Nucleic acid aptamer specifically recognizing gentamicin, screening method and application thereof

Abstract

The present application relates to the nucleic acid aptamer of specific recognition gentamicin and its screening method and application, belong to the field of food safety biotechnology. The specific method of the present application is: a pair of stem structure sequences is introduced into the primer binding region of a three-segment library, and the three-segment library designed in this way is used as the initial library for screening. The nucleic acid aptamer capable of recognizing gentamicin and having good affinity and specificity is obtained by screening gentamicin by using flow cytometry sorting-SELEX technology, and through three rounds of repeated screening, affinity and specificity test analysis and verification. The nucleic acid aptamer screened in the present application has a wide application prospect in the accurate, rapid and sensitive detection of gentamicin in food.

Description

Technical Field

[0001] This invention relates to the field of food safety biotechnology, and in particular to nucleic acid aptamers that specifically recognize gentamicin, as well as their screening methods and applications. Background Technology

[0002] Gentamicin is a thermostable, broad-spectrum antibiotic belonging to the aminoglycoside class. It is primarily extracted from the fermentation culture broth of *Syngonium* spp. (Actinomycetes family) and can treat infections caused by Gram-negative bacteria and Gram-positive cocci. Gentamicin's antibacterial mechanism stems from its numerous positively charged amino groups, which bind to negatively charged cell membranes and penetrate the cell interior through electrostatic interactions. When a small amount of gentamicin enters the cell, it disrupts the cell membrane's integrity, releasing a larger amount of gentamicin into the cell. This leads to the gentamicin binding to the 30S subunit of bacterial ribosomes, thus interfering with bacterial protein synthesis. Due to its easy availability and high antibacterial activity, gentamicin is widely used to treat diseases in poultry and livestock. However, the widespread use of antibiotics has also led to the side effect of gentamicin residues and accumulation in dairy cows. Gentamicin accumulates in the bodies of dairy cows during the dairy farming process and is excreted in milk, causing contamination of the milk source. Long-term consumption of contaminated milk by humans can lead to antibiotic resistance, and in severe cases, may cause ototoxicity and nephrotoxicity.

[0003] Research on gentamicin detection methods mainly categorizes them into three types: microbiological methods, physicochemical analysis methods, and immunoassay methods. Microbiological methods are the most traditional, but they suffer from drawbacks such as long detection cycles and cumbersome operations. Physicochemical analysis methods offer advantages such as high sensitivity, good repeatability, and accurate and reliable detection, but they require large instruments and cannot be used for on-site testing. Immunoassay methods are highly specific and have short detection times, but their methodology is difficult to establish, and obtaining the recognition molecule antibodies is challenging. Therefore, a recognition molecule that can specifically bind to gentamicin is needed to facilitate the subsequent construction of sensors for accurate, rapid, and sensitive detection of gentamicin in food. This is of paramount importance for preventing gentamicin-related infections, ensuring food safety, and protecting human health.

[0004] Aptamers are clusters of small DNA or RNA fragments that specifically bind to a target substance, obtained through systematic evolution of ligands by exponential enrichment (SELEX) technology from randomly synthesized oligonucleotide libraries. Similar to antibodies, aptamers offer advantages such as shorter in vitro synthesis cycles, heat resistance, reusability and long-term storage, low cost, and ease of synthesis and modification. These unique advantages make aptamers promising for applications in disease treatment, drug development, environmental monitoring, and food safety testing. Flow cytometry-SELEX (FACS-SELEX) allows for fluorescence recognition and analysis of each particle, collecting high-fluorescence-intensity magnetic beads. Compared to other separation methods, flow cytometry makes separation more intuitive and less prone to saturation leading to incomplete separation. Gentamicin, with its amino functional group, can be immobilized on carboxyl magnetic beads for efficient flow cytometry separation. Separation efficiency is a key step affecting aptamer screening efficiency. In recent years, research has focused not only on the efficiency of the separation process but also on the impact of library complexity on aptamer screening efficiency. The more complex the structure of a nucleic acid aptamer, the higher its affinity for the target. Studies suggest that structuring the initial library can increase the probability of finding aptamers with complex structures.

[0005] Therefore, aptamer screening based on a combination of structured library design and separation techniques has become a current research hotspot. How to obtain an aptamer with high affinity and high specificity to the target is a technical problem that current technologies urgently need to solve. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides oligonucleotide aptamers that specifically recognize gentamicin, along with their screening methods and applications. This invention utilizes structured library design and flow cytometry to screen gentamicin aptamers. In terms of library design, a pair of stem-like sequences are inserted into the primer-binding region of a three-segment sequence. High-fluorescence magnetic beads are collected using a flow cytometry sorter. Finally, fluorescence polarization is used to determine the affinity and specificity of candidate aptamers. The nucleic acid aptamers obtained through screening that specifically recognize gentamicin exhibit high stability, ease of synthesis, and readily labelable functional groups, and will be widely used for the rapid detection of gentamicin in food.

[0007] This invention is achieved through the following technical solution:

[0008] The first objective of this invention is to provide a nucleic acid aptamer that specifically recognizes gentamicin, the nucleotide sequence of which is shown in SEQ ID No. 1 and SEQ ID No. 2.

[0009] The sequence of SEQ ID No. 1 is shown below:

[0010] agcagcacagaggactgctggatagggtttgaagctgactacgagagcggatctcacgcccagcagtgtg ctaccgtgaa.

[0011] The sequence of SEQ ID No. 2 is shown below:

[0012] agcagcacagaggactgctgtttagaatgtctcacgtacagggacgagtcttatctctaccagcagtgtgcta ccgtgaa.

[0013] The second objective of this invention is to provide a single-stranded DNA library for screening aptamers that specifically recognize aflatoxin M1. This single-stranded DNA library is obtained by introducing a pair of stem structure sequences, 5'-ACTGCTG-3' and 5'-CAGCAGT-3', into the primer-binding region of the original sequence, resulting in an initial library with the sequence 5'-AGCAGCACAGAGGACTGCTG-N40-CAGCAGTGTGCTACCGTGAA-3'; where N40 represents a sequence composed of 40 arbitrary nucleotide bases.

[0014] A third objective of this invention is to provide the application of the single-stranded DNA library in screening nucleic acid aptamers that specifically recognize gentamicin.

[0015] A fourth objective of this invention is to provide a screening method for specifically recognizing aptamers for gentamicin, comprising the following steps:

[0016] (1) Coupling of carboxylated magnetic beads with gentamicin

[0017] 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide and N-hydroxysuccinimide were added to a carboxyl magnetic bead solution and incubated to activate the carboxyl magnetic beads. Gentamicin solution was then added and incubated to obtain magnetic beads coupled with gentamicin.

[0018] (2) Incubation of single-stranded DNA library with target

[0019] Add magnetic beads conjugated with gentamicin to a fluorescently labeled single-stranded DNA library, mix and incubate to allow the single-stranded DNA library to fully bind with gentamicin, and obtain ssDNA that binds to the target.

[0020] (3) PCR amplification

[0021] The ssDNA obtained in step (2) was used as a template for PCR amplification;

[0022] (4) Preparation of single chains

[0023] The amplification product from step (3) was prepared into single-stranded DNA to obtain the next round of screening library;

[0024] (5) Multiple rounds of screening

[0025] Replace the random single-stranded DNA library in step (2) with the next round of screening library described in step (4), and repeat multiple rounds of screening according to steps (2)-(4);

[0026] (6) High-throughput sequencing

[0027] After screening, the screening library obtained in the last round of screening in step (4) was subjected to high-throughput sequencing analysis to detect the affinity and specificity of the obtained sequence with gentamicin, and nucleic acid aptamers for specific recognition of gentamicin were obtained.

[0028] In one embodiment of the present invention, in step (5), the multi-round screening is performed using flow cytometry-SELEX technology, which increases the screening pressure by gradually reducing the range of highly fluorescent magnetic beads collected.

[0029] A fifth object of the present invention is to provide a composition comprising the nucleic acid aptamer of claim 1.

[0030] A sixth object of the present invention is to provide a kit containing the nucleic acid aptamer as described in claim 1.

[0031] A seventh object of the present invention is to provide the use of the described composition, the described kit, or the described nucleic acid aptamer in the detection of gentamicin.

[0032] In one embodiment of the present invention, the 5' or 3' end of the nucleic acid aptamer sequence is linked to a functional group or molecule.

[0033] In one embodiment of the present invention, the functional group or molecule is selected from fluorescein, biotin, amino, thiol, digoxigenin, radioisotope, enzyme labeling, or nanoluminescent materials.

[0034] This invention provides a molecular biology detection method for small molecule targets such as aminoglycoside antibiotics, and particularly relates to a method for rapid and accurate detection of gentamicin using aptamer technology. Specifically, it relates to the use of exponential enrichment ligand system evolution technology in molecular biology.

[0035] The method of this invention uses a three-segment sequence with inserted structured fragments as an initial library, and uses FACS-SELEX to screen gentamicin, ultimately obtaining two aptamers with high affinity and high specificity to the target. The obtained aptamers can be converted into detection probes by fluorescent labeling method for the detection of gentamicin in environmental samples and food, achieving the purpose of rapid and accurate diagnosis.

[0036] Mechanism of the invention:

[0037] This invention immobilizes a target onto carboxyl magnetic beads, incubates the immobilized target with a fluorescently labeled library, and then washes the magnetic beads with binding buffer. The washed solution is placed in a sample tube of a flow cytometer and forced into the flow chamber under high pressure. The flow chamber is filled with sheath fluid, which encapsulates and propels the magnetic beads into a single file, ejecting them from the flow chamber nozzle at a certain speed. These droplets are then charged with different positive and negative charges and deflected under a high-voltage electric field, falling into their respective collection containers. During the screening process, the proportion of highly fluorescent magnetic beads collected is controlled by selecting a sorting gate to reduce the impact of non-specific adsorption. The sorted magnetic beads are then thermally denatured, and the sequences in the supernatant are collected for repeated cycles of subsequent PCR amplification, purification, enzyme digestion, and single-strand preparation.

[0038] The technical solution of the present invention has the following advantages over the prior art:

[0039] (1) Compared with antibodies, aptamers can be screened in vitro, with a short screening cycle, convenient synthesis, easy labeling of various functional groups and reporter molecules, stable properties, and can be stored and used for a long time.

[0040] (2) The screening method of this invention can significantly improve the screening rate of aptamers. Inserting a structured library helps to facilitate rapid sequence folding, enriching the diversity of sequence structures in the library pool, thereby obtaining aptamer sequences with good recognition performance. The separation efficiency during the screening process is improved by using flow cytometry sorting, in order to shorten the screening cycle.

[0041] (3) This sequence is an aptamer sequence with strong affinity and specificity selected from candidate aptamer sequences with significant structure and different affinity for gentamicin. It can specifically identify gentamicin in the environment and food. Attached Figure Description

[0042] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0043] Figure 1 This is a schematic diagram illustrating the principle of using FACS-SELEX technology based on structured library design to screen gentamicin nucleic acid aptamers according to the present invention.

[0044] Figure 2 This is the standard curve of gentamicin in Example 1 of the present invention;

[0045] Figure 3 These are liquid chromatograms before and after gentamicin fixation in Example 1 of the present invention; wherein, A is the liquid chromatogram before gentamicin fixation; and B is the liquid chromatogram after gentamicin fixation.

[0046] Figure 4 The above are flow cytometry sorting diagrams for screening gentamicin in Example 1 of the present invention; wherein, A is the flow cytometry sorting diagram for the first round of screening; B is the flow cytometry sorting diagram for the second round of screening; and C is the flow cytometry sorting diagram for the third round of screening.

[0047] Figure 5 This is a flow cytometry cell sorting monitor of the screening process in Embodiment 1 of the present invention; wherein, A is a blank screening monitoring chart; B is a second round screening monitoring chart; and C is a third round screening monitoring chart.

[0048] Figure 6 Phylogenetic analysis of the first fifty candidate aptamer sequences after screening and sequencing in Example 1 of the present invention;

[0049] Figure 7 This is a secondary structure diagram of the gentamicin candidate aptamers Qing 2 (A), Qing 20 (B), Qing 23 (C), Qing 31 (D), and Qing 34 (E) in Example 1 of the present invention;

[0050] Figure 8 The affinity saturation binding curves of the gentamicin candidate aptamers Qing 2 (A), Qing 20 (B), Qing 31 (C) and Qing 34 (D) in Example 2 of this invention are shown.

[0051] Figure 9 This is a specificity diagram of the candidate aptamers Qing 20 (A) and Qing 31 (B) for gentamicin in Example 3 of the present invention. Detailed Implementation

[0052] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0053] The following is a screening technique based on structured library design using FACS-SELEX to screen gentamicin aptamers with high affinity and high specificity (e.g., ...). Figure 1 (as shown) and its screening method.

[0054] Example 1

[0055] 1. Synthesize random single-stranded DNA libraries and primers (synthesized by Shanghai Sangon Biotech Co., Ltd.)

[0056] Random ssDNA library:

[0057] 5'-FAM-AGCAGCACAGAGGACTGCTG-N40-CAGCAGTGTGCTACCGT GAA-3', where N40 represents a sequence consisting of 40 arbitrary nucleotide bases linked together.

[0058] 5' Upstream primer: 5'-FAM-AGCAGCACAGAGGACTGCTG-3'

[0059] 5' Phosphorylation of downstream primer: 5'-P-TTCACGGTAGCACACTGCTG-3'

[0060] The random ssDNA library and primers were prepared into a 100 μM stock solution using TE buffer and stored at 4 °C for later use.

[0061] 2. Design of the initial library

[0062] A pair of stem structure sequences (5'-ACTGCTG-3', 5'-CAGCAGT-3') were introduced into the primer binding region of the original sequence (5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3') to form the initial library.

[0063] 3. Fixation of gentamicin

[0064] (1) Detection of gentamicin by high performance liquid chromatography

[0065] Take a certain amount of gentamicin solution, add ultrapure water to make up to 2 mL, then add 2 mL of isopropanol and 1 mL of phthalaldehyde derivatizing agent, mix well, and derivatize at 50℃ for 20 min. After cooling to room temperature, take 50 μL of sample and pass it through a membrane for high-performance liquid chromatography (HPLC). HPLC conditions: mobile phase was methanol-acetic acid solution (V / V, 200 / 5) containing 0.02 mol / L sodium heptanesulfonate solution; C18 column was used; injection volume was 10 μL; flow rate was 1.0 mL / min; a fluorescence detector was used, with excitation wavelength of 340 nm and emission wavelength of 540 nm.

[0066] Gentamicin solution was diluted to prepare a series of standard solutions with gradient concentrations of 0 μg / mL, 25 μg / mL, 50 μg / mL, 75 μg / mL, 100 μg / mL, 200 μg / mL, and 500 μg / mL. The determination was performed according to the above procedure, with each concentration of standard solution repeated three times. A standard curve for gentamicin was plotted with the concentration of the gentamicin standard solution on the x-axis and the peak area of ​​the marked peak in the analyte chromatogram on the y-axis. This standard curve was used for the quantitative analysis of gentamicin during the coupling process of carboxyl magnetic beads and gentamicin.

[0067] Figure 2 The standard curve for gentamicin is shown. A distinct peak appears between 7 and 8 minutes of retention time, and its peak area increases with increasing gentamicin concentration. Therefore, this peak was chosen as a marker to determine the gentamicin content. When the gentamicin concentration is between 25 μg / mL and 500 μg / mL, the peak area shows a good linear relationship with the gentamicin concentration, with a correlation coefficient (R0). 2 The value is 0.99901.

[0068] (2) Coupling of carboxylated magnetic beads with gentamicin

[0069] Take 100 μL of 10 mg / mL carboxyl magnetic bead stock solution into a centrifuge tube. After magnetic separation, remove the supernatant. Wash the carboxyl magnetic beads three times with MES buffer (prepared by adjusting the pH of MES to 6 and filtering through a 0.2 μm filter membrane) to remove the protective solution. Disperse in 200 μL of 2-(N-morpholinoethanesulfonic acid, MES) buffer. Remove the supernatant by magnetic separation. Add 250 μL of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and 250 μL of N-hydroxysuccinimide (NHS) sequentially to the system and incubate at 37 °C for 30 min to activate the carboxyl magnetic beads. Wash the activated carboxyl magnetic beads with MES buffer to thoroughly remove excess reagents from the reaction. Add 200 μL of 2 g / L gentamicin solution to the magnetic beads and incubate at room temperature for 1 h. After the reaction was completed, the supernatant was collected by magnetic separation, and the gentamicin content in the supernatant before and after incubation was detected by high performance liquid chromatography.

[0070] like Figure 3 As shown in Figure A, the area corresponding to the peak at a retention time of 7.55 min is 2.11 × 10⁻⁶. 7 The concentration of gentamicin in the supernatant before coupling was calculated to be 459.20 μg / mL. Figure 3 In the figure, B is the chromatogram of gentamicin in the supernatant after coupling. At a retention time of 7.89 min, the peak area of ​​this component is 1.99 × 10⁻⁶. 7 The calculated concentration of gentamicin in the supernatant after coupling was 431.50 μg / mL. The volume of the gentamicin solution was 2 mL, and the amount fixed on the 1 mg magnetic bead was 55.40 μg.

[0071] 4. In vitro screening of gentamicin aptamers

[0072] (1) Incubation of ssDNA library with target: In the first round of screening, the library was first denatured at 95℃ for 5 min and then cooled in an ice bath for 10 min. Then, 500 nmol of pretreated ssDNA was added to the magnetic beads immobilized with the target and incubated at 37℃ for 2 h to allow the ssDNA library to fully bind with gentamicin.

[0073] (2) Flow cytometry screening of gentamicin: In the first round of screening, a library containing 500 pmol of fluorescent groups was added. The specific screening results using flow cytometry are shown in the diagram below. Figure 4As shown in A in the figure. Compared to the blank, the magnetic beads in the first round showed two peaks, and both peaks were shifted overall. This may be because too much library was added in the first round, causing the magnetic beads to adsorb excess sequences, resulting in the overall peaks shifting towards the high fluorescence intensity region. In the first round of screening, the magnetic beads with the top 20% fluorescence intensity were collected to minimize the impact of non-specific binding of magnetic beads on the screening results. In the second round of screening, 200 pmol of secondary library was added, and the magnetic beads with the top 5% fluorescence intensity were collected. Figure 4 (B in the text). In the third round of screening, the top 2% of magnetic beads by fluorescence intensity were collected. Figure 4 (C in the middle).

[0074] (3) PCR amplification: Collect the highly fluorescent magnetic beads from the sorted regions and heat them to detach the sequences from the target. After magnetic separation, use the supernatant obtained from the screening as a template for PCR amplification. The PCR system consists of 4 μL template, 1 μL each of 5 μM forward and reverse primers, and 5 mM Mg-containing... 2+ 1 μL of dNTPs, 5 μL of 10×PCR buffer, and 0.5 μL of Taq enzyme were added to a final volume of 50 μL with sterile ultrapure water. PCR amplification was performed by first denaturing at 94 °C for 5 min, followed by denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s. After cycling to the optimal number of cycles for PCR, the final extension was performed at 72 °C for 2 min, and the sample was cooled to 4 °C.

[0075] (4) Verification by polyacrylamide gel electrophoresis: PCR products were electrophoresed on an 8% non-denaturing polyacrylamide gel. The enzyme digested products were electrophoresed on an 8% denaturing polyacrylamide gel (containing 7M urea). The gel imaging system was used to observe whether the electrophoretic bands were single and bright, and whether the bands were located at the 80bp position.

[0076] (5) Purification and Enzyme Digestion of PCR Products: The obtained PCR products were purified using a purification kit to remove other substances from the PCR reaction system. The concentration of purified nucleic acid was measured using a NanoDrop-2000 micro UV-Vis spectrophotometer to determine the approximate digestion time. The purified product was mixed with 1 / 10 volume of digestion buffer and an appropriate amount of exonuclease, and reacted at 37°C until digestion was complete. After digestion, the enzyme was inactivated at 75°C for 10 min to stop the digestion reaction.

[0077] (6) Purification of enzyme digestion products: Add 1 / 10 volume of 3mol / L NaAC to the enzyme digestion products and mix well. Then add 2 volumes of anhydrous ethanol and mix well. Place the mixture in a -20℃ freezer overnight to precipitate. Centrifuge the precipitated solution at 14000 rpm for 15 min at 4℃. After discarding the supernatant, add 200 μL of 70% ethanol to the system, mix well, and centrifuge at 14000 rpm for 15 min at 4℃. Discard the supernatant. Place the mixture in a 50℃ oven for drying and dissolve it in 50 μL of 1×TE buffer to prepare the library for the next round of screening.

[0078] As the number of screening rounds increases, the screening pressure is gradually increased to obtain aptamer sequences with good affinity and specificity. Except for the first round of screening where the library amount added is 500 nmol, from the second round onwards, the library amount added is reduced to 200 pmol.

[0079] 5. Monitoring of library enrichment during the screening process

[0080] During the screening process, flow cytometry was used to monitor the enrichment level of the library, such as... Figure 5 As shown in the figure. Using flow cytometry to process the blank group, it was found that the magnetic beads were mainly distributed in the Q1 region. In the second round of screening, more than 70% of the magnetic beads shifted to the Q2 region, indicating that after two rounds of screening, most of the fluorescently modified sequences could bind to the magnetic beads with fixed targets. In the third round of screening, more than 90% of the magnetic beads were fluorescent. Therefore, the PCR purification products from the third round were used for high-throughput sequencing.

[0081] 6. Cloning and sequencing

[0082] The PCR amplification products obtained from the third round of screening were sent to Shanghai Sangon Biotech Co., Ltd. for high-throughput sequencing, yielding approximately 100,000 aptamer sequences. The homology information of the first fifty sequences was analyzed using MEGA11 software. Figure 6 As shown), the secondary structure of candidate aptamer sequences was simulated using the M-fold online website. Figure 7 (As shown). Five structurally stable sequences with low free energy were selected based on sequence frequency, family homology, secondary structure, base number, and Gibbs free energy ΔG. Aptamers labeled with FAM at the 5' end were synthesized by Shanghai Sangon Biotech Co., Ltd. for affinity and specificity analysis.

[0083] Example 2 Aptamer Affinity Analysis

[0084] Five candidate aptamer sequences were prepared into 100 μM solutions using TE buffer and stored at -20°C for later use. A series of aptamer solutions with fluorescent groups at concentration gradients (25 nM, 50 nM, 100 nM, 150 nM, 200 nM) were incubated with 2 μM gentamicin at 37°C for 1 h. Then, the optimal volume of graphene oxide solution (1 mg / mL) was added, and the mixture was incubated at 37°C for 30 min. After thorough mixing, the mixture was transferred to a black ELISA plate, and the fluorescence polarization value was measured and recorded as FP1. The mixture without the target was used as a blank control, and its fluorescence polarization value was recorded as FP0. The experiment was repeated three times, and Kd was calculated using GraphPad Prism 8.0 software. The saturation binding curve was plotted with aptamer concentration on the x-axis and ΔFP (ΔFP = FP0 - FP1) on the y-axis. Figure 8 (As shown). The Kd values ​​for Qing 2, Qing 20, Qing 31, and Qing 34 bound to gentamicin were 310.3±7.08 nmol / L, 53.70±3.25 nmol / L, 125.20±2.87 nmol / L, and 473.60±4.56 nmol / L, respectively. Nonlinear fitting of the data for Qing 23 bound to gentamicin showed no Kd, indicating that Qing 23 does not bind to gentamicin. Based on the relationship between Kd value and affinity, Qing 20 showed the lowest Kd and the best affinity for gentamicin.

[0085] Example 3 Aptamer Specificity Analysis

[0086] Candidate aptamers Qing 20 and Qing 31, exhibiting good affinity for gentamicin (i.e., low Kd values), were selected for specificity analysis. 50 nM solutions of the candidate aptamers with fluorescent groups were mixed with gentamicin, oxytetracycline (OTC), tetracyclines (TC), chloramphenicol (CAP), and ampicillin (Amp), respectively, and incubated at 37°C for 1 h. Then, an appropriate volume of GO solution (1 mg / mL) was added to the system, and the mixture was vortexed until homogeneous. The resulting solution was then placed in a black microplate, and the fluorescence polarization value was measured and recorded as FP2. A blank control system without the target was used, and its fluorescence polarization value was recorded as FP0. The experiment was repeated three times. The relative fluorescence polarization (ΔFP / ΔFP) was plotted on the x-axis, with different candidate aptamers as the abscissa. m Plot the specificity curves of candidate aptamers on the ordinate. Figure 9 As shown in the figure, ΔFP is the fluorescence polarization difference measured by the positive sieve target, the reverse sieve material, and the blank group. m It is the value with the largest difference in fluorescence polarization value between the positive screening target and the blank group.

[0087] The study selected two sequences, Qing 20 and Qing 31, with good affinity for gentamicin, for further specificity analysis. Using OTC, TC, CAP, and Amp as specific interference targets, the binding characteristics of the two aptamers to gentamicin were investigated. Both aptamers showed binding rates of over 80% for gentamicin, while binding rates for interfering substances were both below 25%, indicating that both Qing 20 and Qing 31 possess certain specificity.

[0088] The nucleotide sequence of aptamer Qing 20 is shown in SEQ ID No. 1:

[0089] agcagcacagaggactgctggatagggtttgaagctgactacgagagcggatctcacgcccagcagtgtg ctaccgtgaa

[0090] The nucleotide sequence of aptamer Qing 20 is shown in SEQ ID No. 2:

[0091] agcagcacagaggactgctgtttagaatgtctcacgtacagggacgagtcttatctctaccagcagtgtgcta ccgtgaa

[0092] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A nucleic acid aptamer that specifically recognizes gentamicin, characterized in that, The nucleotide sequences of the nucleic acid aptamers are shown in SEQ ID No. 1 and SEQ ID No.

2.

2. A composition, characterized in that, The composition contains the nucleic acid aptamer as described in claim 1.

3. A reagent kit, characterized in that, The kit contains the nucleic acid aptamer as described in claim 1.

4. The use of the composition of claim 2, the kit of claim 3, or the nucleic acid aptamer of claim 1 in the detection of gentamicin.

5. The application according to claim 4, characterized in that, The 5' or 3' end of the nucleic acid aptamer sequence is linked to a functional group or molecule.

6. The application according to claim 5, characterized in that, The functional groups or molecules are selected from fluorescein, biotin, amino, thiol, digoxigenin, radioisotopes, enzyme labels, or nanoluminescent materials.

Images