Targeted gene amplification primers, high-throughput targeted sequencing library and preparation method thereof

Abstract

The application discloses a targeted gene amplification primer, a high-throughput targeted sequencing library and a preparation method thereof. The targeted gene amplification primer comprises, from 5' end to 3' end, a specific recognition site of a type II restriction endonuclease and a specific primer sequence designed according to a target gene site. The preparation method of the high-throughput targeted sequencing library comprises the following steps: designing a primer sequence containing a specific recognition site of a type II restriction endonuclease, performing targeted amplification on a target site, and then removing non-specific dimer primers by using a restriction endonuclease, so that the existence of non-specific dimer sequences is effectively reduced, the quality of the sequencing library is improved, sequencing errors are reduced, the proportion of effective sequencing information acquisition is increased, the depth of targeted gene sequencing is improved, and disease screening is more accurate.

Description

Technical Field

[0001] This invention relates to a method for preparing a sequencing library, and more particularly to a targeted gene amplification primer, a high-throughput targeted sequencing library, and their preparation method and application, belonging to the field of biodetection technology. Background Technology

[0002] Driven by precision medicine, targeted sequencing has been gradually promoted. Targeted sequencing can obtain information related to specific diseases from the whole genome sequence, which further reduces the ineffective cost of NGS sequencing and enhances the sequencing depth of the target sequence. However, the sequence length for commonly used sequencing platforms is fixed. In the complex library preparation process, especially during targeted amplification, the addition of one or more primers can lead to the generation of many non-specific dimer sequences. These non-specific dimers not only increase the ineffective cost of sequencing but also significantly reduce the proportion of effective genomic information obtained. Summary of the Invention

[0003] The main objective of this invention is to provide a targeted gene amplification primer containing a type II restriction endonuclease-specific recognition site to overcome the shortcomings of the prior art.

[0004] Another objective of this invention is to provide a high-throughput targeted sequencing library and a method for preparing the same.

[0005] To achieve the aforementioned objectives, the technical solution adopted by this invention includes:

[0006] This invention provides a targeted gene amplification primer, which includes a type II restriction endonuclease-specific recognition site and a specific primer sequence designed according to the target gene site, from the 5' end to the 3' end.

[0007] This invention also provides a method for preparing a high-throughput targeted sequencing library, comprising:

[0008] Provide the aforementioned primers for targeted gene amplification;

[0009] The target gene amplification primers were used to perform targeted amplification of the target gene locus.

[0010] Type II restriction endonucleases were used to cleave the primer portions of the nonspecific amplification products and the target products. The sticky ends of the cleaved products were then repaired into blunt ends, followed by magnetic bead purification.

[0011] Sequencing adapters were connected, and the high-throughput targeted sequencing library was obtained after purification with magnetic beads.

[0012] Furthermore, the cleavage site of the type II restriction endonuclease is located at a sequence position of not less than 10 bp outside the recognition site sequence.

[0013] This invention also provides a high-throughput targeted sequencing library obtained by the aforementioned method.

[0014] This invention also provides a sequencing method, which includes: preparing a high-throughput targeted sequencing library using the aforementioned method, followed by sequencing analysis.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] The method for preparing high-throughput targeted sequencing libraries provided by this invention designs primer sequences containing type II restriction endonuclease-specific recognition sites, amplifies the target sites, and then removes non-specific dimer primers using restriction endonucleases. This effectively reduces the presence of non-specific dimer sequences, thereby improving the quality of the sequencing library, reducing sequencing errors, and helping to increase the proportion of effective sequencing information obtained and the depth of targeted gene sequencing, making disease screening more accurate. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram illustrating the principle of a targeted high-throughput sequencing library preparation method in a typical embodiment of the present invention;

[0019] Figure 2 This is a graph showing the Agilent 4150 detection results after the final library purification in one embodiment of the present invention. Detailed Implementation

[0020] In view of the shortcomings of existing technologies, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention, which mainly provides a method for preparing high-throughput targeted sequencing libraries. This method can effectively reduce the presence of nonspecific dimer sequences, thereby improving the quality of sequencing libraries and reducing sequencing errors. The following will further explain the technical solution, its implementation process, and its principles.

[0021] One aspect of this invention provides a targeted gene amplification primer, which includes, from the 5' end to the 3' end, a type II restriction endonuclease-specific recognition site and a specific primer sequence designed according to the target gene site.

[0022] In some embodiments, the target gene includes any one of TP53, SOX2, NOTCH1, ZNF750, CCND1, etc.

[0023] In some embodiments, the type II restriction endonuclease includes any one of AcuI, BpmI, BpuEI, BsgI, BtgZI, etc., and the enzyme concentration is 5000 units / ml.

[0024] In some embodiments, the type II restriction endonuclease-specific recognition site consists of 6 bases.

[0025] In some embodiments, the sequence of the targeted gene amplification primers is designed as: 5'-NNNNNN(MMMM) n -3', NNNNNN is the specific recognition sequence for type II restriction endonucleases; (MMMM) n The amplification primer sequences designed for the target gene locus, with n ranging from 18bp to 25bp.

[0026] Furthermore, the specific sequences of the targeted gene amplification primers are designed based on the target gene locus. Under the premise that NNNNNN is determined, (MMMM) n It can be designed as a mixture of primers for amplifying one or more target gene loci, with a primer concentration of 4-7 μM, depending on the requirements.

[0027] When the type II restriction endonuclease is AcuI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:1 (CTGAAG) and SEQ ID NO:2 (GACTTC), respectively.

[0028] Furthermore, when the target gene is TP53, the sequences of the upstream and downstream primers are shown in SEQ ID NO:3 (CTGAAGACGACAGGGCTGGTTGC) and SEQ ID NO:4 (GACTTCATAGGGCACCACCACACTATG), respectively.

[0029] Furthermore, when the target gene is SOX2, the sequences of the upstream and downstream primers are shown in SEQ ID NO:5 (CTGAAGCGCCCGCATGTACAACAT) and SEQ ID NO:6 (GACTTCACCACACCATGAAGGCATTCA), respectively.

[0030] Furthermore, when the target gene is NOTCH1, the sequences of the upstream and downstream primers are shown in SEQ ID NO:7 (CTGAAGTGAGCACCCCTTCCTCAC) and SEQ ID NO:8 (GACTTCCGCGCCGTTTACTTGAAG), respectively.

[0031] Furthermore, when the target gene is ZNF750, the sequences of the upstream and downstream primers are shown in SEQ ID NO:9 (CTGAAGCCTTCCAGTCCGGACGAC) and SEQ ID NO:10 (GACTTCCCGAGAGATTGAGTGGAAGGTC), respectively.

[0032] Furthermore, when the target gene is CCND1, the sequences of the upstream and downstream primers are shown in SEQ ID NO:11 (CTGAAGTCTCAGGACTGCCTCCGG) and SEQ ID NO:12 (GACTTCGTCCCGCACGTCGGTG), respectively.

[0033] In some embodiments, when the type II restriction endonuclease is BpmI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:13 (CTGGAG) and SEQ ID NO:14 (GACCTC), respectively.

[0034] In some embodiments, when the type II restriction endonuclease is BpuEI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:15 (CTTGAG) and SEQ ID NO:16 (GAACTC), respectively.

[0035] In some embodiments, when the type II restriction endonuclease is BsgI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:17 (GTGCAG) and SEQ ID NO:18 (CACGTC), respectively.

[0036] In some embodiments, when the type II restriction endonuclease is BtgZI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:19 (GCGATG) and SEQ ID NO:20 (CGCTAC), respectively.

[0037] For example, the relevant candidate restriction endonucleases and their recognition sites in this invention are shown in Table 1.

[0038] AcuI <![CDATA[5'-CTGAAG N) 16 -3'3'-GACTTC(N) 14 -5']]> BpmI <![CDATA[5'-CTGGAG(N) 16 -3'3'-GACCTC(N) 14 -5']]> BpuEI <![CDATA[5'-CTTGAG(N) 16 -3'3'-GAACTC(N) 14 -5']]> BsgI <![CDATA[5'-GTGCAG(N) 16 -3'3'-CACGTC(N) 14 -5']]> BtgZI <![CDATA[5'-GCGATG(N) 10 -3'3'-CGCTAC(N) 14 -5']]>

[0039] Here, N mainly represents the primer sequence, which is mainly to cut the primer dimer from the 16th base from the 6th base, so that the primer dimer is cut into smaller pieces.

[0040] Another aspect of this invention provides a method for preparing a high-throughput targeted sequencing library, comprising:

[0041] Provide the aforementioned primers for targeted gene amplification;

[0042] The target gene amplification primers were used to perform targeted amplification of the target gene locus.

[0043] Type II restriction endonucleases were used to cleave the primer portions of the nonspecific amplification products and the target products. The sticky ends of the cleaved products were then repaired into blunt ends, followed by magnetic bead purification.

[0044] Sequencing adapters were connected, and the high-throughput targeted sequencing library was obtained after purification with magnetic beads.

[0045] In some embodiments, please refer to Figure 1 As shown, the method for preparing the high-throughput targeted sequencing library includes the following steps:

[0046] (1) Design and synthesize a primer sequence for targeted gene amplification containing a type II restriction endonuclease specific recognition site. (2) Use the targeted gene amplification primer to amplify the target gene site. (3) Use type II restriction endonuclease to cut the primer portion of the non-specific amplification product and the target product. Then repair the sticky ends of the cut product into blunt ends and purify it with magnetic beads. (4) Connect the sequencing adapter and obtain the target high-throughput targeted sequencing library after purification with magnetic beads.

[0047] In some specific embodiments, the present invention provides a method for preparing a high-throughput targeted sequencing library with low non-specific amplification products, comprising the following steps:

[0048] (1) Design upstream and downstream primer sequences containing type II restriction endonuclease-specific recognition sites for specific target gene sequences, with a total length not exceeding 25-30 bp; the target gene amplification primer sequence is designed as: 5'-NNNNNN(MMMM). n -3', NNNNNN represents the recognition sequence for restriction endonucleases; (MMMM) n Amplification primers designed for the target gene locus, with n ranging from 18bp to 25bp.

[0049] (2) Given that NNNNNN is certain, (MMMM) n It can be designed as a mixture of primers for amplifying one or more target gene loci, with a primer concentration of 90-120 μM, depending on the needs.

[0050] (3) Design sequencing adapters based on specific target sequences. The upstream primers are designed from the 5' end to the 3' end in the order of upstream cluster adapter sequence, upstream marker sequence, and upstream sequencing primer sequence; the downstream primers are designed from the 5' end to the 3' end in the order of downstream cluster adapter sequence, downstream marker sequence, and downstream sequencing primer sequence.

[0051] (4) Universal primers were designed. The upstream universal primer sequence from 5' to 3' is the upstream cluster adapter sequence, and the downstream universal primer sequence from 5' to 3' is the downstream cluster adapter sequence.

[0052] (5) The target target of the target gene amplification primer can be any one of gDNA, cDNA, cfDNA, FFPE DNA, PCR amplicons, etc.

[0053] (6) The target fragment is obtained by PCR amplification of the genome using specific primers containing the specific recognition site of type II restriction endonuclease. The amplified product is then digested with the type II restriction endonuclease, followed by end repair and phosphorylation of the fragment. Magnetic beads are used for fragment screening. Compared with traditional library preparation, this step can effectively reduce the generation of nonspecific dimers.

[0054] (7) Finally, the above products are connected to sequencing adapters, and then fragments are screened using magnetic beads and the results are detected by Agilent 4150.

[0055] In some embodiments, the targeted gene amplification primer sequence includes, from the 5' end to the 3' end, a type II restriction endonuclease recognition site and a specific primer sequence designed according to the target gene site.

[0056] In some embodiments, the cleavage site of the type II restriction endonuclease is located at a sequence position not less than 10 bp outside the recognition site sequence.

[0057] In some embodiments, the target amplification product sequence obtained by multiplex PCR amplification using a mixture of target gene amplification primers does not contain a type II restriction endonuclease recognition site sequence.

[0058] Furthermore, this invention uses a type II restriction endonuclease to cleave the primer sequence of the target amplification product, while reducing the primer dimer byproducts generated during the amplification process.

[0059] In this invention, there are no requirements for enzyme digestion; conventional enzyme digestion conditions are sufficient.

[0060] In some embodiments, the sequencing adapter includes a cluster adapter sequence, a marker sequence, and a sequencing primer sequence, wherein the upstream sequencing adapter primer sequence includes an upstream cluster adapter sequence, an upstream marker sequence, and an upstream sequencing primer sequence, and the downstream sequencing adapter primer sequence includes a downstream cluster adapter sequence, a downstream marker sequence, and a downstream sequencing primer sequence.

[0061] Further, the upstream cluster adapter sequence is shown in SEQ ID NO:21 (CGACCACCGAGATCTACAC), the upstream marker sequence is shown in SEQ ID NO:22 (TAGATCGC), the upstream sequencing primer sequence is shown in SEQ ID NO:23 (TCGTCGGCAGCGTC), and the upstream sequencing adapter primer sequence is shown in SEQ ID NO:24 (CGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC).

[0062] Furthermore, the downstream cluster adapter sequence is shown in SEQ ID NO:25 (CGGCATACGAGAT), the downstream marker sequence is shown in SEQ ID NO:26 (TCGCCTTA), the downstream sequencing primer sequence is shown in SEQ ID NO:27 (GTCTCGTGGGCTCGGCATC), and the downstream sequencing adapter primer sequence is shown in SEQ ID NO:28 (CGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGCATC).

[0063] Another aspect of this invention provides a high-throughput targeted sequencing library obtained by the aforementioned method.

[0064] Another aspect of this invention provides a sequencing method, comprising: constructing a high-throughput targeted sequencing library using the aforementioned method, followed by sequencing analysis.

[0065] By employing the above technical solution, the method of the present invention designs and adds a primer sequence with a type II restriction endonuclease-specific recognition site before the target gene amplification primer sequence. After targeted amplification of the target gene site, the non-specific dimer primer is then removed by the type II restriction endonuclease, effectively reducing the presence of non-specific dimer sequences, thereby improving the quality of the sequencing library, obtaining a purer targeted sequencing library, reducing sequencing errors, helping to increase the proportion of effective sequencing information obtained and the depth of targeted gene sequencing, and making disease screening more accurate.

[0066] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be further described in detail below with reference to the accompanying drawings and several preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. For test methods in the following embodiments where specific conditions are not specified, the test methods in the embodiments are all performed under conventional conditions. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0067] Example 1

[0068] One embodiment of the present invention provides a method for preparing a targeted high-throughput sequencing library, the specific steps of which are as follows:

[0069] (1) Design and synthesis of targeting primers:

[0070] The genomic sequence of the target gene was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Primers for upstream and downstream targeting sequences were designed using Primer Premier 5 software. Example targeting primer designs are shown in Table 2. The example restriction endonuclease (NEB: Acul) recognition site is CTGAAG(N). 16 And GACTTC(N) 14 The upstream and downstream targeting primer sequences are between 18 and 25 bp, and both primer sequences were synthesized from a biotechnology company. The targeted amplification product sequence is between 150 and 190 bp in length, and the T-phase of the targeting primer sequences... m The ideal temperature is between 50-60℃. When designing primers, ensure that the amplification product has only one recognition site. If multiple recognition sites appear, consider replacing the restriction endonuclease at other recognition sites or designing other sequence segments of the target gene.

[0071] Table 2 contains examples of primer designs targeting restriction endonuclease recognition sites.

[0072]

[0073] (2) Sequencing adapter sequence

[0074] The sequencing adapter sequences were synthesized using universal adapters provided by Illumina (https: / / www.illumina.com / ). Their main sequence components include cluster adapter sequences, marker sequences, and sequencing primer sequences, as shown in Table 3.

[0075] Upstream cluster connector sequence: CGACCACCGAGATCTACAC

[0076] Upstream marker sequence: TAGATCGC

[0077] Upstream sequencing primer sequence: TCGTCGGCAGCGTC

[0078] Downstream cluster connector sequence: CGGCATACGAGAT

[0079] Downstream marker sequence: TCGCCTTA

[0080] Downstream sequencing primer sequence: GTCTCGTGGGCTCGGCATC

[0081] Table 3 Examples of Illumina universal connectors

[0082] Downstream adapter primer sequence CGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGCATC

[0083] (3) Genomic targeted sequence amplification

[0084] A set of targeted primers containing restriction endonuclease recognition sites as designed above was selected. Targeted amplification was performed using the Roche KAPA HiFi HotStart ReadyMix amplification kit, following the manufacturer's instructions. All sample loading was conducted in a biosafety cabinet, with a total system volume of 20 μL. PCR sample loading details are shown in Table 4 below.

[0085] Table 4

[0086] KAPA mixture (2×) 10 DNA template (10 ng / μL) 2 Upstream Target Primer 1 Downstream targeting primers 1 <![CDATA[ddH2O]]> 6

[0087] Primer concentration: 4-7 μM

[0088] KAPA HiFi HotStart Ready Mix: 0.5U per 25μL reaction

[0089] After completing the sample loading operation, use an Applied Biosystems gradient PCR instrument to perform the reaction under the conditions shown in Table 5 below:

[0090] Table 5

[0091]

[0092] (4) Enzymatic digestion of the product

[0093] The restriction endonuclease used in this experiment is NEB's AcuI, with the following recognition site:

[0094] CTGAAG(N) 16

[0095] GACTTC(N) 14

[0096] The reaction conditions were performed according to the instructions, as shown in Table 6:

[0097] Table 6

[0098] Step (3) Product 20μl Restriction endonucleases 2μl <![CDATA[ddH2O]]> up to 25μl

[0099] Incubation: 37℃, 15-30 min;

[0100] Restriction endonucleases: 5000 units / ml.

[0101] (5) Repair and phosphorylation

[0102] The product was repaired and phosphorylated, under the conditions shown in Table 7:

[0103] Table 7

[0104] T4 DNA polymerase 2μl dNTP 8.0μl ATP (10mM) 8μl T4 PNK 1μl <![CDATA[ddH2O]]> up to 50μl

[0105] Incubation: 12℃, 15 min; 37℃, 20 min; 75℃, 20 min

[0106] T4 DNA Polymerase: 3000units / ml

[0107] T4 PNK: 10000 units / ml

[0108] (6) The product from step (5) was purified by magnetic beads to remove small fragments, and the product was eluted with 20 μl of EB Buffer.

[0109] (7) Sequencing adapter ligation

[0110] Add an excess of Illumina adapter primers and ligate using a ligase, as shown in Table 8:

[0111] Table 8

[0112] Illumina adapter primers 2μl T4 DNA ligase 1.0μl <![CDATA[ddH2O]]> up to 25μl

[0113] Incubation: 16℃, 2 hours

[0114] Illumina adapter primers: 2.5 μM

[0115] T4 DNA ligase: 400000units / ml

[0116] (8) Purify the product from step (7) using magnetic beads.

[0117] (9) Quality control of purified products

[0118] Take 2 μl of the purified library product from step (4) and determine its purity using Nano Drop. The results show that the A260 / A280 ratio of the qualified sample is between 1.8 and 2.0, and the A260 / A230 ratio is above 2.0. Then, take 1 μl of the purified library product and detect the distribution of the amplicon library fragments using an Agilent 4150 Tape Station System. The results are as follows... Figure 2 The fact that the fragment size is between 250-270 bp indicates that the embodiments of the present invention have successfully achieved the preparation of genome-targeted libraries.

[0119] Although the invention has been described with reference to illustrative embodiments, those skilled in the art will understand that various other changes, omissions, and / or additions can be made without departing from the spirit and scope of the invention, and that elements of the described embodiments can be substituted with substantially equivalents. Furthermore, many modifications can be made without departing from the scope of the invention to adapt particular situations or materials to the teachings of the invention. Therefore, this invention is not intended to be limited to the specific embodiments disclosed for carrying out the invention, but rather is intended to encompass all embodiments falling within the scope of the appended claims. sequence list <110> Shanghai University, Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences <120> Targeted gene amplification primers, high-throughput targeted sequencing libraries and their preparation methods <160> 28 <170> SIPOSequenceListing 1.0 <210> 1 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 1 ctgaag 6 <210> 2 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 2 gacttc 6 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence (artificial sequence) <400> 3 ctgaagacga cagggctggt tgc 23 <210> 4 <211> 27 <212> DNA <213> Artificial sequence (artificial sequence) <400> 4 gacttcatag ggcaccacca cactatg 27 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence (artificial sequence) <400> 5 ctgaagcgcc cgcatgtaca acat 24 <210> 6 <211> 27 <212> DNA <213> Artificial sequence (artificial sequence) <400> 6 gacttcacca caccatgaag gcattca 27 <210> 7 <211> twenty four <212> DNA <213> Artificial sequence (artificial sequence) <400> 7 ctgaagtgag caccccttcc tcac 24 <210> 8 <211> twenty four <212> DNA <213> Artificial sequence (artificial sequence) <400> 8 gacttccgcg ccgtttactt gaag 24 <210> 9 <211> twenty four <212> DNA <213> Artificial sequence (artificial sequence) <400> 9 ctgaagcctt ccagtccgga cgac 24 <210> 10 <211> 28 <212> DNA <213> Artificial sequence (artificial sequence) <400> 10 gacttcccga gagattgagt ggaaggtc 28 <210> 11 <211> twenty four <212> DNA <213> Artificial sequence (artificial sequence) <400> 11 ctgaagtctc aggactgcct ccgg 24 <210> 12 <211> twenty two <212> DNA <213> Artificial sequence (artificial sequence) <400> 12 gacttcgtcc cgcacgtcgg tg 22 <210> 13 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 13 ctggag 6 <210> 14 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 14 gacctc 6 <210> 15 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 15 cttgag 6 <210> 16 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 16 gaactc 6 <210> 17 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 17 gtgcag 6 <210> 18 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 18 cacgtc 6 <210> 19 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 19 gcgatg 6 <210> 20 <211> 6 <212> DNA <213> Artificial sequence (artificial sequence) <400> 20 cgctac 6 <210> twenty one <211> 19 <212> DNA <213> Artificial sequence (artificial sequence) <400> twenty one cgaccaccga gatctacac 19 <210> twenty two <211> 8 <212> DNA <213> Artificial sequence (artificial sequence) <400> twenty two tagatcgc 8 <210> twenty three <211> 14 <212> DNA <213> Artificial sequence (artificial sequence) <400> twenty three tcgtcggcag cgtc 14 <210> twenty four <211> 41 <212> DNA <213> Artificial sequence (artificial sequence) <400> twenty four cgaccaccga gatctacact agatcgctcg tcggcagcgt c 41 <210> 25 <211> 13 <212> DNA <213> Artificial sequence (artificial sequence) <400> 25 cggcatacga gat 13 <210> 26 <211> 8 <212> DNA <213> Artificial sequence (artificial sequence) <400> 26 tcgcctta 8 <210> 27 <211> 19 <212> DNA <213> Artificial sequence (artificial sequence) <400> 27 gtctcgtggg ctcggcatc 19 <210> 28 <211> 40 <212> DNA <213> Artificial sequence (artificial sequence) <400> 28 cggcatacga gattcgcctt agtctcgtgg gctcggcatc 40

Claims

1. A method for preparing a high-throughput targeted sequencing library, characterized in that, include: The method provides primers for targeted gene amplification, wherein the primers include, from the 5' end to the 3' end, a type II restriction endonuclease-specific recognition site and a specific primer sequence designed according to the target gene site. The cleavage site of the type II restriction endonuclease is located at a sequence position of not less than 10 bp outside the recognition site sequence. The type II restriction endonuclease is selected from any one of AcuI, BpmI, BpuEI, BsgI, and BtgZI. The target gene is selected from any one of TP53, SOX2, NOTCH1, ZNF750, and CCND1. The type II restriction endonuclease specific recognition site consists of 6 bases. When the type II restriction endonuclease is AcuI, the sequences of the type II restriction endonuclease specific recognition site in the upstream and downstream primer sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. When the type II restriction endonuclease is BpmI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively. When the type II restriction endonuclease is BpuEI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively. When the type II restriction endonuclease is BsgI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively. When the type II restriction endonuclease is BtgZI, the sequences of the type II restriction endonuclease-specific recognition sites in the upstream and downstream primer sequences are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively. The target gene amplification primers were used to target and amplify the target gene locus to obtain the target amplification product. The primer portions of the nonspecific amplification product and the target product were cleaved using a type II restriction endonuclease, wherein the cleavage site of the type II restriction endonuclease was located at a sequence position not less than 10 bp outside the recognition site sequence, and the target amplification product sequence did not contain the type II restriction endonuclease recognition site sequence; then the sticky ends of the cleaved product were repaired into blunt ends, and then purified by magnetic beads. Sequencing adapters were connected, and the high-throughput targeted sequencing library was obtained after purification with magnetic beads.

2. The preparation method according to claim 1, characterized in that: When the target gene is TP53, the sequences of the upstream and downstream primers are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

3. The preparation method according to claim 1, characterized in that: When the target gene is SOX2, the sequences of the upstream and downstream primers are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively.

4. The preparation method according to claim 1, characterized in that: When the target gene is NOTCH1, the sequences of the upstream and downstream primers are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

5. The preparation method according to claim 1, characterized in that: When the target gene is ZNF750, the sequences of the upstream and downstream primers are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively.

6. The preparation method according to claim 1, characterized in that: When the target gene is CCND1, the sequences of the upstream and downstream primers are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively.

7. The preparation method according to claim 1, characterized in that: The target gene amplification primers are selected from any one of gDNA, cDNA, cfDNA, FFPE DNA, and PCR amplicons.

8. The preparation method according to claim 1, characterized in that: The sequencing adapter includes a cluster adapter sequence, a marker sequence, and a sequencing primer sequence. The upstream sequencing adapter primer sequence includes an upstream cluster adapter sequence, an upstream marker sequence, and an upstream sequencing primer sequence. The downstream sequencing adapter primer sequence includes a downstream cluster adapter sequence, a downstream marker sequence, and a downstream sequencing primer sequence.

9. The preparation method according to claim 8, characterized in that: The upstream cluster adapter sequence is shown in SEQ ID NO:21, the upstream marker sequence is shown in SEQ ID NO:22, the upstream sequencing primer sequence is shown in SEQ ID NO:23, and the upstream sequencing adapter primer sequence is shown in SEQ ID NO:

24.

10. The preparation method according to claim 8, characterized in that: The downstream cluster adapter sequence is shown in SEQ ID NO:25, the downstream marker sequence is shown in SEQ ID NO:26, the downstream sequencing primer sequence is shown in SEQ ID NO:27, and the downstream sequencing adapter primer sequence is shown in SEQ ID NO:

28.

11. A high-throughput targeted sequencing library obtained by the preparation method according to any one of claims 1-10.

Images