A kit, and a method for detecting the extent of cell damage
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-10
- Publication Date
- 2026-08-11
AI Technical Summary
[0004]目前常用的细胞损伤程度检测方法主要依赖荧光显微成像,无法在单细胞层面检测细胞的损伤程度、也无法在鉴定细胞损伤程度的同时高通量地获得单细胞层面的转录组信息
[0027] The kit provided by this invention uses biotin-labeled Annexin V or its analogues linked to a biotin-labeled cell membrane damage indicator sequence via avidin. The biotin-labeled Annexin V specifically binds to phosphatidylserine residues exposed on the cell membrane surface during cell death. Thus, Annexin V or its analogues linked to the cell membrane damage indicator sequence are attached to the cell membrane surface of the test cells via phosphatidylserine, resulting in each test cell carrying a different number of cell membrane damage indicator sequences, thus producing a test solution. Single-cell sequencing of the test solution allows for the detection of the real-time damage level of a single test cell while simultaneously obtaining its transcriptome. Furthermore, adding the test solution to a quantitative real-time PCR reaction system allows for the measurement of cell damage at a large cellular level. Therefore, the kit provided by this invention is of significant importance for drug development, pathological detection, and research on developmental processes.
Smart Images

Figure CN116773805B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of detection kit technology, and in particular to a kit and a method for detecting the degree of cell damage. Background Technology
[0002] The assessment of the degree of cell damage has wide applications in tissue development research and tumor drug development. Commonly used methods for detecting the degree of cell damage include the detection of cell membrane damage, the detection of nuclear morphology and genomic DNA fragmentation, the detection of mitochondrial membrane potential, and the detection of biochemical molecular tags.
[0003] The detection of cell damage and death has important applications in drug development, pathological examination, and the detection of apoptosis during development. In drug development, for tumor cells with complex composition and high cellular heterogeneity, sensitive detection of cellular responses to drug treatment at the single-cell level, combined with analysis of the single-cell transcriptome to elucidate the drug's mechanism of action, is crucial for drug mechanism discovery and target identification. In developmental biology research, reflecting spontaneous apoptosis and damage processes during cell development at the single-cell level plays a vital role in elucidating the molecular mechanisms of organ development.
[0004] Currently, commonly used methods for detecting cell damage primarily rely on fluorescence microscopy, which cannot detect the degree of cell damage at the single-cell level, nor can they obtain high-throughput transcriptome information at the single-cell level while identifying the degree of cell damage. Summary of the Invention
[0005] The main objective of this invention is to provide a reagent kit and a method for detecting the degree of cell damage, aiming to provide a reagent kit that can detect the degree of cell damage at the single-cell level and obtain transcriptome information at the single-cell level in high throughput.
[0006] To achieve the above objectives, in a first aspect, the present invention provides a kit comprising: a first reagent comprising a cell membrane damage indicator sequence labeled with biotin or its analogues, wherein the cell membrane damage indicator sequence comprises a barcode nucleotide sequence specifically indicating the degree of cell damage;
[0007] The second reagent comprises a first substance labeled with a marker, said marker comprising biotin or an analogue thereof, and the first substance comprising Annexin V or an analogue thereof; and,
[0008] The third reagent includes avidin or its analogues.
[0009] Secondly, the present invention also provides a kit comprising:
[0010] Reagent R1 includes a cell membrane damage indicator sequence labeled with biotin or its analogues, said cell membrane damage indicator sequence comprising a barcode nucleotide sequence specifically indicating the degree of cell damage;
[0011] Reagent R2 comprises a fusion protein of a first substance and a second substance, wherein the first substance comprises Annexin V or an analogue thereof, and the second substance comprises avidin or an analogue thereof.
[0012] Thirdly, the present invention also proposes a kit comprising a cell membrane damage indicator complex, the cell membrane damage indicator complex comprising a first substance labeled by a marker, a second substance, and a cell membrane damage indicator sequence labeled by biotin or an analogue thereof, connected in sequence.
[0013] The markers include biotin or biotin analogues, the first substance includes Annexin V or biotin analogues, and the second substance includes avidin or avidin analogues.
[0014] The cell membrane damage indicator sequence includes a barcode nucleotide sequence that specifically indicates the degree of cell damage.
[0015] Optionally, the cell membrane damage indicator sequence labeled with biotin or its analogues further includes a first primer binding sequence, one end of which is connected to the biotin or its analogues, and the other end of which is connected to the barcode nucleotide sequence.
[0016] Optionally, the cell membrane damage indicator sequence further includes a second primer-binding sequence and a polyadenylated tail sequence, wherein the cell membrane damage indicator sequence comprises a first primer-binding sequence, a barcode nucleotide sequence, a polyadenylated tail sequence, and a second primer-binding sequence connected in sequence.
[0017] Optionally, the avidin includes streptavidin.
[0018] To achieve the above objectives, the present invention also proposes a method for detecting the degree of cell damage, the method comprising the following steps:
[0019] S10. A kit is provided, the kit comprising: a first reagent comprising a cell membrane damage indicator sequence labeled with biotin or its analogue, the cell membrane damage indicator sequence comprising a barcode nucleotide sequence specifically indicating the degree of cell damage; a second reagent comprising Annexin V or its analogue labeled with biotin or its analogue; and a third reagent comprising avidin or its analogue.
[0020] S20. The first substance labeled with the marker, avidin or its analogue, and the cell membrane damage indicator sequence labeled with biotin are mixed and incubated to obtain a mixture. The mixture is then purified to obtain a purified cell membrane damage indicator complex. The marker includes biotin or its analogue, and the first substance includes Annexin V or its analogue.
[0021] S30. After incubating the purified cell membrane damage indicator complex with the test cells, the test cells are washed to obtain labeled cells;
[0022] S40. After resuspending the labeled cells, test the number of cell membrane damage indicator sequences bound to the labeled cells to obtain the degree of cell membrane damage.
[0023] Optionally, step S40 includes:
[0024] The labeled cells are subjected to single-cell sequencing. The number of cell membrane damage indicator sequences bound to a single cell is obtained based on the sequencing results, thereby determining the degree of cell damage in a single cell.
[0025] Optionally, step S40 includes:
[0026] The labeled cells were resuspended and then added to a real-time PCR reaction system for measurement. The number of cell membrane damage indicator sequences bound to each cell was calculated based on the measured fluorescence signal, thereby obtaining the degree of cell damage.
[0027] The kit provided by this invention uses biotin-labeled Annexin V or its analogues linked to a biotin-labeled cell membrane damage indicator sequence via avidin. The biotin-labeled Annexin V specifically binds to phosphatidylserine residues exposed on the cell membrane surface during cell death. Thus, Annexin V or its analogues linked to the cell membrane damage indicator sequence are attached to the cell membrane surface of the test cells via phosphatidylserine, resulting in each test cell carrying a different number of cell membrane damage indicator sequences, thus producing a test solution. Single-cell sequencing of the test solution allows for the detection of the real-time damage level of a single test cell while simultaneously obtaining its transcriptome. Furthermore, adding the test solution to a quantitative real-time PCR reaction system allows for the measurement of cell damage at a large cellular level. Therefore, the kit provided by this invention is of significant importance for drug development, pathological detection, and research on developmental processes. Attached Figure Description
[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0029] Figure 1 This is a schematic diagram of a biotin-labeled cell membrane damage indicator sequence in one embodiment of the present invention;
[0030] Figure 2 This is a partial structural diagram of a labeled cell in one embodiment of the present invention;
[0031] Figure 3 The figure shows the experimental results of labeling MCF7 cells with different concentrations of the tumor chemotherapy drug topotecan using the cell membrane damage indicator complex in Example 3 of the present invention.
[0032] Figure 4 The figure shows the results of single-cell RNA sequencing experiments of MCF7 cells treated with different concentrations of the tumor chemotherapy drug toltratecan after being labeled with the cell membrane damage indicator complex in Example 4 of this invention.
[0033] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0035] Furthermore, the meaning of "and / or" throughout the text includes three parallel solutions. Taking "A and / or B" as an example, it includes solution A, solution B, or a solution that simultaneously satisfies A and B. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or impossible to implement, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention.
[0036] Currently, commonly used methods for detecting cell damage primarily rely on fluorescence microscopy, which cannot detect the degree of cell damage at the single-cell level, nor can they obtain high-throughput transcriptome information at the single-cell level while identifying the degree of cell damage.
[0037] In view of this, the present invention proposes a kit that can detect the degree of cell damage at the single-cell level and obtain transcriptome information at the single-cell level in high throughput.
[0038] In a first embodiment, the kit includes a first reagent, a second reagent, and a third reagent. The first reagent includes a cell membrane damage indicator sequence labeled with biotin or its analogues, the cell membrane damage indicator sequence including a barcode nucleotide sequence specifically indicating the degree of cell damage. The second reagent includes a first substance labeled with a marker, the marker including biotin or its analogues, the first substance including Annexin V or its analogues. The third reagent includes avidin or its analogues.
[0039] Cell membrane damage is a characteristic of cell death (including apoptosis and necrosis), therefore, we can indirectly detect the degree of cell damage and death by detecting the extent of cell membrane damage. In normal cells, phosphatidylserine (PS) is located on the inner side of the cell's lipid bilayer membrane. When cell death occurs, phosphatidylserine flips to the outer side of the cell membrane. Annexin V can specifically bind to phosphatidylserine, a property that allows it to serve as an indicator signal of the degree of cell death.
[0040] Single-cell sequencing technology has greatly advanced research in systems biology, enabling high-throughput, single-cell-level analysis of the transcriptome to reveal numerous cell types and finely differentiate their subtle differences. Single-cell sequencing technology provides a powerful tool for systems biology research in drug development and target discovery.
[0041] The kit provided by this invention uses biotin (or its analogues)-labeled Annexin V or its analogues linked to a biotin (or its analogues)-labeled cell membrane damage indicator sequence via avidin. The biotin (or its analogues)-labeled Annexin V specifically binds to phosphatidylserine residues exposed on the cell membrane surface during cell death. Thus, Annexin V or its analogues linked to the cell membrane damage indicator sequence are attached to the cell membrane surface of the test cells via phosphatidylserine residues, resulting in each test cell carrying a different number of cell membrane damage indicator sequences, thus producing a test solution. Single-cell sequencing of the test solution allows for the detection of the real-time damage level of a single test cell while simultaneously obtaining its transcriptome. Furthermore, adding the test solution to a quantitative real-time PCR reaction system allows for measurement at the level of a large number of cells to reflect the degree of cell damage. Therefore, the kit provided by this invention is of great significance for drug development, pathological detection, and research on developmental processes.
[0042] Specifically, the kit provided by this invention is of great significance in discovering and verifying genes that play a key role in cell damage and death caused by various reasons such as drug treatment, radiotherapy, pathological processes, and tissue and organ development.
[0043] Understandably, intact cells carry a lower number of cell membrane damage indicator sequences, while the number of these sequences gradually increases in cells undergoing cell death. Furthermore, before performing single-cell sequencing, the kit needs to be pretreated to link biotin-labeled Annexin V or its analogues with biotin-labeled cell membrane damage indicator sequences via avidin (or its analogues), resulting in a cell membrane damage indicator complex.
[0044] In a second embodiment, the kit includes reagent R1 and reagent R2. Reagent R1 includes a cell membrane damage indicator sequence labeled with biotin or its analogues, the cell membrane damage indicator sequence including a barcode nucleotide sequence that specifically indicates the degree of cell damage. Reagent R2 includes a fusion protein of a first substance and a second substance, the first substance including Annexin V or its analogues, and the second substance including avidin or its analogues.
[0045] Unlike the first embodiment, the kit in this embodiment expresses Annexin V (or its analogues) in fusion with avidin (or its analogues). Thus, Annexin V or its analogues do not require biotin labeling to be linked with avidin or its analogues, and the resulting fusion protein can be linked with a cell membrane damage indicator sequence labeled with avidin (or its analogues) and biotin (or its analogues).
[0046] It is understood that the kit provided in this embodiment is similar in principle to the kit provided in the first embodiment. It also involves linking Annexin V or its analogues, which are linked with cell membrane damage indicator sequences, to the cell membrane surface of the cell to be tested via phosphatidylserine, and then performing single-cell sequencing. This will not be elaborated further here.
[0047] In a third embodiment, the kit includes a cell membrane damage indicator complex, which comprises a first substance labeled with a marker, a second substance, and a cell membrane damage indicator sequence labeled with biotin or an analogue thereof, connected in sequence; wherein the marker includes biotin or an analogue thereof, the first substance includes Annexin V or an analogue thereof, the second substance includes avidin or an analogue thereof, and the cell membrane damage indicator sequence includes a barcode nucleotide sequence that specifically indicates the degree of cell damage.
[0048] Unlike the first and second embodiments, the reagent in the kit in this embodiment is a complex, which is prepared by incubating avidin or its analogues, Annexin V labeled with biotin or its analogues, and a cell membrane damage indicator sequence labeled with biotin or its analogues.
[0049] It is understood that the kit provided in this embodiment is similar in principle to the kit provided in the first embodiment. It also involves linking Annexin V or its analogues, which are linked with cell membrane damage indicator sequences, to the cell membrane surface of the cell to be tested via phosphatidylserine, and then performing single-cell sequencing. This will not be elaborated further here.
[0050] Please see Figure 1 The cell membrane damage indicator sequence is essentially a nucleic acid tag. Each position in the barcode nucleotide sequence can be any base of A, T, C, or G. Specific barcode nucleotide sequences can be obtained through base arrangement. These barcode nucleotide sequences are characteristic sequences of the cell membrane damage indicator sequences in the sample. Their length and sequence can be designed arbitrarily, preferably 8-10 bases in length. Barcode nucleotide sequences that are too short will lack specificity and fail to accurately identify the cell membrane damage in single-cell sequencing, while sequences that are too long will result in unnecessary waste. In one embodiment, the nucleotide sequence of the barcode nucleotide sequence is GGTTTACT.
[0051] Based on the above embodiments, the cell membrane damage indicator sequence labeled with biotin or its analogues further includes a first primer binding sequence, one end of which is connected to the biotin or its analogues, and the other end is connected to the barcode nucleotide sequence.
[0052] The first primer binding sequence is used for subsequent PCR amplification of cell membrane damage indicator sequences, and its length is generally between 16 and 28 bases. The design of the first primer binding sequence must follow primer design principles. This invention does not limit the specific nucleotide sequence of the first primer binding sequence. In one embodiment, the nucleotide sequence of the first primer binding sequence is GAGGACGCTATGCCTGTACC.
[0053] Specifically, the cell membrane damage indicator sequence is linked to a cell tag in single-cell sequencing. The cell tag is linked to both intracellular RNA and the cell membrane damage indicator sequence, and libraries are constructed and sequenced separately. After obtaining the sequencing results of each library, the sequencing results of endogenous mRNA in the cell can be correlated with the quantitative results of the cell membrane damage indicator sequence through the cell tag sequence, thereby quantitatively determining the degree of cell damage in each single cell.
[0054] Furthermore, the cell membrane damage indicator sequence further includes a second primer-binding sequence and a polyadenylated tail sequence. The cell membrane damage indicator sequence comprises a first primer-binding sequence, a barcode nucleotide sequence, a polyadenylated tail sequence, and a second primer-binding sequence connected in sequence.
[0055] In single-cell mRNA sequencing, the cell tag carries a polythymidine sequence (i.e., poly-T). By designing a polyadenylated tail (i.e., poly-A tail) sequence on the cell membrane damage indicator sequence, the cell membrane damage indicator sequence can bind to the cell tag sequence during single-cell mRNA sequencing. This allows sequencing of the sequencing material with the cell tag and the cell membrane damage indicator sequence with the cell tag to be sequenced separately. The degree of cell damage corresponding to the sequencing material can be determined based on the same cell tag.
[0056] In this embodiment, the second primer-binding sequence also needs to follow primer design principles. This second primer-binding sequence is used to subsequently connect with the cell tag in single-cell sequencing through complementary base pairing. During single-cell sequencing, the cell tag connects to intracellular RNA and cell membrane damage indicator sequences, and then performs library construction and sequencing respectively. After obtaining the sequencing results of each library, the sequencing results of intracellular endogenous RNA and the quantitative results of cell membrane damage indicator sequences can be correlated using the cell tag sequence, thereby quantitatively determining the degree of cell damage in each single cell.
[0057] Depending on the library preparation kit chosen, there are various library preparation methods for single-cell sequencing. The second primer binding sequence must be changed accordingly based on the different library preparation methods. Therefore, this invention does not limit the specific sequence of the second primer binding sequence; the corresponding second primer binding sequence can be designed based on the library preparation method of single-cell sequencing. In this embodiment, the nucleotide sequence of the second primer binding sequence is: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC.
[0058] Furthermore, the first primer-binding sequence may include a random sequence between the first primer-binding sequence and the barcode nucleotide sequence, and between the second primer-binding sequence and the polyadenylate tail sequence, to increase the length of the cell membrane damage indicator sequence, thereby increasing the recovery efficiency of the cell membrane damage indicator sequence in subsequent single-cell sequencing.
[0059] In one embodiment, the nucleotide sequence of the cell membrane damage indicator sequence is shown in SEQ ID NO: 1. Specifically, GAGGACGCTATGCCTGTACC is the first primer-binding sequence; GGTTTACT is the barcode nucleotide sequence; B (degenerate base symbol) is a single base representing C, T, or G; AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA is the polyadenylate tail sequence; and CTGTCTCTTATACACATCTCCGAGCCCACGAGAC is the second primer-binding sequence.
[0060] Each avidin molecule consists of four subunits, allowing it to bind tightly to four biotin molecules. Preferably, the avidin is streptavidin, which has higher binding specificity to biotin. Please refer to [link to relevant documentation]. Figure 2 Streptavidin is a tetrameric protein with a size of 66 kDa. One molecule of streptavidin can bind to four molecules of biotin with high specificity; the affinity between the two is extremely strong. The dissociation constant of the streptavidin-biotin complex is on the order of 10 mol / L. The molecular formula of streptavidin is C2. 14 H 17 BrClNO2S has the structure shown in formula (Ⅰ):
[0061]
[0062] Annexin V, with a molecular weight of approximately 36 kDa, can specifically bind to phosphatidylserine molecules exposed on the cell membrane surface during cell membrane damage. Cell death is usually accompanied by cell membrane damage, and as the cell death process progresses, the degree of cell membrane damage becomes more severe, leading to the binding of more Annexin V protein. Therefore, Annexin V can be used to indicate the degree of cell death.
[0063] Preferably, the molar ratio of the biotin-labeled Annexin V or its analogue, the streptavidin or its analogue, to the biotin-labeled cell membrane damage indicator sequence is 1:1:4. Of course, other ratios are also possible, as long as they do not affect the function of the complex.
[0064] It should be noted that this invention does not limit the specific structure of biotin or its analogues, as long as the analogue can be linked to avidin. Similarly, this invention does not limit the specific structure of avidin or its analogues, as long as the analogue can be linked to biotin or its analogues. Furthermore, this invention does not limit the specific structure of Annexin V or its analogues, as long as the analogue can be linked to phosphatidylserine.
[0065] The present invention also proposes a method for detecting the degree of cell damage. In one embodiment, the detection method includes the following steps:
[0066] Step S10: Provide the reagent kit described in the first embodiment.
[0067] The kit includes a first reagent, a second reagent, and a third reagent. The first reagent includes a cell membrane damage indicator sequence labeled with biotin or its analogues, the cell membrane damage indicator sequence including a barcode nucleotide sequence that specifically indicates the degree of cell damage. The second reagent includes Annexin V or its analogues labeled with biotin or its analogues. The third reagent includes avidin or its analogues.
[0068] Step S20: Mix the first substance labeled with the marker, avidin or its analogue, and the cell membrane damage indicator sequence labeled with biotin, and incubate to obtain a mixture. Purify the mixture to obtain a purified cell membrane damage indicator complex. The marker includes biotin or its analogue, and the first substance includes Annexin V or its analogue.
[0069] Specifically, avidin or its analogues, biotin-labeled Annexin V, were dissolved in 50% glycerol, and a biotin-labeled cell membrane damage indicator sequence was dissolved in double-distilled water. Appropriate concentrations were prepared separately, and then incubation was performed to obtain a mixture. In this embodiment, the incubation conditions were room temperature incubation for 10 minutes.
[0070] The purification process includes: adding the mixture to 300 μL of PBS (phosphate buffer), adding it to an ultrafiltration purification tube purchased from Millipore (placed in the collection tube), centrifuging at 14000g for 4 minutes at 4°C, discarding the filtrate in the collection tube, adding 300 μL of PBS, and repeating this process 8 times; replacing the collection tube, inverting the purification tube in the collection tube, centrifuging at 3000g for 2 minutes at 4°C, and replenishing the liquid in the collection tube to the original volume (volume of the mixture) with PBS, which is the purified cell membrane damage indicator complex.
[0071] Step S30: After incubating the purified cell membrane damage indicator complex with the test cells, wash the test cells to obtain labeled cells.
[0072] After labeling the test cells, they acquire cell membrane damage indicator sequences, allowing for clear differentiation of the degree of damage in subsequent single-cell sequencing. The step of washing the test cells includes washing them three times with PBS to remove excess cell membrane damage indicator complexes.
[0073] Step S40: After resuspending the labeled cells, test the number of cell membrane damage indicator sequences bound to the labeled cells to obtain the degree of cell membrane damage.
[0074] In one embodiment, step S40 includes: performing single-cell sequencing on the labeled cells, obtaining the number of cell membrane damage indicator sequences bound to a single cell based on the sequencing results, thereby obtaining the degree of cell damage in a single cell.
[0075] This invention imbues cells in a sample with cell membrane damage indicator sequences before single-cell RNA sequencing, enabling clear and quantitative differentiation of the degree of damage in individual cells during subsequent single-cell RNA sequencing. This detection method is simple and convenient to operate, provides clear differentiation of cell damage, and is highly helpful for research such as identifying molecular targets for drugs at the single-cell level.
[0076] In another embodiment, step S40 includes: resuspending the labeled cells, then adding them to a quantitative real-time PCR reaction system for measurement, and calculating the number of cell membrane damage indicator sequences on each cell based on the measured fluorescence signal, thereby obtaining the degree of cell damage. By employing the above steps, the degree of cell damage can be reflected at the level of a large number of cells.
[0077] Therefore, the kit provided by this invention can not only reflect the degree of cell damage at the level of a large number of cells, but also clearly quantify the degree of damage to individual cells, and users can select the corresponding detection steps according to their needs.
[0078] Of course, the method for detecting the degree of cell damage provided by the present invention can also use the kit described in the second or third embodiment. When the kit described in the second embodiment is used, step S20 is adapted. When the kit described in the third embodiment is used (i.e., the kit includes a cell membrane damage indicator complex, wherein the cell membrane damage indicator complex includes Annexin V labeled with biotin or its analogue, avidin or its analogue, and a cell membrane damage indicator sequence labeled with biotin or its analogue in sequence), step S20 is removed.
[0079] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.
[0080] Example 1 Reagent Kit
[0081] The kit includes:
[0082] First reagent: Biotin-labeled cell membrane damage indicator sequence (e.g.) Figure 1 The cell membrane damage indicator sequence (shown) was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The cell membrane damage indicator sequence comprises a first primer binding sequence, a barcode nucleotide sequence, a polyadenylate tail sequence and a second primer binding sequence connected in sequence, wherein the nucleotide sequence of the cell membrane damage indicator sequence is shown in SEQ ID NO: 1.
[0083] The second reagent: biotin-labeled Annexin V (manufacturer: Biolegend, catalog number 640904); and,
[0084] Third reagent: Streptavidin (manufacturer: Beijing Coollab Technology Co., Ltd., product number CS10471);
[0085] The molar ratio of the biotin-labeled Annexin V, the streptavidin, and the biotin-labeled cell membrane damage indicator sequence is 1:1:4.
[0086] Example 2: Detection of cell damage at a large cell level
[0087] (1) Provide the kit described in Example 1;
[0088] (2) Cell preparation: Add different concentrations of DNA tootecan, an inhibitor of DNA tootecan, to adherent MCF7 cells and culture them together with control cells without the drug for 24 hours to obtain the test cells;
[0089] (3) Preparation of cell membrane damage indicator complex: 1.4 μM biotin-labeled Annexin V, 1.6 μM streptavidin and 1 μM cell membrane damage indicator sequence were mixed in a molar ratio of 1:1:4. After mixing, the mixture was placed at room temperature for 10 minutes to obtain a mixture. 300 μL of phosphate-buffered saline (PBS) was added to the mixture. The mixture was then placed in a Millipore ultrafiltration purification tube (placed in the collection tube), catalog number UFC510008. The tube was centrifuged at 14000g for 4 minutes at 4°C. The filtrate in the collection tube was discarded. 300 μL of PBS was added. This process was repeated 8 times. The collection tube was replaced, the purification tube was inverted in the collection tube, and the tube was centrifuged at 3000g for 2 minutes at 4°C. The liquid in the collection tube was then replenished to the original volume with PBS. This is the purified cell membrane damage indicator complex.
[0090] (4) Labeling cells: Add purified 10 nM cell membrane damage indicator complex (calculated as Annexin V) to the experimental group and control group cells cultured with the drug, dissolve it in Annexin V binding buffer, and incubate at room temperature for 10 minutes on a turntable; wash the cells 3 times with PBS to remove excess cell membrane damage indicator complex and obtain labeled cells;
[0091] (5) Measure the number of cell membrane damage indicator sequences bound on the cells: Resuspend the labeled cells and add them directly to the real-time PCR reaction system (100 cells per reaction) for measurement. Calculate the number of cell membrane damage indicator sequences on each cell by referring to the standard curve.
[0092] Test results as follows Figure 3 As shown, by Figure 3 It can be seen that the degree of cell damage varies among different groups of cells due to different drug concentrations, which is reflected in the average number of cell membrane damage indicator sequences bound per cell. The higher the drug concentration, the greater the degree of cell damage, and the more cell membrane damage indicator sequences bound.
[0093] Example 3: Detecting the degree of cell damage at the single-cell level
[0094] (1) Provide the kit described in Example 1;
[0095] (2) Cell preparation: Add different concentrations of DNA tootecan, an inhibitor of DNA tootecan, to adherent MCF7 cells and culture them together with control cells without the drug for 24 hours to obtain the test cells;
[0096] (3) Preparation of cell membrane damage indicator complex: 1.4 μM biotin-labeled Annexin V, 1.6 μM streptavidin and 1 μM cell membrane damage indicator sequence were mixed in a molar ratio of 1:1:4. After mixing, the mixture was placed at room temperature for 10 minutes to obtain a mixture. 300 μL of phosphate-buffered saline (PBS) was added to the mixture. The mixture was then placed in a Millipore ultrafiltration purification tube (placed in the collection tube), catalog number UFC510008. The tube was centrifuged at 14000g for 4 minutes at 4°C. The filtrate in the collection tube was discarded. 300 μL of PBS was added. This process was repeated 8 times. The collection tube was replaced, the purification tube was inverted in the collection tube, and the tube was centrifuged at 3000g for 2 minutes at 4°C. The liquid in the collection tube was then replenished to the original volume with PBS. This is the purified cell membrane damage indicator complex.
[0097] (4) Labeling cells: 10 nM cell membrane damage indicator complex (calculated as Annexin V) was added to the experimental group and control group cells cultured with the drug, dissolved in Annexin V binding buffer, incubated at room temperature on a turntable for 10 minutes, and the cells were washed 3 times with PBS to remove excess cell membrane damage indicator complex to obtain labeled cells.
[0098] (5) Single-cell mRNA sequencing library construction and sequencing: Library construction was carried out in accordance with the standard single-cell mRNA sequencing procedure; using the final cDNA library as a template, primers containing the first primer binding sequence were added, and a library of cell membrane damage indicator sequences was constructed separately by PCR amplification and sequencing was performed.
[0099] Test results as follows Figure 4 As shown, by Figure 4 It can be seen that the higher the drug concentration, the greater the degree of cell damage, and the more cell membrane damage indicator sequences are bound. The number of cell membrane damage indicator sequences bound to a single cell can be obtained through single-cell sequencing, thus reflecting the degree of cell damage under specific drug administration conditions at the single-cell level.
[0100] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention. SEQUENCE LISTING <110> Southern University of Science and Technology <120> A reagent kit and a method for detecting the degree of cell damage. <130> 2022.03.09 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 94 <212> DNA <213> Synthetic <400> 1 gaggacgcta tgcctgtacc ggtttactba aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60 ctgtctctta tacacatctc cgagcccacg agac 94
Claims
1. A method for detecting the degree of cell damage, characterized in that, Includes the following steps: S10. Provide a reagent kit; the reagent kit includes: First reagent: Biotin-labeled cell membrane damage indicator sequence, wherein the cell membrane damage indicator sequence comprises a first primer binding sequence, a barcode nucleotide sequence, a polyadenylate tail sequence and a second primer binding sequence connected in sequence; The second reagent: biotin-labeled Annexin V; and, Third reagent: streptavidin; S20. Biotin-labeled Annexin V, streptavidin, and cell membrane damage indicator sequence are mixed to obtain a mixture. The mixture is then purified to obtain a purified cell membrane damage indicator complex. S30. After incubating the purified cell membrane damage indicator complex with the test cells, the test cells are washed to obtain labeled cells; S40. Construct a library according to the standard single-cell mRNA sequencing procedure; using the final cDNA library as a template, add primers containing the first primer binding sequence, and construct a library of cell membrane damage indicator sequences separately by PCR amplification and sequencing; the number of cell membrane damage indicator sequences bound to a single cell is obtained by single-cell sequencing, thereby reflecting the degree of cell damage at the single-cell level. The purification process includes: adding the mixture to phosphate buffer, placing it in an ultrafiltration purification tube and then in a collection tube, centrifuging at 14000 g for 4 minutes at 4°C, discarding the filtrate, adding phosphate buffer, and repeating this process 8 times; replacing the collection tube, inverting the ultrafiltration purification tube into the collection tube, centrifuging at 3000 g for 2 minutes at 4°C, and replenishing the liquid in the collection tube to the original volume of the mixture with phosphate buffer.
Citation Information
Patent Citations
Kit, sample marking method and single cell sequencing method
CN112280829A
Method for detecting and / or optionally quantifying and / or separating apoptotic cells in or from a sample
US5834196A