the detection antibody (B264) is biotinylated through the following process.

[0252] To prepare 2 mg / ml biotin-7-NHS, DMSO (dimethyl sulfoxide) was mixed into 20 mg / ml biotin-7-NHS. 15 μl (30 μg) of biotin-7-NHS (2 mg / ml) was mixed into every 1 mg / ml of B264 antibody and reacted at 15–25 °C for 2 hours. The reaction solution was placed in an Amicon ultra-15 (Millipore) filter, and PBS solution was added to the final volume. The mixture was then centrifuged at 3600 x g until 0.5 ml remained. This process was repeated three times. The remaining antibody solution (biotinylated B264; B264-B) in the Amicon filter was transferred to a 1.5 ml tube and PBSA was used to adjust the final concentration to 0.3 mg / ml.

[0253] Then, the human Trx1 antigen was detected from the serum of breast cancer patients through the following procedure.

[0254] Standard antigen solution was added to the first column of a 96-well plate prepared using antibody coating. After adding 20 μl of serum obtained from breast cancer patients, 80 μl (0.3 mg / ml) of B264-B solution was added. The plate was then incubated at 37°C for 60 minutes. The antigen and antibody reaction solution was removed, and 200 μl of PBST was added to each well for washing. This process was repeated three times. 100 μl of streptavidin-HRP diluted 1:400 (R&D Systems) was added, and the plate was incubated at 37°C for 30 minutes. After the reaction, the reaction solution was removed, and 200 μl of PBST was added to each well for washing. This process was repeated three times. Finally, 100 μl of TMB solution (Sure Blue) was added and the plate was incubated at room temperature and in the dark for 15 minutes. Pour in 100 μl of 2N H2SO4 solution and use a microplate reader to detect the absorbance at 450 nm.

[0255] Finally, ROC analysis was performed using the following procedure.

[0256] Sensitivity and specificity were calculated by analyzing the results of enzyme-linked immunosorbent assays (ELISA) using B266-1 and B264, monoclonal antibodies associated with Trx1. A sensitivity of 93.0% and a specificity of 97.4% were confirmed when the cut-off value was 10.8 ng / ml. Figure 9 ).

[0257] Example 12

[0258] Comparative analysis with other enzyme-linked immunosorbent assay kits for diagnosing breast cancer

[0259] In this embodiment, to evaluate the performance of B266-1 and B264 as recombinant monoclonal antibodies, they were compared with an enzyme-linked immunosorbent assay kit for detecting CA15-3, another biomarker for diagnosing breast cancer (Table 13).

[0260] As shown in Table 13, the sensitivity and specificity of the monoclonal antibody that specifically binds to Trx1 in this invention are particularly high compared to CA15-3.

[0261] Table 13

[0262] Comparison of the kit of the present invention with the AxSYM CA15-3 kit

[0263] Sensitivity (%) 93 54 Specificity (%) 97.4 94 Test sample Serum Serum and plasma

[0264] Example 13

[0265] Expression of Trx1 protein in golden mole (Chrysochloris asiatica)

[0266] 13-1. Comparison of human Trx1 (hTrx1) and golden mole Trx1 (CaTrx1) sequences

[0267] The amino acid sequence comparison between the golden mole (Chrysochlorisa siatica) Trx1, which is structurally similar to human Trx1 but has low amino acid sequence similarity, confirmed that it showed 82% identity. Figure 10 ).

[0268] The gene was synthesized using the known base sequence of CaTrx1 (NCBI Accession Number XM_006863001.1), and then cloned into the pUCIDT-AMT plasmid for storage in *E. coli*. The cloned plasmid was treated with restriction enzymes Sfi I and Xho I, and confirmed by electrophoresis. The results are as follows: Figure 12 As shown, the restriction enzyme-treated plasmid (lane 2) confirmed the 357 bp DNA fragment excised from the plasmid, thus confirming the synthesis of the CaTrx1 gene. Figure 12 (arrow).

[0269] 13-2. Expression of CaTrx1 protein

[0270] The CaTrx1 plasmid prepared in Example 13-1 above was transformed into animal cells to purify CaTrx1 secreted from the cell line. The protein was confirmed by 15% SDS-PAGE, and the results are shown below. Figure 3 middle. Figure 13 Lanes 1 and 2 represent 5 μg and 10 μg of total protein in the CaTrx1 transformed somatic cell culture medium, respectively, while lane 3 represents 3 μg of control protein (BSA; Bovine Serum Albumin). This confirms that the purified CaTrx1 protein exhibits a productivity of 28.75 mg / L.

[0271] Example 14

[0272] Confirmation of the affinity of two antibodies against the human Trx1 antigen (hTrx1) for CaTrx1.

[0273] This embodiment confirms the binding affinity of two antibodies, B266-1 (Trx1-hIgG1) and B264 (Trx1-mIgG1), to CaTrx1.

[0274] To confirm the binding affinity of B266-1 (Trx1-hIgG1) and B264 (Trx1-mIgG1) for hTrx1 and CaTrx1, respectively, 200 ng of hTrx1 and 10 μg of CaTrx1 were coated onto each well of a 96-well ELISA plate. 200 μL of isolation buffer (4% skim milk / 1x PBS) was added to each well, and the plate was incubated at 37°C for 1 hour. After removing the reaction solution, 100 μL each of B266-1 (Trx1-hIgG1) and B264 (Trx1-mIgG1) were added to each well coated with the antigen, and the plate was incubated at 37°C for 2 hours. The plate was then washed five times with 200 μL of 1xPBST. Add 100 μL of anti-human Fc-HRP to wells treated with B266-1 (Trx1-hIgG1) and 100 μL of mouse-HRP (diluted at a ratio of 1:4000) to wells treated with B264 (Trx1-mIgG1), and incubate at 37°C for 2 hours. Remove the reaction solution and wash five times with 200 μL of 1xPBST. Add 100 μL of chromogenic reagent to each well and incubate for 10 minutes, then add 50 μL of 2.5 M H2SO4 to each well. After color development, measure the results using an ELISA reader.

[0275] The binding affinity of B266-1 (Trx1-hIgG1) and B264 (Trx1-mIgG1) for hTrx1 was confirmed, as shown in Table 14 below. This confirms that B266-1 has a KD of 2.1 x 10⁻⁶ relative to 200 ng of antigen. -10 M, B264 is KD = 1.7 x 10 -10 M. And, through Figure 14 A, compared to B266-1, has a reaction value (OD490) that is about 50% lower through binding with B264.

[0276] The results confirmed the binding affinity of antibodies B266-1 and B264 against 10 μg of CaTrx1, such as... Figure 14 As shown in B and Table 14, neither antibody binds to CaTrx1.

[0277] Table 14

[0278]

[0279] Example 15

[0280] Preparation of mutant antigens targeting human Trx1 antigen (hTrx1)

[0281] 15-1. Setting the mutation location through amino acid sequence analysis between hTrx1 and CaTrx1

[0282] The amino acid sequence of the known hTrx1 (NCBI Accession Number NP_003320.2) was compared with the amino acid sequence of CaTrx1 (NCBI Accession Number XP_006863063.1). Figure 15a As shown, although hTrx1 and CaTrx1 share 82% amino acid sequence similarity, their antibody binding affinity to the antigen is significantly different. Therefore, the parts with different amino acid sequences are divided into 8 parts. Figure 15b ).

[0283] 15-2. Fusion PCR and Cloning for Mutant Protein Expression

[0284] A) Fragment PCR

[0285] In the eight portions with different amino acid sequences confirmed in Example 15-1 above, the hTrx1 sequence was replaced with the CaTrx1 sequence to amplify the DNA fragment of the cassette used for mutant preparation. Figure 15d ).

[0286] Specifically, in order to prepare genes for expressing the various mutant proteins, two DNA fragments need to be amplified for fusion PCR. Therefore, two primers (F2 and R1) containing the mutated portions of the required base sequences were prepared. Figure 15c (See Table 15) DNA fragments were amplified using primers F1 and R1, and F2 and R2 as pairs. To amplify the DNA fragments, 1 μL of template DNA (100-200 ng) and 10 pmol each of forward and reverse primers were added to 25 μL of 2xEF-Taq PCR smart mix band (Solgent, SEF02-M50h). The mixture was titrated to the final volume with sterile distilled water, thoroughly mixed, and amplified using a PCR instrument (Thermalcycler, T100).

[0287] Table 15

[0288]

[0289]

[0290] The PCR reaction conditions were as follows: 30 cycles of 95°C for 2 minutes for pre-denaturation (1 cycle), followed by 95°C for 20 seconds, 62°C for 40 seconds, and 72°C for 1 minute for amplification, and then 72°C for 5 minutes for post-extension (1 cycle). The reaction was then terminated. The amplified DNA fragments were confirmed using 1% agarose gel electrophoresis. Figure 15d To purify the gene, experiments were conducted using the QIAqui ck gel Extraction Kit (QIAGEN, 28704) according to the manufacturer's instructions.

[0291] B) Fusion PCR for fusing two DNA fragments and purification of PCR products

[0292] To fuse the amplified DNA fragments, PCR was performed using two DNA fragments and primers F1 and R2. Figure 15c For the PCR mixture used in fusion PCR, 100-150 ng each of two DNA fragments and 1 μL each of forward and reverse primers (10 pmol each) were added to 25 μL of 2xEF-Taq PCR smart mix mix (Solgent, SEF02-M50h). The mixture was titrated to the final volume with sterile distilled water, thoroughly mixed, and amplified using a PCR instrument. The PCR reaction conditions were as follows: 30 cycles of 95°C for 2 minutes for pre-denaturation, 95°C for 20 seconds, 62°C for 40 seconds, and 72°C for 1 minute for amplification, followed by 72°C for 5 minutes for extension, and the reaction was terminated. After the reaction, the PCR products were confirmed using a 1% agarose gel. Figure 15e ).

[0293] After the fusion PCR reaction, the PCR products were purified using ethanol precipitation. 3M sodium acetate (pH 5.2) was added to 1 / 10 of the total PCR product volume, followed by 100% ethanol (twice the total PCR product volume). The mixture was thoroughly mixed and incubated at -70°C for 10 minutes. Then, the mixture was centrifuged at 13000 rpm for 10 minutes, the supernatant was removed, and 1 mL of 70% ethanol was added. The mixture was then centrifuged at 13000 rpm for 10 minutes. The supernatant was removed, and the mixture was incubated in a 70°C heat block for 3 minutes to remove any remaining ethanol. The DNA precipitate was then dissolved thoroughly in 50 μL of distilled water.

[0294] C) Cloning of PCR products

[0295] Restriction enzymes were used to clone the purified PCR product into the N293F plasmid. Specifically, 50 μL of the PCR product and the N293F plasmid were treated with 7 μL of Kpn I and 8 μL of 10× buffer, respectively, and the total volume was titrated to 80 μL. After thorough mixing, the mixture was reacted in a water bath at 37°C for 3 hours. After the reaction was complete, the product was purified by ethanol precipitation. Then, 7 μL of Xho I and 8 μL of 10× buffer were treated, and the total volume was titrated to 80 μL. After thorough mixing, the mixture was reacted in a water bath at 37°C for 3 hours. To purify the DNA from the terminated reaction, the experiment was performed using the QIAquick gel extraction kit (QIAGEN, 28704) according to the manufacturer's instructions.

[0296] To clone the purified DNA fragment into N293F, the DNA fragment (100 ng; less than 1 kb, 300 ng; more than 3 kb) and 20 ng of restriction enzyme N293F were processed, along with 1 μL of T4 DNA ligase (Thermo Scientific, EL0011), 1 μL of 10× buffer, and the total volume was titrated to 10 μL with purified water. The reaction was carried out at 22°C for 16 hours. After the reaction, DH5α soluble cells were removed and thawed on ice for transformation into *E. coli*. 2 μL of the ligation reaction mixture was thoroughly mixed with DH5α soluble cells and reacted on ice for 30 minutes. Then, the mixture was incubated in a 42°C water bath for 90 seconds, transferred to ice, and reacted for another 3 minutes. The reactants were added to 500 μL of SOC medium (20 g bactotryptone, 5 g bacto-yeast extract, and 0.5 g NaCl per 1 L) and incubated at 37°C with shaking for 30 minutes. After incubation, 100 μL of the reactants were taken and sprinkled into LB medium supplemented with 100 μg / mL ampicillin (10 g bactotryptone, 5 g bacto-yeast extract, and 10 g NaCl per 1 L) and incubated at 37°C for 12–16 hours.

[0297] D) Colony PCR and base sequence analysis used to confirm transformation.

[0298] Colony PCR was performed to confirm the presence of cloned plasmids. For the PCR mixture used in fusion PCR, 0.5 μL each of the forward and reverse primers (10 pmol each) were added to 12.5 μL of a 2xEF-Taq PCR smart mix band (Solgent, SEF02-M50h), and the mixture was titrated to the final volume with sterile distilled water. After thorough mixing, amplification was performed using PCR. The PCR reaction conditions were as follows: 25 cycles of 95°C for 2 minutes for pre-denaturation (1 cycle), 95°C for 20 seconds for amplification, 62°C for 40 seconds for amplification, and 72°C for 1 minute for extension, followed by 72°C for 5 minutes for extension. The reaction was then terminated.

[0299] After the reaction was complete, confirmation was performed using a 1% agarose gel. Figure 15f The amplified products were purified, and the base sequence analysis was outsourced to NeuroProbe. The base sequence information is shown in Table 16 below. Sequences marked in bold and underlined indicate sequences that caused mutations.

[0300] Table 16

[0301]

[0302]

[0303]

[0304]

[0305] E) Plasmid preparation (Midi-preparation)

[0306] Colonies containing plasmids for end-base sequence analysis were inoculated into 100 mL of 2×YT medium (17 g trypsin, 10 g yeast extract, and 5 g NaCl per liter) containing 100 μg / mL ampicillin and cultured at 37°C and 210 rpm for 16 hours. The cultured bacteria were then separated by centrifugation at 4500 rpm for 8 minutes. To obtain the plasmids, [the following process was used]. The Xtra Midi (Macherey-Nagel, Cat. 740410.100) was tested according to the manufacturer's user manual.

[0307] F) Animal cell culture

[0308] 19.4 g of Freestyle™ 293 Expression Medium AGT™ powder (AG100009, Thermoscientific) was dissolved in 1 L of triple-distilled water and sterilized. 35 mL of Freestyle™ 293 Expression Medium AGT™ media, heated in a 37°C water bath for 30 minutes, was placed into a 125 mL Erlenmeyer flask (CC-431143, Corning). Frozen cell line 293F (510029, Invitrogen) was thawed for approximately 1–2 minutes in a 37°C water bath, then mixed with 5 mL of Freestyle™ 293 Expression Medium AGT™, and poured into a 125 mL Erlenmeyer flask containing 35 mL of the medium. The mixture was then incubated in a 37°C, 8% CO2 shaking incubator at 85 rpm. After culturing for 2–3 days, 10 μL of the cell line and 10 μL of trypan blue were mixed, and 10 μL was added to the Luna cell counting chip (L12002, Biosystems). Cell viability and cell count were confirmed using the Luna™ automated cell counting system (L10001, Biosystems). The cell line was then released to 4–7 × 10⁶ cells / mL in 40 mL of culture medium. 5 After the cells were separated to a density of 1 / mL, centrifugation at 100xg for 5 minutes was performed to remove the supernatant. 10 mL of culture medium was added to the cell pellet after removing the supernatant to release the pellet, and 30 mL of the culture medium was inoculated into dispensed 125 mL Erlenmeyer flasks. The cells were incubated at 37°C, 8% CO2, 85 rpm in a shaking incubator, and this process was repeated at least twice.

[0309] G) Transfection into animal cells

[0310] Divide 40 mL into equal portions of 5.5 × 10 5 Cells at a density of [cells / mL] were placed in test tubes and centrifuged at 100xg for 5 minutes. After removing the culture medium, the precipitate was released using 10 mL of Freestyle™ 293 Expression Medium AGT™ media and seeded into 125 mL Erlenmeyer flasks. Cells were cultured in a CO2 shaking incubator at 37°C, 8% concentration, and 85 rpm. The cell count and viability were confirmed to be 1×10⁻⁶ cells / mL using a Luna™ automated cell counter. 6Cells / mL, above 90%. Using 40 mL of culture medium as a baseline, 25 μg of DNA to be transformed and 100 μg of PEI (23966, Polysciences) were vortexed and centrifuged at 10,000 rpm for 1 second. The DNA and PEI were then mixed in 800 μL of Freestyle™ 293 Expression Medium AGT™ and reacted at room temperature for 20 minutes. The resulting DNA-PEI mixture was transferred to a 125 mL flask containing cell lines for further reaction. After 24 hours, a supplement was added to a concentration of 5 g / L. The cells were then cultured for another 5 days, and the culture medium was recovered.

[0311] H) Expression confirmation test in culture medium

[0312] After 5 days of culture, 500 μL of the recovered culture medium was added to each tube. One tube was allowed to stand for 20 minutes, then the supernatant (uncentrifuged sample) was used. The remaining tubes were centrifuged at 10,000 rpm for 2 minutes to remove cells, and only the supernatant (centrifuged sample) was used. 10 μL of 5x reduction sample buffer was mixed with 40 μL of supernatant, and the mixture was boiled at 100°C for 5 minutes. The prepared sample was confirmed to be suitable for use with Mini- 15% SDS-PAGE of Tetra Cell (BR165-8029, Bio-rad) Figure 16 ).

[0313] I) Purification using affinity chromatography (Ni-NTA)

[0314] After 6 days of culture, the transformed cell lines were centrifuged at 4800 rpm for 30 minutes to remove the supernatant. The affinity chromatography column (731-1553, Bio-rad) was washed with 10 mM imidazole wash buffer (pH 7.4) and packed with Ni-Sepharose™ 6Fast Flow beads (17-5318-02, GE Healthcare). The column was then washed twice with 10 mM imidazole wash buffer (pH 7.4). When approximately 2–3 mL of 10 mM imidazole wash buffer (pH 7.4) remained, the column was washed again with 20 mL of 10 mM imidazole wash buffer (pH 7.4). Culture medium was added to the washed column. The beads were washed with 10 mM imidazole wash buffer (pH 7.4) and eluted with 500 mM imidazole elution buffer (pH 7.4). 200 μL of Coomassie Plus™ Protein Assay Reagent (1856210, Thermoscientific) was mixed with 10 μL of sample and eluted until the solution did not turn blue. The eluted protein purification solution was concentrated using an Amicon® Ultra centrifuge (UFC901096, Millipore), and the concentration process was repeated twice with PBS solution for taurine exchange. Protein concentration was measured using nano-drops and diluted to 0.3–0.5 mg / mL. SDS-PAGE confirmed the concentration of each protein in 3 μg samples. Figure 17 ).

[0315] Furthermore, the concentrations and productivity of eight hTrx1 mutant proteins were analyzed and are shown in Table 17 below. Table 17 shows that the eight hTrx1 mutant proteins can be expressed at concentrations ranging from 3.15 to 5.31 mg / mL.

[0316] Table 17

[0317]

[0318] Example 16

[0319] Enzyme-linked immunosorbent assay (ELISA) was performed to confirm binding affinity.

[0320] In the embodiments, the binding affinity of each B266-1 and B264 antibody was confirmed for the eight hTrx1 mutant proteins prepared in Example 15 above.

[0321] Eight hTrx1 mutant proteins prepared in Example 3 were dissolved in spreading buffer (DPBS; LB001-02, Welgene) at a concentration of 2 μg / mL to prepare antigen solutions. 100 μL of the antigen solution was injected into each well of a 96-well plate, and the plate was sealed with tape and incubated at 4°C for at least 16 hours. After removing the antigen solutions, 200 μL of isolation buffer (1xPBS w / 4% skim milk) was injected into each well, the plate was sealed, and the plate was incubated at 37°C for 1 hour. After the reaction, the isolation buffer was removed, and 100 μL of antibody solution diluted to the specified concentration was injected into each well, the plate was sealed, and the plate was incubated at 37°C for 2 hours. The antibody solutions were then removed, and this process of processing and discarding 200 μL of wash buffer (1xPBST) solution in each well was repeated five times. After diluting the HRP-binding antibodies (anti-human Fc-HRP against B266 and anti-mouse Fc-HRP against B264) 1:4000 in antibody dilution solution (1xPBSw / 1% skim milk), 100 μL was injected into each well, the plate was sealed with a sealing tape, and the reaction was carried out at 37°C for 2 hours. The antibody solution was removed, and this process of treating and discarding each well with 200 μL of wash buffer (1xPBST) was repeated 5 times. For the chromogenic reagent [one OPD tablet, 10 mL PC buffer (5.1 g C6H8O7·H2O and 7.3 g Na2HPO4 per L), 10 μL of H2O2 was added, and 100 μL was injected into each well, and the reaction was carried out in the dark for 10 minutes. Each well was treated with 50 μL of stop buffer (2.5 M H2SO4), and the OD at 490 nm was measured.

[0322] As shown in Figure 18A, the binding ability between the mutant proteins (YSNVIFGNMV) in the M4 region of the B266-1 (hTrx1-hIgG1) antibody was reduced, as was the binding ability between the mutant proteins (M1: QIESKTAEIEGKED, M2: QEALDAHAALSS, and M3: YSNVIFGNMV) in the M1, M2, and M4 regions of the B264 (hTrx1-mIgG1) antibody.

[0323] Tables 18 and 19 below show the original amino acid and base sequences of the mutation sites M1, M2, and M4 in hTrx1, respectively.

[0324] Table 18

[0325] M1 QIEGSTA Sequence 32 M2 QEALDA Sequence 33 M4 YSNVI Sequence 34

[0326] Table 19

[0327] M1 CAGATCGAATCAAAAACCGCA Sequence 35 M2 CAAGAAGCCCTGGACGCC Sequence 36 M4 TACAGTAACGTTATC Sequence 37

[0328] The above results confirm that the B266-1 antibody and the B264 antibody are likely to share the M4 portion (YSNVI) in the antigen binding site.

[0329] Example 17

[0330] Antibody profiling using peptide microarrays

[0331] In the examples, antibodies B266-1 and B264 were used to confirm a more accurate amino acid sequence through epitope mapping analysis of the Trx1 antigen. Specifically, PepStar™ peptide microarray technology from JPT Peptide Technologies, Germany, was utilized. Figure 19 As shown, epitopes were detected by overlapping peptide scan.

[0332] 17-1. Sequence

[0333] Antibody analysis was performed using a peptide library consisting of 108 peptides. The complete list of peptides is shown in Tables 20 to 22 below. At this time, sequences 64 to 81 of Peptide_001 to Peptide_018 are non-natural and include recombinant insertion regions. The known amino acid sequences of the hTrx1 protein are referenced from GenBank Accession No. AAF87085.1.

[0334] Table 20

[0335] peptides immobilized in microarrays

[0336]

[0337]

[0338] Table 21

[0339] Peptides immobilized in microarrays

[0340]

[0341]

[0342] Table 22

[0343] Peptides immobilized in microarrays

[0344] 140 DDCQDVASECEVKCM Peptide_077 141 DCQDVASECEVKCMP Peptide_078 142 CQDVASECEVKCMPT Peptide_079 143 QDVASECEVKCMPTF Peptide_080 144 DVASECEVKCMPTFQ Peptide_081 145 VASECEVKCMPTFQF Peptide_082 146 ASECEVKCMPTFQFF Peptide_083 147 SECEVKCMPTFQFFK Peptide_084 148 ECEVKCMPTFQFFKK Peptide_085 149 CEVKCMPTFQFFKKG Peptide_086 150 EVKCMPTFQFFKKGQ Peptide_087 151 VKCMPTFQFFKKGQK Peptide_088 152 KCMPTFQFFKKGQKV Peptide_089 153 CMPTFQFFKKGQKVG Peptide_090 154 MPTFQFFKKGQKVGE Peptide_091 155 PTFQFFKKGQKVGEF Peptide_092 156 TFQFFKKGQKVGEFS Peptide_093 157 FQFFKKGQKVGEFSG Peptide_094 158 QFFKKGQKVGEFSGA Peptide_095 159 FFKKGQKVGEFSGAN Peptide_096 160 FKKGQKVGEFSGANK Peptide_097 161 KKGQKVGEFSGANKE Peptide_098 162 KGQKVGEFSGANKEK Peptide_099 163 GQKVGEFSGANKEKL Peptide_100 164 QKVGEFSGANKEKLE Peptide_101 165 KVGEFSGANKEKLEA Peptide_102 166 VGEFSGANKEKLEAT Peptide_103 167 GEFSGANKEKLEATI Peptide_104 168 EFSGANKEKLEATIN Peptide_105 169 FSGANKEKLEATINE Peptide_106 170 SGANKEKLEATINEL Peptide_107 171 GANKEKLEATINELV Peptide_108

[0345] Full-length mouse IgG was co-immobilized on a microarray slide as a control group for assays, and the additional sequence was included in a peptide library via JPT as an internal process control group.

[0346] 17-2. Measurement conditions

[0347] The analytical experiments utilized two antibody samples (B266-1 and B264) diluted in isolation buffer (Pierce International, Superblock TBST20, order #37536). Serial dilutions of 5, 1, 0.2, 0.04, 0.008, and 0.0016 μg / ml were incubated for 1 hour at 30°C on a single multi-well microarray slide. The slide comprised 21 individual microarrays (one microarray per sample dilution).

[0348] After culturing the samples, 1 μg / ml of fluorescently labeled anti-mouse IgG secondary antibody (anti-mouse IgG(H+L)(Thermo 84545)) was added to the corresponding wells, and the reaction was carried out for 1 hour. Labeling was performed using a DyLight 650. An alternative control culture was performed on the same microarray slide using only the secondary antibody to assess false-positive binding to the peptide. The microarray was washed with washing buffer before each step.

[0349] After washing and drying, the slides were scanned using a 635nm high-resolution laser scanner (Axon Genepix Scanner 4300SL50) to obtain fluorescence intensity distribution maps. The obtained images were then used with GenePix, the spot recognition software, to quantify the average pixel value of each peptide. For each spot, the average signal intensity (luminescent units between 0 and 65535) was extracted.

[0350] 17-3. Processed Array Images

[0351] An exemplary fluorescence reading image of a microarray co-cultured with one of the antibody samples is shown in Figure 20 Medium. Low background levels were observed for all samples. Black indicates no signal, red shading increases the intensity of detected signals, white indicates detector saturation, and each individual subarray is outlined in green.

[0352] 17-4. Heatmap Evaluation

[0353] To visualize the results and compare the binding regions in different cultures, such as Figures 21a to 21d As shown, the heatmap was calculated. Figures 21a to 21dIn the results, fluorescence intensity is represented in a color-coded manner, with white indicating no binding and red indicating strong binding. For all evaluations, the MMC2- value of the average pixel fluorescence for each peptide was calculated.

[0354] Except for cases where the coefficient of variation (CV) of the standard deviation divided by the mean is greater than 0.5, MMC2 has the same mean as all three cases on the microarray. In this case, the mean of the two closest values ​​(MC2) is assigned to MMC2. The thick black line on the heatmap is used to distinguish the control group culture using only anti-mouse IgG secondary antibody. The culture of individual antibody samples is distinguished by a thin blue line.

[0355] For antibody B266-1, as shown in Table 23, the highest signal was measured to be approximately 8 times the average signal level for peptides (sequences 67 and 68) of Peptide_004 and Peptide_005. However, peptides Peptide_004 and Peptide_005 are not native and were therefore excluded from the epitope candidate group.

[0356] Table 23

[0357]

[0358] Antibody B264 exhibited fairly strong interactions with several peptides, as well as concentration-dependent signal plots. Particularly at the two highest culture sample concentrations, the peptides listed in Table 24 below yielded the most significant binding.

[0359] As shown in Table 24, the highest signals measured for the peptides (sequences 75 and 81) of Peptide_012 and Peptide_018 were approximately 7 times the average background level. However, the peptides of Peptide_012 and Peptide_018 are not native and were therefore excluded from the epitope candidate group.

[0360] Peptides 82 to 88, corresponding to peptides Peptide_019 to Peptide_025 that showed the second strongest signals, were expected to be the binding sites for antibody B264. Ultimately, 'VKQIESKTAFQEALDAAGDKL' (sequence 179) was deduced to be the epitope of antibody B264.

[0361] Peptides 109 to 120, corresponding to peptides Peptide_046 to Peptide_057 that showed the second strongest signals, were expected to be the binding sites for antibody B264, and it has been confirmed that they have the same epitopes as the binding sites for B266-1.

[0362] Table 24

[0363]

[0364] No significant binding was detected in the secondary antibody control group culture. High signal levels, reaching saturation levels, were obtained in the control group spots containing full-length mouse IgG in all cultures, demonstrating excellent analytical performance.

[0365] The epitope sites derived through the above process are shown in Table 25 below. The recognized hTrx1 NMR sequence was downloaded from a protein database (PDB), and the tertiary structure was confirmed through 3D archiving. The results are as follows: Figures 22a to 22f As shown, when in the natural form, these sequences exist externally and can therefore act as epitopes.

[0366] Table 25

[0367]

[0368] Industrial availability

[0369] The monoclonal antibody of this invention binds effectively and specifically to thioredoxin 1 due to its excellent binding affinity, and its high sensitivity and specificity make it useful for screening breast cancer patients. Furthermore, compared to detecting CA15-3, another existing biomarker for breast cancer diagnosis, the method of detecting thioredoxin 1 using the monoclonal antibody of this invention, which specifically binds to thioredoxin 1, exhibits significantly superior sensitivity and specificity, thus significantly improving the accuracy and reliability of breast cancer diagnosis. The epitope site of the human Trx1 antigen bound by the antibody of this invention can be effectively utilized in the development of modified antibodies to improve the binding affinity of anti-Trx1 antibodies.

Claims

1. A monoclonal antibody or its antigen-binding fragment that specifically binds to thioredoxin 1, characterized in that, Include: The light chain variable region comprises light chain CDR1 formed by the amino acid sequence of sequence 7, light chain CDR2 formed by the amino acid sequence of sequence 8, and light chain CDR3 formed by the amino acid sequence of sequence 9; and The heavy chain variable region comprises heavy chain CDR1 formed by the amino acid sequence of sequence 10, heavy chain CDR2 formed by the amino acid sequence of sequence 11, and heavy chain CDR3 formed by the amino acid sequence of sequence 12.

2. The monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody described above contains a light chain variable region formed by the amino acid sequence of sequence 15 and a heavy chain variable region formed by the amino acid sequence of sequence 16.

3. The monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody described above comprises a light chain formed by the amino acid sequence of sequence 19 and a heavy chain formed by the amino acid sequence of sequence 20.

4. The monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody described above comprises a light chain formed by the amino acid sequence of sequence 25 and a heavy chain formed by the amino acid sequence of sequence 26.

5. The monoclonal antibody or its antigen-binding fragment according to any one of claims 1 to 4, characterized in that, The antibodies mentioned above contain the IgG1 heavy chain and the κ light chain.

6. The monoclonal antibody or its antigen-binding fragment according to any one of claims 1 to 4, characterized in that, The antigen-binding fragments mentioned above are Fab, F(ab'), F(ab')2, Fv, or single-chain antibody molecules.

7. The monoclonal antibody or its antigen-binding fragment according to any one of claims 1 to 4, characterized in that, The antibodies mentioned above are chimeric antibodies or humanized antibodies.

8. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the light and heavy chains of the monoclonal antibody or its antigen-binding fragment according to claim 1.

9. The nucleic acid molecule according to claim 8, characterized in that, The aforementioned nucleic acid molecule encoding the light chain is formed from the nucleotide sequence of sequence 23 or 27.

10. The nucleic acid molecule according to claim 8, characterized in that, The above-mentioned nucleic acid molecules encoding the heavy chain are formed from nucleotide sequences of sequence 24 or 28.

11. A recombinant vector, characterized in that, It includes the nucleic acid molecule according to claim 8.

12. A host cell, characterized in that, It includes the recombinant vector according to claim 11.

13. A method for preparing a monoclonal antibody or antigen-binding fragment thereof that specifically binds to thioredoxin 1, characterized in that, This includes culturing the host cells as described in claim 12.

14. A breast cancer diagnostic kit, characterized in that, It contains a monoclonal antibody or its antigen-binding fragment according to any one of claims 1 to 4.

15. The breast cancer diagnostic kit according to claim 14, characterized in that, The above kit is an enzyme-linked immunosorbent assay (ELISA) kit.

16. The breast cancer diagnostic kit according to claim 15, characterized in that, The enzyme-linked immunosorbent assay (ELISA) described above is selected from one or more of the groups consisting of direct ELISA and indirect ELISA.

17. The breast cancer diagnostic kit according to claim 16, characterized in that, The direct enzyme-linked immunosorbent assay (ELISA) is a direct sandwich ELISA, and the indirect ELISA is an indirect sandwich ELISA.

18. Use of the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 4 in the preparation of a kit for diagnosing breast cancer.

19. The use according to claim 18, characterized in that, The above kit is an enzyme-linked immunosorbent assay (ELISA) kit.

20. The use according to claim 19, characterized in that, The enzyme-linked immunosorbent assay (ELISA) described above is selected from one or more of the groups consisting of direct ELISA and indirect ELISA.

21. The use according to claim 20, characterized in that, The direct enzyme-linked immunosorbent assay (ELISA) is a direct sandwich ELISA, and the indirect ELISA is an indirect sandwich ELISA.

Images