Citrobacter amalonaticus and phenol whole-cell biosensor thereof and application
Patent Information
- Application Number
- CN202211226178.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-30
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2042-09-30
AI Technical Summary
[0007]滴定法和分光光度法是现有的常规苯酚检测方法,然而在检测过程中需要的试剂品种较多,过程繁琐,且在分光光度法检测时,用以萃取的三氯甲烷对环境存在一定的毒害作用
[0037] This invention constructs a whole-cell biosensor for detecting phenol concentration. The bacteria used are isolated from the intestines of healthy C57 mice, are non-toxic to the environment, and are simple to operate with no specific training or reagent preparation required before the assay. It can specifically detect the phenol content of the sample, with high sensitivity, a concentration range of 10 nmol/L to 0.1 mmol/L, and a detection limit of only 0.1 nmol/L. Furthermore, it does not require the addition of other expensive reagents, such as luciferin.
Smart Images

Figure CN116769632B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology and relates to a malondioxanil-free Citrobacterium and its application in detecting phenol concentration. Specifically, it relates to the application of this bacterium in constructing a whole-cell biosensor for detecting phenol concentration, including a whole-cell biosensor for phenol and its construction method, and a method for detecting phenol concentration. Background Technology
[0002] Phenol is widely used in the chemical industry to produce a large number of industrial products such as pharmaceuticals, pesticides, and plastics, and is one of the most widely used intermediates in the chemical industry. In environmental science, phenol is considered a priority pollutant with wide sources, large quantities, and significant hazards. In medicine, phenol exceeding a certain dose is a toxic pollutant to organisms, and phenol exposure in the environment is easily ingested by organisms through routes including but not limited to skin, respiratory tract, and digestive tract, causing a range of chronic or acute toxic symptoms, including corrosion, central nervous system damage, and kidney damage.
[0003] Existing methods for detecting phenol are generally classified into three types: titration, spectrophotometry, and chromatography.
[0004] The titration method is as follows: Phenol is reacted with excess bromine to produce tribromophenol. After the reaction, the remaining bromine is reacted with potassium iodide to produce iodine. The iodine is titrated with a standard sodium thiosulfate solution to obtain an absolute quantification of the iodine. Finally, the amount of phenol consumed in the reaction is deduced.
[0005] Spectrophotometry is the standard detection method for determining the residual amount of volatile phenols in aquatic products according to national food safety standards. The most commonly used method is the 4-aminotipyrine spectrophotometric method. The principle of the determination is as follows: After the phenolic compound is absorbed in an alkaline solution, it reacts with 4-aminotipyrine in the presence of an oxidant to generate a red antipyrine dye. The color intensity is determined by spectrophotometry, and a standard curve is plotted based on the phenolic solution at a standard concentration, thereby allowing for the quantitative detection of phenolic compounds in the sample.
[0006] The most commonly used chromatographic methods are gas chromatography and liquid chromatography. This method involves the quantitative detection of phenol in a sample at a wavelength of 270 nm.
[0007] Titration and spectrophotometry are existing conventional methods for phenol detection. However, they require a large variety of reagents, are cumbersome, and the chloroform used for extraction in spectrophotometric detection is environmentally toxic. Liquid chromatography (LC) offers high precision, but the instruments themselves are expensive and have stringent requirements regarding space and environmental conditions. Furthermore, operators of LC systems require specialized training, resulting in significant training costs. Summary of the Invention
[0008] The purpose of this invention is to provide a method for detecting phenol concentration, including the construction of a whole-cell biosensor for detecting phenol concentration and its construction method, and its application in detecting phenol concentration, including a malondialdehyde-free Citrobacter. This bacterium was isolated from the intestine of healthy C57BL / 6 mice, has no toxic effects on the environment, and exhibits excellent response to phenol. It was deposited at the China Center for Type Culture Collection (CCTCC) on July 11, 2022, with accession number CCTCC M20221071.
[0009] The technical solution of the present invention is as follows:
[0010] This invention discloses a malondiol-free Citrobacter amalonaticus PS01, which was deposited at the China Center for Type Culture Collection (CCTCC) on July 11, 2022, with accession number CCTCC M 20221071.
[0011] The present invention also discloses the application of the aforementioned malondioxycholic acid-free citrate bacillus in the detection of phenol concentration.
[0012] The present invention also discloses the application of the aforementioned malondialdehyde-free Citrobacter in constructing a whole-cell biosensor for detecting phenol concentration.
[0013] The present invention also discloses a method for constructing a whole-cell biosensor for detecting phenol concentration, which involves transfecting the malonic acid-free Citrobacter PS01 with the plasmid pCM-DmpR-lux.
[0014] The gene of the plasmid pCM-DmpR-lux is shown in SEQ ID No. 1.
[0015] This invention also discloses a method for constructing the whole-cell biosensor, comprising the following steps:
[0016] (1) Construction of pCM-lux vector
[0017] The lux reporter gene was ligated into the pCMgfp-lacZ plasmid using homologous recombination to construct the pCM-lux vector.
[0018] (2) Construction of pCM-DmpR-lux vector
[0019] The DmpR gene and Po promoter from the Dmp family of gene clusters encoding phenol hydroxylase in strain CF600 were linked into pCM-lux using homologous recombination to construct the pCM-DmpR-lux vector.
[0020] (3) After the constructed pCM-DmpR-lux vector is sequenced and confirmed, it is transferred into the malondiol-free Citrobacter PS01 as described in claim 1, thus completing the construction of the whole-cell biosensor.
[0021] The method for constructing the whole-cell biosensor, in step (1) of amplifying the lux CDABE reporter gene, uses the following primers:
[0022] Forward amplification primers:
[0023] cagaaagcatgccggggatcc CTCGAGCTGCAGACTAGTAGGCTTGGAGGATACGTATGAC,
[0024] Reverse amplification primers: cgtaatcatggtcatggatc TCAACTATCAAACGCTTCGGTTAA;
[0025] In this context, the lowercase underlined letters represent the homologous arm sequences on the vector.
[0026] The method for constructing the whole-cell biosensor, step (2) of which involves constructing the primers for pCM-DmpR-lux, is as follows:
[0027] DmpR-lux s 5: 'CAGAAAGCATGCCGGGGATCCCtagccttcgatgccgatttt 3';
[0028] DmpR lux a 5:'AGTCTGCAGCTCGAGGGATCCtgcgcacacggatgtaacg 3' where the uppercase letters are homologous arm sequences on the vector.
[0029] This invention also discloses a method for detecting phenol concentration using the whole-cell biosensor, comprising the following steps:
[0030] (1) Using the relative luminescence intensity of the whole-cell biosensor bacterial solution described in claim 5 after adding it to a phenol solution diluted with known concentration gradients, a standard curve between phenol concentration and relative luminescence intensity is plotted.
[0031] (2) Add the sample to be tested to the whole-cell biosensor bacterial solution with the same OD value as in step (1), read the relative luminescence intensity of the sample, and determine whether the sample contains phenol or calculate the concentration of phenol in the sample based on the relative luminescence intensity.
[0032] The method for detecting phenol concentration using the whole-cell biosensor includes the following steps:
[0033] (1) Mix 100 μl of the whole-cell biosensor bacterial culture with an OD value of 0.4-0.5 with 100 μl of serially diluted phenol solution and sterile water in a 1:1 ratio and add it to a 96-well plate;
[0034] (2) Fix the 96-well plate in a shaker and incubate it at 37°C and 180 rpm for 2 hours, and read the relative luminescence intensity.
[0035] (3) Based on the relationship between different concentrations of phenol and relative luminescence intensity, a fitting plot is made to obtain the standard curve.
[0036] The beneficial technical effects of this invention are as follows:
[0037] This invention constructs a whole-cell biosensor for detecting phenol concentration. The bacteria used are isolated from the intestines of healthy C57 mice, are non-toxic to the environment, and are simple to operate with no specific training or reagent preparation required before the assay. It can specifically detect the phenol content of the sample, with high sensitivity, a concentration range of 10 nmol / L to 0.1 mmol / L, and a detection limit of only 0.1 nmol / L. Furthermore, it does not require the addition of other expensive reagents, such as luciferin.
[0038] PS01 strain is a facultative anaerobic bacterium. Although its optimal survival temperature is 37°C, it can also function at room temperature and has no specific requirements for the operating environment. Attached Figure Description
[0039] Figure 1 This is the plasmid map of plasmid pCM-DmpR-lux in Example 2 of the present invention;
[0040] Figure 2 The images show the response of the phenol whole-cell biosensor of Example 4 of the present invention to phenol and water at concentrations of 0.01 nmol / L to 10000 nmol / L in a completely dark room with an exposure time of 60 s.
[0041] Figure 3 The standard curve for the phenol whole-cell biosensor in Example 4 of this invention is plotted based on the analysis and fitting of phenol concentration and luminescence value.
[0042] Figure 4 This is a schematic diagram showing the response of the whole-cell phenol biosensor of Example 4 of the present invention to phenol concentrations ranging from 0.01 nmol / L to 10000 nmol / L;
[0043] Figure 5This is a schematic diagram showing the response of the phenol whole-cell biosensor of Example 5 of the present invention to concentrations of 0.01 nmol / L to 10000 nmol / L of p-cresol;
[0044] Figure 6 This is a schematic diagram showing the response of the whole-cell phenol biosensor of Example 5 of the present invention to concentrations of 0.01 nmol / L to 10000 nmol / L catechol;
[0045] Figure 7 This is a schematic diagram showing the response of the whole-cell phenol biosensor of Example 5 of the present invention to concentrations of 0.01 nmol / L to 10000 nmol / L 4-ethylphenol;
[0046] Figure 8 This is a schematic diagram showing the response of the Escherichia coli DH5α whole-cell biosensor of Example 6 of the present invention to phenol concentrations ranging from 0.01 nmol / L to 10000 nmol / L;
[0047] Figure 9 This is a schematic diagram illustrating the response of the Escherichia coli Nissle1917 whole-cell biosensor (Example 6 of this invention) to phenol concentrations ranging from 0.01 nmol / L to 10000 nmol / L. Detailed Implementation
[0048] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.
[0049] Numerous specific details are set forth in the following description to provide a full understanding of the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.
[0050] Example 1: Screening of PS01 strain
[0051] SPF-grade mice were dissected, and the contents of the mice's colon were placed in 100 mL of LB medium. The mixture was shaken at 37°C and 180 rpm for 2 hours. 50 μL of the liquid containing the mouse's intestinal contents was taken, diluted twice in a 10-fold serial order, and then evenly spread on LB solid medium using an inoculation stick.
[0052] The culture was carried out at 37℃ under aerobic conditions for 12 hours. After the colonies grew on the solid medium, a large number of single colonies were picked and sequenced using 16S sequencing to determine the species. The most abundant single colony was identified as *Citrobacter amalonaticus*, which was named PS01. It was deposited at the China Center for Type Culture Collection (CCTCC) on July 11, 2022, with accession number CCTCC M 20221071.
[0053] The PS01 strain grew successfully on LB medium. After streaking for 12 hours at 37°C under aerobic conditions, regular, round, white, translucent colonies were visible.
[0054] PS01 can be grown in M9 liquid basal medium with 20 mmol / L citric acid as the sole carbon source.
[0055] Prepare LB solid medium: Add 10g sodium chloride, 10g tryptone and 5g yeast extract to every liter of ultrapure water, and add 1.5g agar powder to every 100mL of liquid medium.
[0056] Prepare M9 medium: Add 12.8g disodium hydrogen phosphate heptahydrate, 3.0g dipotassium hydrogen phosphate, and 0.5g sodium chloride to every liter of ultrapure water. Prepare a 5x M9 stock solution with 1g ammonium chloride. To prepare a 1x M9 medium, mix 20ml of the M9 stock solution with 80ml of ultrapure water, 200μl of magnesium chloride, and 20μl of calcium chloride.
[0057] Example 2: Construction of plasmid pCM-DmpR-lux
[0058] According to existing literature [GUPTA S, SAXENA M, SAINI N, et al. An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein[J]. PLoS ONE, 2012, 7(8):e43527.], strain CF600 contains the Dmp family of genes encoding phenol hydroxylase. Among them, the DmpR gene is an enhancer that can specifically respond to phenol and regulates a series of gene transcriptions starting from the Po promoter. The constructed plasmid pCM-DmpR-Lux utilizes the specific response mechanism of DmpR to phenol by linking the lux CDABE reporter gene downstream of the Po promoter. DmpR-Lux serves as the main functional part of the sensor.
[0059] (1) Construction of pCM-lux vector
[0060] The lux CDABE reporter gene was ligated into the pCMgfp-lacZ plasmid using homologous recombination to construct the pCM-lux vector; pCMgfp-lacZ is a known plasmid that has been reported in the literature.
[0061] [Zhang WM, Zhang JJ, Jiang X, Chao HJ, Zhou NY. 2015. Transcriptional activation of multiple operons involved in para-nitrophenol degradation by Pseudomonas sp strain WBC-3. Appl Environ Microbiol 81:220-230.]; The primers used to amplify the lux reporter gene were:
[0062] Primers for forward amplification of the lux gene:
[0063] cagaaagcatgccggggatcc CTCGAGCTGCAGACTAGTAGGCTTGGAGGATACGTATGAC;
[0064] Primers for reverse amplification of the lux gene:
[0065] cgtaatcatggtcatggatc TCAACTATCAAACGCTTCGGTTAA;
[0066] In this context, lowercase underlined letters represent homologous arm sequences on the vector, while uppercase letters represent multiple cloning site sequences added via primers.
[0067] (2) Construction of pCM-DmpR-lux vector
[0068] The DmpR gene and Po promoter from the Dmp family of gene clusters encoding phenol hydroxylase in strain CF600 were linked into pCM-lux using homologous recombination to construct the pCM-DmpR-lux vector.
[0069] First, the DmpR (including the Po promoter) sequence, as shown in SEQ ID No. 2, was synthesized by Beijing Qingke Biotechnology Co., Ltd. The DmpR (including the Po promoter) sequence was then ligated into pCM-lux using homologous recombination to construct the pCM-DmpR-lux vector. The primers used for constructing pCM-DmpR-lux were:
[0070] DmpR lux s: 5'CAGAAAGCATGCCGGGGATCCCtagccttcgatgccgatttt 3';
[0071] DmpR lux a: 5'AGTCTGCAGCTCGAGGGATCCtgcgcacacggatgtaacg 3';
[0072] Among them, the uppercase sequence is the homologous arm sequence on the vector.
[0073] The plasmid map of plasmid pCM-DmpR-lux is as follows: Figure 1 As shown, its gene sequence is shown in SEQ ID No. 1. After confirmation by sequencing, the pCM-DmpR-lux plasmid was successfully constructed.
[0074] Example 3 Construction of a phenol whole-cell biosensor
[0075] PS01, which was frozen at -80°C in 25% glycerol liquid, was streaked onto antibiotic-free LB solid medium for revival and then incubated upside down at 37°C under aerobic conditions for 12 hours.
[0076] After colonies have grown, pick a single colony and place it in 5 ml of antibiotic-free liquid LB medium. Incubate overnight in a shaker at 37°C and 180 rpm until the OD value reaches between 0.4 and 0.5.
[0077] Inoculate the bacterial culture at a ratio of 1:100 into 100 ml of antibiotic-free liquid LB medium and incubate overnight in a shaker at 37°C and 180 rpm until the OD value reaches between 0.4 and 0.5.
[0078] Pre-cool the bacterial culture on ice for 30 minutes, then centrifuge it at 4°C and 4000 rpm for 10 minutes, and completely discard the supernatant.
[0079] The bacterial resuspended in 1 ml of pre-cooled, sterile 1 mol / L calcium chloride solution and centrifuged at 4°C and 4000 rpm for 10 minutes.
[0080] Discard the supernatant and repeat the above steps once.
[0081] Discard the supernatant. Resuspend each 50 ml initial bacterial culture in 2 ml of a solution containing 15% calcium chloride and 25% glycerol. Aliquot the solution into 1.5 ml EP tubes, dispensing 100 μl into each tube and storing at -80°C for later use.
[0082] Take 10 μl of pCM-DmpR-Lux plasmid and add it to 100 μl of the above PS01 heat-competent bacteria on ice. After gently mixing, incubate on ice for 30 minutes.
[0083] The mixture of plasmid and competent cells was placed on a 42°C metal bath and heat-shocked for 90 seconds. After heat shock, it was transferred to ice and incubated for 2 minutes. Then, 600 μl of antibiotic-free LB medium was added, and the mixture was incubated at 37°C and 180 rpm for 1 hour.
[0084] Spread 100 μl of bacterial culture onto solid LB medium containing tetracycline resistance and incubate overnight at 37°C.
[0085] Single colonies from solid culture medium were picked and placed in liquid culture medium with tetracycline resistance. The culture was carried out at 37°C and 180 rpm for 12 hours to complete the construction of the phenol whole-cell biosensor.
[0086] Example 4: Detection of phenol concentration using a whole-cell phenol biosensor
[0087] (1) Draw the standard curve
[0088] A standard curve was plotted between phenol concentration and relative luminescence intensity by adding whole-cell biosensor bacterial culture to phenol solutions diluted with known concentration gradients.
[0089] Experimental group: 100 μl of PS01 bacterial suspension with OD between 0.4 and 0.5 was mixed with 100 μl of serially diluted phenol solution at a ratio of 1:1 and added to a 96-well plate. Each concentration gradient was repeated three times. 100 μl of PS01 bacterial suspension with OD between 0.4 and 0.5 was mixed with 100 μl of sterile water. This was also repeated three times.
[0090] The 96-well plate was fixed in a shaker and incubated for 2 hours at 37°C and 180 rpm.
[0091] Under completely dark conditions, a 96-well plate containing a 1:1 mixture of bacterial culture and biological solution was photographed using a 60-second exposure. Figure 2 As shown.
[0092] The BioTek Synergy H1 laboratory automation workstation was used to take luminescence and OD600 readings of 96-well plates, and a standard curve was plotted using the readings of the serially diluted phenol solutions.
[0093] The data was fitted using OriginLab, and the resulting fitted curves are shown in Table 1. The standard curve is shown in Table 2. Figure 3 As shown:
[0094] Table 1
[0095]
[0096] (2) Add the sample to be tested to the whole-cell biosensor bacterial solution with the same OD value as in step (1), read the relative luminescence intensity of the sample, and determine whether the sample contains phenol or calculate the phenol concentration in the sample based on the relative luminescence intensity. For concentrations from 0.01 nmol / L to 10 μmol / L...
[0097] The response of phenol within the concentration range of (10000 nmol / L) is as follows: Figure 4 As shown.
[0098] Example 5: Whole-cell phenol biosensor for detecting phenol structural analogs
[0099] The specificity of the phenol whole-cell biosensor was validated by mixing it with phenol structural analogs (p-cresol, catechol, 4-ethylphenol) in a 1:1 ratio (100 μl: 100 μl).
[0100] 100 μl of PS01 bacterial suspension with an OD between 0.4 and 0.5 was mixed with 100 μl of serially diluted p-cresol, catechol, and 4-ethylphenol solutions at a ratio of 1:1 and added to a 96-well plate. Each concentration gradient was repeated three times. 100 μl of PS01 bacterial suspension with an OD between 0.4 and 0.5 was mixed with 100 μl of sterile water, and this was also repeated three times.
[0101] The 96-well plate was fixed in a shaker and incubated for 2 hours at 37°C and 180 rpm.
[0102] Illumination readings were performed on a 96-well plate using a BioTek Synergy H1 laboratory automation workstation.
[0103] The response of the whole-cell phenol biosensor to cresol at concentrations ranging from 0.01 nmol / L to 10 μmol / L (10000 nmol / L) is as follows: Figure 5 As shown;
[0104] The response of the whole-cell phenol biosensor to catechol concentrations ranging from 0.01 nmol / L to 10 μmol / L (10000 nmol / L) is as follows: Figure 6 As shown;
[0105] The response of the whole-cell phenol biosensor to concentrations of 4-ethylphenol ranging from 0.01 nmol / L to 10 μmol / L (10000 nmol / L) is as follows: Figure 7 As shown;
[0106] Testing revealed that this whole-cell phenol biosensor has low sensitivity to phenol structural analogs, and its detection limits for these three phenol structural analogs are all higher than those for phenol.
[0107] Example 6
[0108] The pCM-DmpR-lux plasmid was transformed into competent Escherichia coli DH5α cells and probiotic Escherichia coli Nissle1917 via heat shock. The resulting strains carrying pCM-DmpR-lux were also added to serially diluted phenol solutions at a 1:1 volume ratio. The luminescence readings were recorded and processed using a BioTek SynergyH1 laboratory automation workstation and compared with those of the PS01 strain.
[0109] The response of the Escherichia coli DH5α whole-cell biosensor to phenol concentrations ranging from 0.01 nmol / L to 10 μmol / L (10000 nmol / L) is as follows: Figure 8 As shown.
[0110] The response of the whole-cell biosensor of the probiotic Escherichia coli Nissle1917 to phenol concentrations ranging from 0.01 nmol / L to 10 μmol / L (10000 nmol / L) is as follows: Figure 9 As shown.
[0111] The detection limits of the whole-cell biosensor for Escherichia coli DH5α were 1 nmol / L, and those of the whole-cell biosensor for the probiotic Escherichia coli Nissle1917 were 100 nmol / L. Both were higher than those of the PS01 strain of this invention, indicating that the PS01 strain has a better response to phenol than both Escherichia coli DH5α and Escherichia coli Nissle1917.
[0112] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.
Claims
1. A citrate-free bacterium (Citrobacterium malonicum) Citrobacter amalonaticus The application of PS01 in constructing a whole-cell biosensor for detecting phenol concentration is characterized by, The aforementioned malondiol-free Citrobacter was deposited at the China Center for Type Culture Collection (CCTCC) on July 11, 2022, with accession number CCTCC M 20221071; The whole-cell biosensor is formed by transfecting plasmid pCM-DmpR-lux into the malonic acid-free Citrobacter PS01, and the gene of plasmid pCM-DmpR-lux is shown in SEQ ID No.
1.
2. The method for constructing the whole-cell biosensor according to claim 1, characterized in that, Includes the following steps: (1) Constructing the pCM-lux vector The lux reporter gene was ligated into the pCMgfp-lacZ plasmid using homologous recombination to construct the pCM-lux vector. (2) Constructing the pCM-DmpR-lux vector The DmpR gene encoding phenol hydroxylase from strain CF600 and the Po promoter were linked into pCM-lux using homologous recombination to construct the pCM-DmpR-lux vector. (3) After the constructed pCM-DmpR-lux vector is confirmed by sequencing, it is transferred into the malondiol-free Citrobacter PS01 to complete the construction of the whole-cell biosensor.
3. The method for constructing a whole-cell biosensor according to claim 2, characterized in that, The primers used in step (1) to amplify the luxCDABE reporter gene are: Forward amplification primers: cagaaagcatgccggggatcc CTCGAGCTGCAGACTAGTAGGCTTGGAGGATACGTATGAC, Reverse amplification primers: cgtaatcatggtcatggatc TCAACTATCAAACGCTTCGGTTAA; In this context, the lowercase underlined letters represent the homologous arm sequences on the vector.
4. The method for constructing a whole-cell biosensor according to claim 2, characterized in that, Step (2) The primers for constructing pCM-DmpR-lux are: DmpR-lux s: CAGAAAGCATGCCGGGGATCCCtagccttcgatgccgatttt; DmpR-lux a: AGTCTGCAGCTCGAGGGATCCtgcgcacacggatgtaacg,where the uppercase letters are homologous arm sequences on the vector.
5. A method for detecting phenol concentration using the whole-cell biosensor according to claim 1, characterized in that, Includes the following steps: (1) Using the relative luminescence intensity of the whole-cell biosensor bacterial solution described in claim 1 after adding it to a phenol solution diluted with known concentration gradients, a standard curve between phenol concentration and relative luminescence intensity is plotted. (2) Add the sample to be tested to the whole-cell biosensor bacterial solution with the same OD value as in step (1), read the relative luminescence intensity of the sample, and determine whether the sample contains phenol or calculate the concentration of phenol in the sample based on the relative luminescence intensity.
6. The method for detecting phenol concentration using a whole-cell biosensor according to claim 5, characterized in that, Includes the following steps: (1) Mix 100 μl of the whole-cell biosensor bacterial culture with an OD value of 0.4-0.5 with 100 μl of serially diluted phenol solution and sterile water in a 1:1 ratio and add the mixture to a 96-well plate. (2) Fix the 96-well plate in a shaker and incubate it at 37°C and 180 rpm for 2 hours, and read the relative luminescence intensity; (3) Based on the relationship between different concentrations of phenol and relative luminescence intensity, a fitting plot is made to obtain the standard curve.