Marker detection material and kit for breast cancer diagnosis or prognosis evaluation
By detecting KLHL29 gene expression levels and using inhibitors targeting KLHL29-mediated signaling pathways, the problems of diagnosis and prognostic assessment of triple-negative breast cancer have been solved, chemotherapy resistance has been improved, new treatment options have been provided, and treatment outcomes have been enhanced.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE FIRST HOSPITAL OF CHINA MEDICIAL UNIV
- Filing Date
- 2023-06-26
- Publication Date
- 2026-08-04
AI Technical Summary
Current technologies lack effective methods for the diagnosis and prognostic assessment of breast cancer, especially triple-negative breast cancer, and platinum-based drug resistance seriously affects treatment outcomes.
This invention provides a biomarker and kit for detecting the expression level of the KLHL29 gene or its encoded protein, combined with an inhibitor targeting the KLHL29-mediated signaling pathway, such as the small molecule inhibitor RK33 of DDX3X, to improve chemotherapy resistance and prognostic assessment.
By detecting the expression level of the KLHL29 gene, a diagnostic and prognostic tool for triple-negative breast cancer has been provided, improving chemotherapy resistance, offering new treatment options, and enhancing treatment outcomes.
Smart Images

Figure CN116769915B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the biomedical field, and more specifically, to a biomarker and kit for the diagnosis or prognostic assessment of breast cancer. Background Technology
[0002] Breast cancer has a high mortality and incidence rate, seriously endangering women's lives and health, and placing a heavy burden on families and society. With as many as 2.3 million new cases annually, accounting for 11.7% of all new malignant tumors, it has become the most common malignant tumor globally. Since the 1990s, the incidence rate of breast cancer in my country has increased at twice the global rate, far exceeding that of Europe and the United States, and is characterized by earlier age of onset, later diagnosis, more complications, and poorer prognosis and survival.
[0003] Triple-negative breast cancer (TNBC) is a type of breast cancer that is negative for ER, PR, and HER2 expression, accounting for approximately 15% to 20% of breast cancer cases. TNBC is the most challenging subtype of breast cancer, characterized by young age of onset, high malignancy, and rapid recurrence and metastasis. Patients typically present with a heavy tumor burden and early lymph node involvement. During treatment, TNBC exhibits varying tumor biological behavior and drug sensitivity, and is insensitive to both endocrine therapy and anti-HER2 targeted therapy. Chemotherapy efficacy varies, and patients often develop chemotherapy resistance and poor prognosis. Therefore, the molecular mechanisms underlying the development, progression, and drug resistance of TNBC remain unclear, and the challenges in diagnosis and treatment urgently need to be addressed.
[0004] On the other hand, anthracycline and taxane-based chemotherapy remains the standard treatment for TNBC, but its poor efficacy affects prognosis, and patients frequently develop chemotherapy resistance. Cisplatin is a representative first-generation platinum-based chemotherapy drug, the first synthetic platinum-based anticancer drug, and one of the most widely used chemotherapy drugs in clinical practice. Currently, platinum-based treatment regimens are a commonly used approach in TNBC treatment, showing good efficacy in both neoadjuvant and advanced-stage TNBC treatment. However, platinum resistance and its adverse reactions that have emerged in clinical treatment severely affect the efficacy of platinum-based drugs and limit their clinical application.
[0005] In summary, there is currently a lack of methods for the diagnosis and assessment of prognosis in triple-negative breast cancer, and from a treatment perspective, the problem of platinum-based drug resistance and its adverse reactions also need to be addressed. Summary of the Invention
[0006] The purpose of this disclosure is to address at least one of the problems existing in the prior art. More specifically, this disclosure aims to provide a biomarker for the diagnosis or prognostic assessment of breast cancer, a specific method of applying this biomarker, and a kit for the diagnosis or prognostic assessment of breast cancer. Simultaneously, based on the same research approach as the aforementioned biomarker, this disclosure provides a targeted inhibitor to address the problem of platinum-based drug resistance.
[0007] Specifically, the first aspect of this disclosure provides a biomarker for the diagnosis or prognostic assessment of breast cancer, the biomarker comprising primers for detecting the expression level of the KLHL29 gene or its encoded protein.
[0008] Optionally, this marker detection includes a pair of specific amplification primers:
[0009] Upstream primer (F): 5'-GCAGAGCGAAAGCGTTTACAG-3'
[0010] Downstream primer (R): 5'-GCAGGTTCGACAGGACGAG-3'.
[0011] KLHL29, a member of the Kelch family of proteins, acts as a tumor suppressor gene in breast cancer, especially triple-negative breast cancer, inhibiting its proliferation, migration, and invasion. Low KLHL29 expression also suggests a poor prognosis, making it a potential novel therapeutic target and prognostic biomarker for triple-negative breast cancer. Therefore, this disclosure provides a biomarker that can effectively detect the prognostic biomarker KLHL29. The detection results can provide important reference for the diagnosis and prognostic assessment of triple-negative breast cancer.
[0012] The second aspect of this disclosure provides the use of the above-mentioned marker for the preparation of a detection reagent, wherein the detection reagent is used for one or more of the following purposes:
[0013] Used to predict chemotherapy resistance and prognosis in anti-breast cancer drugs.
[0014] Used to improve the combination of inhibitors and anti-breast cancer drugs.
[0015] Optionally, the expression level of the KLHL29 gene or its protein can be detected by a detection reagent, and the chemotherapy resistance and prognosis of anti-breast tumor drugs can be predicted based on the expression level, wherein a lower expression level indicates a poor prognosis.
[0016] Optionally, the expression level of the KLHL29 gene or its protein can be detected using a detection reagent, and the dosage of the inhibitor can be adjusted according to the expression level to improve the combined use of the inhibitor and anti-breast tumor drugs.
[0017] In the above-mentioned uses, breast tumors specifically include breast cancer and its subtypes, especially triple-negative breast cancer; anti-breast tumor drugs include platinum-based drugs, especially cisplatin.
[0018] A third aspect of this disclosure provides a kit for the diagnosis or prognostic assessment of breast cancer, comprising a housing and a biomarker as described in the first aspect or an alternative thereof.
[0019] Optionally, the kit may also include one or more of the following reagents:
[0020] Pepsin, tissue fixative, prehybridization solution, oligonucleotide probe hybridization solution, blocking solution, biotinylated mouse anti-digoxigenin, SABC-POD, biotinylated peroxidase, DEPC, 3% citrate, 2×SSC, 0.5×SSC, 0.2×SSC, and PBS for in situ hybridization.
[0021] Given the aforementioned characteristics of KLHL29 acting as a tumor suppressor gene in triple-negative breast cancer, and further, KLHL29 can affect the function of triple-negative breast cancer by promoting CUL3-mediated DDX3X ubiquitination, thereby leading to cell cycle arrest. Therefore, the fourth aspect of this disclosure provides an inhibitor targeting the KLHL29-mediated signaling pathway, which can be used in combination with anti-breast cancer drugs to improve the drug resistance problem of anti-breast cancer drugs during the treatment of triple-negative breast cancer.
[0022] Among these inhibitors is RK33, an inhibitor of DDX3X, the interacting protein of KLHL29. Cisplatin is a suitable anti-breast cancer drug. Platinum-based drugs and RK33, a specific small-molecule inhibitor of DDX3X, have a synergistic effect, significantly inhibiting tumor growth in triple-negative breast cancer and providing a new treatment option for patients with triple-negative breast cancer.
[0023] Through the above-mentioned solutions, this disclosure has at least the following advantages and beneficial effects:
[0024] First, this disclosure clarifies the role and molecular mechanism of KLHL29 and its interacting protein DDX3X in the development and progression of triple-negative breast cancer. At the same time, it focuses on its clinical translational value, discovers potential drug targets for triple-negative breast cancer, and applies inhibitors targeting the mechanisms involved by the target genes for clinical translation. This provides a theoretical basis for the selection of breast cancer treatment targets and offers new treatment options for patients with triple-negative breast cancer.
[0025] Specifically, the KLHL29 gene is used as a biomarker for the diagnosis or prognostic assessment of breast cancer, and a corresponding biomarker detection method is provided. This is a molecular biomarker detection method that can effectively detect the expression level of the KLHL29 gene, and the detection results can provide important reference for the diagnosis and prognostic assessment of triple-negative breast cancer.
[0026] Secondly, regarding the application of the aforementioned biomarkers, diagnostic reagents or kits are developed based on these biomarkers, providing auxiliary tools for the diagnosis and treatment of breast cancer and its prognostic assessment. Specifically, they can predict chemotherapy resistance and prognosis during treatment, and can regulate the dosage of inhibitors in combination therapy to improve resistance to anti-breast cancer drugs.
[0027] Furthermore, targeting the KLHL29 gene provides targeted drugs and inhibitors targeting the KLHL29-mediated signaling pathway, which improves the problems of poor efficacy of anti-tumor drugs, chemotherapy resistance, and poor prognosis, effectively solving the problem of lack of therapeutic drug targets and effective therapeutic drugs for breast cancer, especially triple-negative breast cancer. Attached Figure Description
[0028] The above and other features, advantages, and aspects of the embodiments of this disclosure will become more apparent from the accompanying drawings and the following detailed description. In the drawings, the same or similar reference numerals denote the same or similar elements, wherein:
[0029] Figure 1 This is a diagram illustrating the expression of the KLHL29 gene in TNBC cancer tissue as described in this disclosure;
[0030] In this table, A shows the differential expression of KLHL29 in 360 cancer tissues and 88 adjacent normal tissues in the FUSCC-TNBC RNA-seq cohort; B shows the differential expression of KLHL29 in 88 paired cancer tissues and adjacent normal tissues in the FUSCC-TNBC RNA-seq cohort; C shows the differential expression of KLHL29 in 169 cancer tissues and 113 adjacent normal tissues in the TCGA-TNBC RNA-seq cohort; and D shows the differential expression of KLHL29 in 13 paired cancer tissues and adjacent normal tissues in the TCGA-TNBC RNA-seq cohort.
[0031] Figure 2 Immunohistochemical staining and survival analysis of TNBC tissue samples involved in this disclosure;
[0032] In this study, A represents the relationship between KLHL29 expression and overall survival in basal-like breast cancer according to the PAM50 classification; B represents the relationship between KLHL29 expression and recurrence-free survival in basal-like breast cancer according to the PAM50 classification; C represents the relationship between KLHL29 expression and recurrence-free survival in basal-like breast cancer according to the St Gallen classification; D represents the relationship between KLHL29 expression and recurrence-free survival in basal-like breast cancer according to the St Gallen classification; E presents representative images of different immunohistochemical scores from paraffin sections of 91 TNBC samples for KLHL29 immunohistochemical staining analysis; F represents the grouping of samples by high and low expression based on KLHL29 immunohistochemical scores to assess the relationship between KLHL29 expression and overall survival in TNBC; and G represents the grouping of samples by high and low expression based on KLHL29 immunohistochemical scores to assess the relationship between KLHL29 expression and recurrence-free survival in TNBC.
[0033] Figure 3 The effects of KLHL29 on the proliferation, cloning, and apoptosis abilities of TNBC as disclosed in this disclosure;
[0034] In this diagram, A represents the effect of KLHL29 overexpression on the proliferation of BT549 cells as detected by the CCK-8 assay; B represents the effect of KLHL29 overexpression on the proliferation of CAL51 cells as detected by the CCK-8 assay; C represents the effect of KLHL29 overexpression on the colony-forming ability of BT549 and CAL51 cells as detected by the plate colony-forming assay; D represents a statistical graph of the plate colony-forming assay data; E represents the effect of KLHL29 overexpression on the apoptosis ability of BT549 and CAL51 cells as detected by the flow cytometry assay; and F represents a statistical graph of the apoptosis assay data.
[0035] Figure 4 This is a graph showing the effect of KLHL29 on the in vivo growth of TNBC in a nude mouse orthotopic xenograft model involved in this disclosure.
[0036] In the figures, A shows the tumor of the nude mouse orthotopic xenograft model constructed using MDA-MB-231 cells stably overexpressing KLHL29; B shows the tumor volume change curves of the overexpression experimental group (KLHL29) and the control group (PCDH); C shows the tumor mass statistics of the overexpression experimental group (KLHL29) and the control group (PCDH); D shows the tumor of the nude mouse orthotopic xenograft model constructed using MDA-MB-231 cells stably knocked down KLHL29; E shows the tumor volume change curves of the knockdown experimental group (sh-KLHL29) and the control group (shNC); and F shows the tumor mass statistics of the knockdown experimental group (sh-KLHL29) and the control group (shNC).
[0037] Figure 5To identify KLHL29 interacting proteins using a protein immunoprecipitation assay combined with mass spectrometry analysis as described in this disclosure;
[0038] In this diagram, A shows the process for identifying KLHL29 interacting proteins; B is a Venn diagram presenting the mass spectrometry analysis results of BT549 and CAL51 cells; and C shows candidate proteins that interact with KLHL29 in both BT549 and CAL51 cells.
[0039] Figure 6 This is a diagram illustrating the expression and prognosis of DDX3X in TNBC as described in this disclosure;
[0040] In this study, A shows the differential expression of DDX3X in 84 cancerous tissues and 69 adjacent normal tissues in the FUSCC-TNBC proteomics cohort; B shows the differential expression of DDX3X in 28 TNBC subtypes and 91 non-TNBC subtypes of breast cancer in the CPTAC cohort; C shows the differential expression of DDX3X in 29 basal-like subtypes and 93 non-basal-like subtypes of breast cancer in the CPTAC cohort; D shows the immunohistochemical staining analysis of DDX3X in paraffin sections of 91 TNBC cases, with representative images of different immunohistochemical scores; E shows the grouping of samples based on high and low expression according to DDX3X immunohistochemical scores, analyzing the relationship between DDX3X expression and overall survival in TNBC; and F shows the grouping of samples based on high and low expression according to DDX3X immunohistochemical scores, analyzing the relationship between DDX3X expression and recurrence-free survival in TNBC. PT: adjacent normal tissue, T: cancerous tissue.
[0041] Figure 7 This is a diagram illustrating the interaction between KLHL29 and DDX3X in protein immunoprecipitation, as described in this disclosure.
[0042] In this study, A represents the exogenous transient transduction of Flag-KLHL29 and Myc-DDX3X plasmids into HEK293T cells, followed by an immunoprecipitation assay using a Flag-tagged antibody to detect the expression of Myc-DDX3X and Flag-KLHL29 proteins; B represents the exogenous transient transduction of Myc-DDX3X and Flag-KLHL29 plasmids into HEK293T cells, followed by an immunoprecipitation assay using a Myc-tagged antibody to detect the expression of Flag-KLHL29 and Myc-DDX3X proteins; C represents a schematic diagram of the KLHL29 truncated variant; and D represents the exogenous overexpression of Myc-DDX3X and Flag-KLHL29 truncated variants (AA1–328, AA1–401, AA329–584, and AA1–328) in HEK293T cells. (585-875) Immunoprecipitation experiments were performed using Flag-tagged antibodies to detect the expression of Flag-KLHL29 truncated variants and Myc-DDX3X proteins, and to determine the binding domain of KLHL29 to DDX3X. E represents the exogenous overexpression of Myc-DDX3X and Flag-KLHL29 plasmids in BT549 and CAL51 cells, followed by immunofluorescence experiments using Flag-tagged and Myc-tagged antibodies.
[0043] Figure 8 The diagrams (A and B) show the effect of the small molecule inhibitor RK33, a DDX3X inhibitor disclosed in this disclosure, on DDX3X expression in Western blotting experiments, and (C and D) show the effect of the small molecule inhibitor RK33, a DDX3X inhibitor disclosed in this disclosure, on the cell cycle in flow cytometry experiments.
[0044] Figure 9 This is a graph showing the relationship between the expression levels of KLHL29 and DDX3X and the drug sensitivity of TNBC to the small molecule inhibitor RK33, as disclosed in this disclosure.
[0045] Figure 10 This is a diagram illustrating the combined effects of RK33 inhibitor and cisplatin in TNBC during the CCK-8 proliferation assay described in this disclosure.
[0046] Among them, A, B, C, and D are growth curves of the MDA-MB-231 human breast cancer cell line, SUM159PT human breast cancer cell line, BT459 human breast cancer cell line, and CAL51 human breast cancer cell line, respectively, using the small molecule inhibitor RK33 of DDX3X alone or in combination with cisplatin.
[0047] Figure 11 This is a diagram illustrating the effects of RK33 and cisplatin on the in vivo growth of TNBC in nude mice in tumor-bearing experiments as described in this disclosure.
[0048] In the chart, A is a comparison chart of tumor size, B is a bar chart of tumor weight, C is a line graph of tumor volume change in 24 days after transplantation, and D is a line graph of body weight change in 24 days after transplantation. Detailed Implementation
[0049] To make the objectives, embodiments, and advantages of this disclosure clearer, the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this disclosure. All other embodiments obtained by those skilled in the art based on the embodiments of this disclosure without creative effort are within the scope of protection of this disclosure.
[0050] This disclosure, based on transcriptomic data from multiple patients with triple-negative breast cancer and the Cancer Genome Atlas (TCGA) public database, screened for the gene KLHL29, which is significantly underexpressed in triple-negative breast cancer and associated with prognosis. Subsequently, in vivo and in vitro experiments, including quantitative polymerase chain reaction (qPCR), Western blotting, immunohistochemistry, CCK8 cell proliferation assay, transwell migration and invasion assay, flow cytometry, co-immunoprecipitation (Co-IP), and nude mouse fat pad tumorigenesis assay, were conducted to explore the biological function and potential mechanism of this protein in the development and progression of triple-negative breast cancer. The inventors of this disclosure are the first to discover that KLHL29, a member of the Kelch family of proteins, acts as a tumor suppressor gene in triple-negative breast cancer, inhibiting its proliferation, migration, and invasion. Furthermore, low expression of KLHL29 indicates a poor prognosis and could serve as a novel therapeutic target and prognostic biomarker for triple-negative breast cancer. Therefore, a biomarker for KLHL29 was specifically developed.
[0051] Furthermore, the inventors of this disclosure have learned through research that KLHL29 can affect the function of triple-negative breast cancer by promoting CUL3-mediated ubiquitination of DDX3X, thereby leading to cell cycle arrest. Moreover, given the synergistic effect between platinum-based drugs and RK33, a specific small molecule inhibitor of DDX3X, which can significantly inhibit tumor growth in triple-negative breast cancer and provide new treatment options for patients, the expression levels of KLHL29 and DDX3X can serve as predictive biomarkers for patient efficacy, aiding in the selection of chemotherapy regimens and the evaluation of chemotherapy effects.
[0052] In view of this, this disclosure aims to provide a molecular marker for detecting the expression level of the KLHL29 gene or its encoded protein, as well as a detection reagent, and the application of the KLHL29 gene in the preparation of products for the auxiliary diagnosis of breast tumors. Simultaneously, it provides an inhibitor targeting the KLHL29-mediated signaling pathway, laying a theoretical foundation for developing novel treatment regimens for triple-negative breast cancer. Furthermore, it provides a novel combination therapy regimen for triple-negative breast cancer that can improve cisplatin resistance, offering new treatment options for patients with triple-negative breast cancer.
[0053] like Figure 1 As shown, bioinformatics mining was performed using a large-scale TNBC multi-omics cohort (FUSCC-TNBC) previously established by a cancer center. Transcriptome data from primary TNBC lesions and adjacent normal tissues were analyzed, and combined with TNBC data from the Cancer Genome Atlas Program (TCGA) breast cancer cohort, the gene KLHL29, which is lowly expressed in TNBC cancer tissue, was screened out. This demonstrated that the KLHL29 gene is a low-expression gene in TNBC cancer tissue and confirmed that it can serve as a therapeutic target.
[0054] like Figure 2 As shown, survival analysis was performed using the Kaplan-Meier Plotter online database, and TNBC tissue samples were further collected for immunohistochemical staining and survival analysis to clarify the prognostic value of KLHL29.
[0055] To verify the effect of KLHL29 on the biological phenotype of TNBC cells, such as Figure 3 As shown, the effects of KLHL29 on the proliferation and colony-forming ability of TNBC were detected by CCK-8 proliferation assay and plate colony formation assay, and the effect of KLHL29 on the apoptosis ability of TNBC was detected by flow cytometry. Figure 3 As shown in Figures A and B, the KLHL29 gene-mediated cell activity is stronger in the BT549 and CAL51 cancer cell lines.
[0056] Figure 4 This demonstrates the effect of KLHL29 on the in vivo growth of TNBC using a nude mouse orthotopic xenograft model.
[0057] To verify the interaction between KLHL29 and DDX3X, a protein immunoprecipitation assay combined with mass spectrometry was used to identify the interacting proteins of KLHL29. The results are as follows: Figure 5 As shown. Further, as... Figure 6As shown, differential expression analysis was performed using proteomics data from primary TNBC lesions and adjacent normal tissues in the FUSCC-TNBC cohort. The expression of DDX3X in different breast cancer subtypes was analyzed using proteomics data from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) to clarify the expression of DDX3X in TNBC.
[0058] The interaction between KLHL29 and DDX3X was verified by protein immunoprecipitation assay, and the results are as follows: Figure 7 As shown.
[0059] To explore the clinical translational value of KLHL29 and DDX3X, Western blotting was used to detect the inhibitory effect of the small molecule inhibitor RK33 on DDX3X expression. The results are as follows: Figure 8 As shown; the relationship between the expression levels of KLHL29 and DDX3X and the drug sensitivity of TNBC to the small molecule inhibitor RK33 was detected by drug sensitivity testing, and the results are as follows. Figure 9 As shown.
[0060] Furthermore, the combination therapy effect of RK33 and cisplatin in TNBC was detected by CCK-8 proliferation assay, and the experimental results are as follows: Figure 10 As shown in the figure. The effects of RK33 and cisplatin on the in vivo growth of TNBC were explored using a nude mouse tumor-bearing experiment. The results are as follows. Figure 11 As shown.
[0061] Based on the above research findings and experimental results, the following is an example of a molecular marker detection substance.
[0062] The molecular marker detection in this example includes primers for detecting the expression level of the KLHL29 gene or its encoded protein. In a typical embodiment, this includes a pair of specific amplification primers:
[0063] Upstream primer (F): 5'-GCAGAGCGAAAGCGTTTACAG-3'
[0064] Downstream primer (R): 5'-GCAGGTTCGACAGGACGAG-3'.
[0065] This disclosure also provides KLHL29 interacting proteins and DDX3X markers for detection.
[0066] This disclosure also provides various application methods for the above-mentioned markers used to detect the expression level of the KLHL29 gene or its encoded protein.
[0067] In one embodiment, the marker assay described above for detecting the expression level of the KLHL29 gene or its encoded protein is used to prepare a detection reagent for one or more uses selected from the following:
[0068] Used to predict chemotherapy resistance and prognosis in anti-breast cancer drugs.
[0069] Used to improve the combination of inhibitors and anti-breast cancer drugs.
[0070] According to the embodiments of this disclosure, in the above embodiments, the detection reagent detects the expression level of the KLHL29 gene or its protein, and predicts chemotherapy resistance and prognosis of anti-breast tumor drugs based on the expression level, wherein a lower expression level indicates a poor prognosis.
[0071] According to the embodiments of this disclosure, in the above embodiments, the expression level of the KLHL29 gene or its protein in human breast tumor tissue samples is detected by a detection reagent, and the dosage of the inhibitor is adjusted according to the expression level to improve the combined use of the inhibitor and anti-breast tumor drugs.
[0072] In the implementation of the above-mentioned test reagents, breast tumors specifically include breast cancer and its subtypes, especially triple-negative breast cancer; anti-breast tumor drugs include platinum-based drugs, especially cisplatin.
[0073] This disclosure provides an embodiment of a kit for breast cancer diagnosis or prognostic assessment, including a housing and a marker detection substance as described in the foregoing embodiments.
[0074] Optionally, the kit may also include one or more of the following reagents:
[0075] Pepsin, tissue fixative, prehybridization solution, oligonucleotide probe hybridization solution, blocking solution, biotinylated mouse anti-digoxigenin, SABC-POD, biotinylated peroxidase, DEPC, 3% citrate, 2×SSC, 0.5×SSC, 0.2×SSC, and PBS for in situ hybridization.
[0076] In a preferred embodiment, the kit may include, in addition to various primers, at least one of the following items: a carrying tool, the space of which is divided into a defined space for accommodating one or more containers, well plates or strips, such as kits, vials, test tubes, and the like, each container containing a separate component for detecting the expression level of the KLHL29 gene or its encoded protein as disclosed herein; and an instruction manual, which may be written on the vials, test tubes, and the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper document with an operation demonstration video app download window, such as a QR code. The instruction manual may also be in multimedia form, such as a CD, USB flash drive, cloud storage, etc.
[0077] According to embodiments of this disclosure, the above-described kit uses human breast tumor tissue samples as test samples.
[0078] In one embodiment of this disclosure, a use is provided for the KLHL29 gene or its encoded protein to construct a prognostic assessment model for triple-negative breast cancer, the prognostic assessment model being programmed and input into a computer or gene analyzer in the form of a mathematical software package.
[0079] In a preferred embodiment, the prognostic assessment model can output a prognostic reference value for triple-negative breast cancer. When the expression level of the KLHL29 gene or its protein is low, the prognostic assessment model outputs a reference value indicating a poor prognosis.
[0080] It should be understood that the modeling, training, programming, and parameters and weights used in each step of the above-mentioned prognostic assessment model can all be completed by technicians based on the technical ideas of the embodiments of this disclosure and relying on existing technology. The specific modeling, training, programming methods and details are not the focus of this application and will not be elaborated upon due to space limitations.
[0081] In one embodiment of this disclosure, a computer or gene analyzer configured with the above-described prognostic assessment model is provided.
[0082] In a typical embodiment, the above-mentioned computer or gene analyzer has:
[0083] The data acquisition module is configured to collect the expression level of the KLHL29 gene or its protein in the sample, and to record or output the expression level digitally to other modules. The collected samples were human breast tumor tissue samples.
[0084] The computational module is capable of executing prognostic assessment models and evaluating the prognosis of triple-negative breast cancer in subjects based on the expression level of the KLHL29 gene or its protein, as well as evaluating combination therapy with platinum-based drugs.
[0085] The storage module is used to save data such as the above-mentioned expression level and the prognostic evaluation reference values generated by the calculation module.
[0086] The aforementioned computer or gene analyzer may also have manual input devices, such as a keyboard and camera, as well as a display device for showing evaluation results, such as a screen. It may also include necessary buses, transceivers, and memory.
[0087] In one embodiment of this disclosure, a computer-readable storage medium is provided having a computer program stored thereon, which, when executed by a processor, is capable of running the above-described prognostic assessment model.
[0088] This disclosure also includes an embodiment of an inhibitor targeting the KLHL29-mediated signaling pathway, which can be used in combination with anti-breast cancer drugs to improve drug resistance to the anti-breast cancer drugs.
[0089] In a preferred embodiment, the inhibitor includes RK33, an inhibitor of the KLHL29 interacting protein DDX3X, which is applicable to triple-negative breast cancer, and the anti-breast cancer drug is cisplatin.
[0090] This disclosure also includes a targeted drug targeting KLHL29.
[0091] The specific experimental methods for each experiment mentioned above:
[0092] All reagents, instruments, or equipment mentioned below can be purchased and obtained from the market.
[0093] Reagents, software and equipment:
[0094]
[0095]
[0096]
[0097]
[0098] I. Cell Culture Experiment
[0099] Cell lines were cultured in DMEM or RPMI 1640 medium containing 10% fetal bovine serum and 5% penicillin-dextrose antibody, with insulin added as needed. Cells were cultured in a cell culture incubator at 37°C and 5% CO2.
[0100] 1. Cell resuscitation
[0101] Preheat a 37°C water bath. Remove the cells to be thawed from the −80°C freezer or liquid nitrogen tank, place them on a float plate, and thaw them quickly in a 37°C water bath. After thawing, centrifuge the cryovials at 800 rpm for 4 min, discard the supernatant, resuspend the cells in complete culture medium (containing FBS), and add the cell suspension to a 10 cm cell culture dish with 8 mL of complete culture medium.
[0102] 2. Cell passage
[0103] When the cell density is 80%-90%, passage is required. First, discard all the culture medium, add 1-2 mL of sterile PBS to rinse, discard the PBS, add an appropriate amount of trypsin, and after the cells become round and detach, stop digestion with complete culture medium. Transfer the cell suspension to a 5 mL centrifuge tube, centrifuge at 800 rpm for 4 min, discard the supernatant, resuspend the cells with 1 mL of complete culture medium, and add the cell suspension to a 10 cm cell culture dish with 8 mL of complete culture medium to complete passage or perform cell function experiments.
[0104] 3. Cell cryopreservation
[0105] After digesting and centrifuging the cells, discard the supernatant, resuspend the cells in an appropriate amount of cryopreservation solution, transfer them to cryovials, label them, and store them in a −80°C freezer or liquid nitrogen tank for long-term storage.
[0106] II. Cell Function Experiments
[0107] 1. CCK-8 proliferation experiment
[0108] Cells were trypsinized, digested with complete culture medium to stop the digestion, centrifuged, resuspended in 1 mL of culture medium, and then counted. During the counting process, 96-well plates were prepared, and 200 μL of PBS was added to the wells surrounding the 96-well plates. After counting, cell suspensions were prepared according to the count results, so that each 100 μL of suspension contained 1500-2500 cells. 100 μL of cell suspension was added to each well of the 96-well plate using a multipipe pipette, and 6 accessory wells were set up. From the first to the fifth day after plating, 10 μL of CCK-8 reagent was added to the 96-well plates at the same time each day, and the plates were incubated at 37°C for 1-4 hours. The absorbance at 450 nm was measured to assess the cell proliferation capacity.
[0109] 2. Plate cloning experiment
[0110] Cells were digested with trypsin, digestion was stopped with complete culture medium, centrifuged, and resuspended in 1 mL of culture medium before counting. During counting, six-well plates were prepared, PBS was added around the edges of the plates, and 2 mL of complete culture medium was added to each well. After counting, cell suspensions were prepared to contain 800-1000 cells per 100 μL, and 100 μL of the suspension was added to each well of the six-well plate, with three accessory wells. Colony formation was observed regularly, and complete culture medium was added every three days for 1-3 weeks in the six-well plates. After colony formation, all culture medium was discarded, PBS was added for washing, the PBS was discarded, and 2 mL of methanol crystal violet was added for staining. After staining, the cells were washed, dried, photographed, and counted.
[0111] 3. Apoptosis experiment
[0112] Prepare 5mL centrifuge tubes, collect all supernatant from six-well plates, wash with 1mL PBS, collect the PBS, then digest with 200μL trypsin, terminate digestion with complete culture medium, transfer to 5mL centrifuge tubes, and centrifuge at 1000rpm for 5min at room temperature. Discard the supernatant, add 3mL pre-chilled PBS (carefully rinsing the centrifuge tube walls, avoiding blowing onto the cells), gently resuspend the cells by blowing 10 times, and centrifuge again at 1000rpm for 5min at room temperature. Prepare 1.5mL centrifuge tubes for centrifugation and label them. After centrifugation, resuspend the cells with 1× Binding Buffer and transfer to 1.5mL centrifuge tubes. Add 7.5μL Annexin-V-PE reagent to each centrifuge tube, mix well, and incubate at room temperature in the dark for 15min. Add 7.5μL 7-AAD staining reagent to each centrifuge tube, mix well, and incubate at room temperature in the dark for 10min. Subsequently, dilute each sample with 300μL Binding Buffer, place on ice, and perform flow cytometry detection and data analysis.
[0113] III. Animal Experiments
[0114] 1. Tumor-bearing experiment in nude mice
[0115] The NOD / SCID nude mice used in this experiment were 4-6 week old females. MDA-MB-231 breast cancer cells were trypsinized, digested with complete culture medium to terminate the digestion, centrifuged, washed with sterile PBS, centrifuged again, resuspended in 1 mL PBS, and counted. Based on the cell count, a cell suspension was prepared using empty culture medium (medium:Matrix gel = 1:1), ultimately ensuring 1 × 10⁷ cells per 100 μL suspension. Using a 1 mL sterile syringe, 100 μL of the cell suspension was injected into the fat pads of the nude mice in a biosafety cabinet to complete the in vivo tumor-bearing experiment. After tumor formation, the mouse weight and tumor size were measured periodically. The tumor volume was calculated using the formula: length × width × width × 0.52. When the tumor reached a suitable size, the nude mice were sacrificed, the tumor was removed, weighed, and photographed. Some tumors were fixed with paraformaldehyde and embedded in paraffin, while the remaining tumors were preserved in liquid nitrogen for RNA and protein extraction.
[0116] 2. Drug Experiments
[0117] The BALB / c nude mice used in this experiment were 4-6 week old females. MDA-MB-231 breast cancer cells were digested with trypsin, digestion was terminated with complete culture medium, centrifuged, washed with sterile PBS, centrifuged again, resuspended in 1 mL PBS, and counted. Based on the cell count, a cell suspension was prepared using empty culture medium (medium:matrix = 1:1), ensuring 1 x 10⁷ cells per 100 μL suspension. Using a 1 mL sterile syringe, 100 μL of the cell suspension was injected into the fat pads of the nude mice in a biosafety cabinet to complete the in vivo tumor-bearing experiment. After tumor formation, the mouse weight and tumor size were measured periodically. Once the tumor reached a certain volume, drug treatment was administered. Drug treatment was divided into four groups: control group, RK33 monotherapy group, cisplatin monotherapy group, and combination therapy group. All drugs were administered intraperitoneally, with RK33 at a concentration of 20 mg / kg and cisplatin at a concentration of 3 mg / kg, administered three times a week. Mice were regularly weighed and their tumor size was measured. Once the tumor reached a suitable size, the mice were euthanized, the tumor was removed, weighed, and photographed. Some tumors were fixed in paraformaldehyde and embedded in paraffin, while the remaining tumors were preserved in liquid nitrogen for RNA and protein extraction.
[0118] IV. RNA extraction, reverse transcription, and qPCR experiments
[0119] 1. Extraction of cellular RNA (Trizol method): All experimental procedures involving RNA use RNase-free pipette tips and centrifuge tubes and are performed on ice.
[0120] (1) Cell RNA extraction: Discard the cell culture medium from which RNA was extracted, wash twice with PBS and discard the PBS, add 1 mL of RNAiso Plus to the culture dish, mix thoroughly by pipetting and transfer to a 1.5 mL centrifuge tube.
[0121] (2) Add 200 μL of chloroform, mix thoroughly by inverting, let stand on ice for 5 min, centrifuge at 14,500 rpm and 4°C for 15 min, and transfer 400 μL of the upper aqueous phase to a new 1.5 mL centrifuge tube.
[0122] (3) Add 500 μL of pre-cooled isopropanol, mix thoroughly by inverting, let stand on ice for 20 min, centrifuge at 14,500 rpm and 4°C for 15 min, a white precipitate will be visible at the bottom, discard the supernatant.
[0123] (4) Add 1 mL of 75% pre-cooled anhydrous ethanol (prepared with DEPC water), rinse by inverting the container until the precipitate is suspended (do not blow away the precipitate), centrifuge at 14,500 rpm and 4°C for 10 min, discard the supernatant, and repeat this step once.
[0124] (5) Use a large pipette tip to attach a small pipette tip to remove the supernatant, dry at room temperature for 10 minutes, wait for the ethanol to completely evaporate and the RNA to become translucent, add an appropriate amount of DEPC water to dissolve the RNA, use Nanodrop to measure the RNA concentration, and proceed to the next experiment or store at −80°C.
[0125] 2. Reverse transcription
[0126] The reverse transcription step was performed using the Nanjing Novizan HiScript III RT SuperMix for qPCR (+gDNA wiper) transcription kit.
[0127] (1) Genomic DNA removal
[0128]
[0129] After preparing the reaction system, place it in a PCR instrument and react at 42°C for 2 hours.
[0130] (2) Reverse transcription reaction
[0131]
[0132] After preparing the reaction system, place it in a PCR instrument and set the reaction conditions as follows: 37°C for 15 min, 85°C for 5 s, and maintain at 4°C.
[0133] 3. qPCR reaction
[0134] qPCR reactions were performed using the Nanjing Novizan ChamQ SYBR qPCR Mater Mixes kit.
[0135] (1) Add 180 μL of DEPC water to 20 μL of reverse transcribed cDNA for a 10-fold dilution;
[0136] (2) qPCR primer design: qPCR primers were designed based on PrimerBank. The primers used in this section were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and their specific sequences are as follows:
[0137] PrimerSequences (5'-3')
[0138] GAPDH-FGGAGCGAGATCCCTCCAAAAT
[0139] GAPDH-RGGCTGTTGTCATACTTCTCATGG
[0140] ACTB-FCATGTACGTTGCTATCCAGGC
[0141] ACTB-RCTCCTTAATGTCACGCACGAT
[0142] KLHL29-FGCAGAGCGAAAGCGTTTACAG
[0143] KLHL29-RGCAGGTTCGACAGGACGAG
[0144] (3) Prepare the qPCR reaction system. Prepare the reaction system according to the kit instructions as follows:
[0145]
[0146] After preparing the reaction system, load the samples into a 384-well plate according to experimental requirements. After sealing the plate, centrifuge at 2,000 rpm at room temperature for 1 min, and then perform qPCR under the following conditions:
[0147]
[0148] (4) Compare the ct value of the target gene with the ct value of the internal reference gene to obtain a quantitative indicator, namely the expression level of the target gene.
[0149] V. Protein Immunoassay (WB, Western Blotting)
[0150] 1. Sample preparation
[0151] Prepare RIPA or Lysis lysis buffer, and add appropriate amounts of protease inhibitors, phosphatase inhibitors, EDTA, and PMSF as needed. Discard the culture medium from the cells from which proteins were extracted. Wash the cells twice with PBS and discard the PBS. Add an appropriate amount of the prepared RIPA or Lysis buffer, scrape off the cells with a cell scraper, and transfer them to 1.5 mL centrifuge tubes. Incubate on ice for at least 40 min, shaking thoroughly during this time. After lysis, centrifuge at 14,500 rpm at 4°C for 15 min, and transfer the supernatant to a new 1.5 mL centrifuge tube.
[0152] 2. Protein quantification
[0153] Protein quantification was performed using a BCA (Bioassay Acetate) kit. A BCA mixture was prepared at a 49:1 ratio (solution A:solution B), and 100 μL of the mixture was added to each well of a 96-well plate. Pre-prepared standards, stored at 4°C, were added at concentrations of 2 μg / μL, 1 μg / μL, 0.5 μg / μL, 0.25 μg / μL, and 0.125 μg / μL, with 4 μL of standard added to each well, and two auxiliary wells were set up. For the remaining wells, 2 μL of the target protein was added to each well, and two auxiliary wells were set up. After incubation at 37°C for 30 min, the absorbance was measured using a microplate reader at OD 562 nm. A standard curve was plotted based on the absorbance, and the concentration of the target protein was calculated. Prepare the target protein at the same concentration to facilitate subsequent sample loading. Add an appropriate amount of 5 × SDSLoading Buffer according to the calculation results, mix well, and boil the sample in a 100°C metal bath. After boiling, immediately transfer the sample to the next experiment or store it at −80°C. Before loading, vortex the sample to ensure it is thoroughly mixed.
[0154] 3. Polyacrylamide gel electrophoresis (SDS-PAGE electrophoresis)
[0155] (1) Preparation of SDS-PAGE gel:
[0156] The prepared gel can be used directly for the next experiment or stored at 4°C.
[0157] (2) Sample loading
[0158] Assemble the prepared gel into the electrophoresis tank and add electrophoresis buffer. Then, directly load the quantified and boiled protein sample (20-100 μg) into the gel wells.
[0159] (3) Electrophoresis
[0160] After loading the sample and protein marker, start gel electrophoresis. Begin with a voltage of 60V, and once the sample reaches the separating gel, adjust the voltage to 125V and continue electrophoresis. Stop electrophoresis when the bromophenol blue reaches the bottom.
[0161] (4) Transfer membrane
[0162] The transfer solution needs to be pre-cooled. Activate the cut PVDF membrane in methanol. Prepare the transfer tank and ice plate. Begin the transfer process. The "sandwich system" for the transfer should be arranged in the order of "sponge-filter paper-gel-PVDF membrane-filter paper-sponge" in the transfer tank. Pay attention to the order of arrangement, and ensure there are no air bubbles in the gel and PVDF membrane. The transfer conditions are: constant current 300mA for 100 min.
[0163] (5) Closed
[0164] After the transfer was completed, the PVDF membrane was rinsed once with 1 × TBST and then blocked with 5% skim milk for 1 hour.
[0165] (6) Primary antibody incubation
[0166] After the transfer was completed, the PVDF membrane was rinsed once with 1 × TBST to remove residual milk. The membrane was then cut according to the corresponding strip positions and incubated with the corresponding primary antibody. The membrane was then incubated overnight on a horizontal shaker at 4°C.
[0167] (7) Washing the film
[0168] After primary antibody incubation, the PVDF membrane was washed four times with 1 × TBST for 10 min each time.
[0169] (8) Secondary Antibody Inoculation
[0170] Apply the corresponding secondary antibody and incubate at room temperature on a horizontal shaker for 1 hour.
[0171] (9) Washing the film
[0172] After primary antibody incubation, the PVDF membrane was washed four times with 1 × TBST for 10 min each time.
[0173] (10) Exposure
[0174] Prepare the ECL chemiluminescence solution, expose the strips on the machine, and analyze the results.
[0175] VI. Immunohistochemistry (IHC)
[0176] 1. Baked slices
[0177] Place the paraffin slices in a 65°C oven and bake for 2 hours.
[0178] 2. Dewaxing and hydration
[0179] Place the slide into each reagent in the following order: xylene-anhydrous ethanol-95% ethanol-90% ethanol-80% ethanol-75% ethanol-distilled water, for 10 minutes.
[0180] 3. Rinse
[0181] Rinse the slides under running water for 15 minutes, being careful not to let the front of the slides touch the water.
[0182] 4. Antigen repair
[0183] Place the slides in sodium citrate buffer / EDTA and heat to boiling, then heat on the lowest setting for 15 minutes, and allow to cool naturally to room temperature. Wash three times with 1× PBS, 5 minutes each time.
[0184] 5. Primary antibody incubation
[0185] Blot the PBS and excess moisture with a paper towel, outline the tissue area with an immunohistochemistry pen, add an appropriate amount of primary antibody working solution according to the size of the tissue area, and incubate overnight at 4°C.
[0186] 6. Secondary antibody incubation
[0187] After the primary antibody incubation is complete, discard the primary antibody, wash three times with 1 × PBS for 5 min each time, discard the PBS, add the secondary antibody, and incubate at 37°C for 30 min.
[0188] 7. Color Development
[0189] After the secondary antibody incubation is complete, discard the secondary antibody, wash three times with 1×PBS for 5 min each time, discard the PBS, add the colorimetric reagent DAB, incubate at room temperature for 5 min, terminate the colorimetric reaction in 1×PBS, and wash three times with 1×PBS for 5 min each time.
[0190] 8. Re-dyeing
[0191] After washing with PBS, counterstaining was performed using hematoxylin staining solution.
[0192] 9. Dehydration
[0193] Place the slide into each reagent in the following order: 75% ethanol - 85% ethanol - 90% ethanol - 95% ethanol - anhydrous ethanol - xylene, for 5-10 minutes.
[0194] 10. Sealing
[0195] Add the mounting medium and coverslip, then place the sealed slide in a fume hood to dry, and observe the staining under a microscope.
[0196] 11. Assessment
[0197] The immunohistochemical score is the product of the cell staining intensity score and the percentage of positive cells score. The cell staining intensity score is divided into four grades: negative (0 points), light yellow (weakly positive) (1 point), brownish-yellow (positive) (2 points), and brownish-red (strongly positive) (3 points). The percentage of positive cells is also divided into four grades: no positive cells (0 points), <10% (1 point), 10-50% (2 points), and >50% (3 points).
[0198] In summary, this disclosure presents for the first time a specific biomarker related to the diagnosis and treatment of breast cancer, namely the KLHL29 gene and its encoded protein. The KLHL29 gene is expected to become a molecular biomarker for diagnosing breast cancer and for detecting chemotherapy resistance in breast cancer, and will provide new insights into the molecular mechanisms of breast cancer development and drug resistance.
[0199] Based on large-sample transcriptome sequencing and combined with bioinformatics analysis, effective therapeutic targets for triple-negative breast cancer were screened. The differential expression of KLHL29 in triple-negative breast cancer and adjacent non-cancerous tissues was investigated. Breast cancer can be diagnosed by detecting the expression levels of the KLHL29 gene and its encoded protein. Therefore, this disclosure provides a breast cancer auxiliary diagnostic kit containing the KLHL29 gene or the protein encoded by KLHL29. The method of diagnosing breast cancer by detecting gene expression levels is more sensitive and specific, which is beneficial for early diagnosis. Simultaneously, the roles and molecular mechanisms of KLHL29 and DDX3X in the development and progression of triple-negative breast cancer were clarified. Focusing on their clinical translational value, potential drug therapeutic targets for triple-negative breast cancer were discovered, and inhibitors targeting the mechanisms involved in the target genes were applied for clinical translation. This provides a theoretical basis for the selection of breast cancer therapeutic targets and offers new treatment options for patients with triple-negative breast cancer.
[0200] Based on the foregoing, those skilled in the art will understand that the technical solutions claimed in this disclosure and their equivalents will be readily apparent. Furthermore, those skilled in the art can make appropriate modifications and alterations to the disclosed technical solutions as needed, and these modifications and improvements are also within the scope of protection of the claims in this disclosure.
Claims
1. Use of a marker detection agent comprising primers for detecting the expression level of the KLHL29 gene in the manufacture of a kit for the diagnosis or prognosis evaluation of triple negative breast cancer.
2. Use according to claim 1, characterized in that, The marker detection agent comprises a pair of specific amplification primers: upstream primer (F): 5'-GCAGAGCGAAAGCGTTTACAG-3' downstream primer (R): 5'-GCAGGTTCGACAGGACGAG-3'.