AAV5 expanded capsid mutant and method for detecting expansion thereof

CN116789772BActive Publication Date: 2026-09-18ANLONG BIOPHARMACEUTICAL CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210272242.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-18
Publication Date
2026-09-18
Estimated Expiration
2042-03-18

AI Technical Summary

Technical Problem

另外,若是AAV粗品,则其中会含有大量的核酸、杂质蛋白等生物大分子,因此,无论是AAV纯品还是粗纯产品,其样本PCR反应体系中都会含有相对多的酶、衣壳蛋白或其它杂质蛋白等抑制PCR反应的成分,这些成分会干扰qPCR准确定量,可能导致qPCR定量的AAV滴度批间或批内差异大,不能很好满足基因治疗产品批内/批间稳定性要求

Benefits of technology

[0012] To overcome the shortcomings of the prior art, the purpose of this disclosure is to provide an AAV capsid protein mutant that has a larger packaging capacity compared to the wild-type capsid protein. Furthermore, this disclosure also provides a method for detecting the increased packaging capacity compared to wild-type AAV after introducing a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant amino acids into multiple cells. Through the content provided in this disclosure, a quantitative method for AAV titer quantification with small quantitative error, high accuracy, and good stability can be obtained.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003554030940000081
    Figure BDA0003554030940000081
  • Figure BDA0003554030940000082
    Figure BDA0003554030940000082
  • Figure BDA0003554030940000091
    Figure BDA0003554030940000091
Patent Text Reader

Abstract

The present disclosure provides an AAV capsid protein mutant having a larger packaging capacity than a wild-type capsid protein. In addition, the present disclosure also provides a method for detecting a larger packaging capacity conferred after introducing a nucleic acid sequence encoding the amino acid of the aforementioned AAV capsid protein mutant into a plurality of cells. Through the content provided by the present disclosure, an AAV titer quantification method with small quantitative error, accuracy and good stability can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, specifically to an AAV5 expanded capsid mutant and a method for detecting the proportion of full-length viral gene expression cassettes by digital PCR. Background Technology

[0002] Adenoviruses were among the first viruses discovered, but in the 1960s, electron microscopy revealed that adenovirus samples typically contained a small particle (around 25 nm). In 1965, it was classified as a second virus, namely adeno-associated virus (AAV). AAV is a dependent virus, an accessory virus to adenoviruses and some herpesviruses, and is currently considered a non-pathogenic virus. Due to its relatively simple genome and non-pathogenicity, AAV has been used clinically as a gene therapy vector (Rittié, Laure, et al. Molecular Therapy 27.10(2019):1706-1717.). Currently, AAV vectors are mainly classified based on serotype, combined with subtypes and variants. Simply put, different classification methods are selected according to the different origins and coat characteristics of AAV. Natural AAVs are classified using conventional systematic classification (e.g., AAV2, AAV5, AAV9); non-natural AAVs produced through cross-packaging are classified according to subtype classification (e.g., AAV2 / 8, AAV2 / 5); and novel non-natural AAVs obtained through other means (e.g., capsid nucleic acid sequence mutation) are classified into different variants or isolated species according to variant classification (e.g., AAV2 / 7m8, AAV PHP.B, AAV DJ).

[0003] The AAV particle is approximately 25 nm in diameter, and its capsid is composed of 60 capsid protein subunits arranged in an icosahedral structure. An icosahedron is a convex polyhedron formed by 20 triangles. Every five triangles form a five-vertex structure, with a five-fold rotational symmetry axis passing through each pair of opposing vertices, a three-fold rotational axis passing through the center of each pair of opposing triangles, and a two-fold rotational axis passing through the midpoint of each pair of opposing edges (Zhang, Ran, et al. Nature microbiology 4.4 (2019): 675-682). The wtAAV genome is a linear, single-stranded DNA molecule, approximately 4.7 kb in length. Both ends of the genome contain identical inverted terminal repeats (ITRs) of approximately 150 nucleotides (nt), forming a T-shaped hairpin secondary structure, which is crucial for genome replication and packaging (Bennett, et al. Future Virology 12.6 (2017): 283-297). Between the ITRs, two open reading frames (ORFs) encode the Rep protein, the viral capsid VP proteins (VP1, VP2, and VP3), and two smaller accessory proteins: AAP and MAAP. For recombinant AAV (rAAV) vectors, the viral genome ORFs are replaced with the therapeutic gene of interest (or target gene), retaining only the flanking ITRs. The Rep and VP proteins required for rAAV packaging are provided via trans-propagation (Grieger, et al. Methods in enzymology 507(2012):229-254.).

[0004] Currently, several AAV drugs have been approved for marketing, such as: (1) A gene therapy based on adeno-associated virus, developed by the Dutch company UniQure, was approved by the EMA in 2012 for the treatment of familial lipoprotein lipase deficiency (Scott, et al. Drugs 75.2(2015):175-182.); (2) Developed by Spark Therapeutics, a subsidiary of Roche, AAV gene therapy was approved by the FDA in 2017 for the treatment of hereditary retinal dystrophy causing vision loss due to biallelic RPE65 mutations. This drug is a non-replicating recombinant AAV2 carrying the normal RPE65 gene. Administered subretinally, it allows retinal cells to express the normal RPE65 protein, thereby improving the patient's vision (Lloyd, Andrew, et al. British Journal of Ophthalmology 103.11(2019):1610-1614.); (3) Developed by AveXis, a subsidiary of Novartis, this drug is used to treat spinal muscular atrophy (SMA) and was approved by the FDA in 2019. The drug uses AAV9 as a gene vector, and AAV9 can cross the blood-brain barrier, allowing it to be delivered directly to motor neurons in the central nervous system, increasing the expression level of SMN protein in the body, thereby treating SMA (Waldrop, Megan A., and Stephen J. Current treatment options in neurology 21.6(2019):1-11.).

[0005] The advantages of AAV vectors are: (1) high safety, non-pathogenicity, and low immunogenicity; (2) long expression time, long-term efficient and stable expression; (3) broad tropism, capable of infecting dividing cells and non-dividing cells (neurons), and multiple serotypes of AAV can achieve targeting of different tissues and organs. One limitation of AAV vectors is that their capacity to carry exogenous genes is limited, and the packaging capacity of different serotypes of AAV varies. Currently, it is generally believed that the packaging capacity of AAV does not exceed 5Kb. When the target fragment of the packaging system is 5Kb or more, the fragments smaller than 5Kb that are mainly packaged into the AAV5 capsid are incomplete fragments. This limits the application of AAV vectors in long target genes to a certain extent (Samulski, Richard Jude. Nature biotechnology 18.5 (2000):497-498.). For example, the length of F8 factor expression cassette, cas9-gRNA protein expression cassette, and anti-dystrophin expression cassette often exceeds 5Kb. Therefore, increasing the packaging capacity of AAV is of great significance for gene therapy of some diseases.

[0006] Given that DNA carries a negative charge under physiological conditions, increasing the positive charge or decreasing the negative charge of amino acids in the AAV capsid chamber, thereby reducing the charge repulsion between the AAV capsid protein and its genomic DNA or increasing the charge attraction between them, may allow DNA to be packaged more compactly, thus increasing the packaging capacity of the AAV capsid.

[0007] Digital PCR (dPCR), known as the third generation of PCR technology, is an emerging technology that, compared with older PCR technologies (such as real-time quantitative PCR), allows for more precise quantitative analysis of nucleic acid molecules (Pinheiro LB, et al. AnalChem. 2012; 84(2):1003–11.). The innovation of digital PCR lies in the droplet generation process in the standard PCR reaction system, which dilutes the target molecule into multiple droplets. Each droplet generally contains only one or no target DNA template, achieving "single-molecule template PCR amplification." After amplification, droplets containing the target molecule template will emit a fluorescent signal. Finally, based on the Poisson distribution principle and the proportion of positive droplets, the analysis software can calculate the concentration or copy number of the target molecule. Therefore, absolute quantification of the target molecule can be performed without a standard curve. dPCR is widely used in the determination of viral vector titers (e.g., for quantifying lentiviral vector titers, AAV vector titers, adenovirus vector titers, etc.).

[0008] Compared to traditional qPCR methods, dPCR offers significant advantages in terms of quantitative accuracy, sensitivity, and stability. More accurate and reliable viral vector titers are crucial for toxicological and clinically relevant dosage range studies. If the titer is artificially high, the actual efficacy may be too low, potentially resulting in no therapeutic effect; conversely, if the titer is artificially low, it may lead to serious side effects, such as cytokine storms.

[0009] Taking AAV titer detection as an example, AAV titer detection generally does not involve genome extraction. Furthermore, before quantifying the titer, it needs to be digested with DNase I to reduce the influence of cell-free DNA on AAV quantification. Additionally, crude AAV contains a large amount of nucleic acids, impurity proteins, and other biomolecules. Therefore, whether it's pure or crude AAV, the PCR reaction system will contain relatively high levels of enzymes, capsid proteins, or other impurity proteins that inhibit the PCR reaction. These components can interfere with accurate qPCR quantification, potentially leading to large batch-to-batch or intra-batch variations in AAV titers, failing to meet the batch-to-batch stability requirements of gene therapy products. AAV quantification urgently needs a method with small quantification error, high accuracy, and good stability. According to research, digital PCR technology has significant advantages in this regard and is increasingly favored by industry professionals.

[0010] Studies have shown that dPCR technology for quantifying AAV samples during downstream purification, regardless of whether the DNase-treated group or the DNase and proteinase K-treated group is tested, yields lower CV values ​​than qPCR detection data, indicating that dPCR detection of AAV samples is more stable than qPCR technology. (Dobnik, David, et al. Frontiers in microbiology 10(2019):1570.)

[0011] This patent is based on a third-generation digital PCR system, namely a droplet chip-based digital PCR system, to develop a method for detecting the proportion of full-length AAV target gene expression cassettes. Compared with the first two generations of digital PCR systems (first generation: chip-based digital PCR system; second generation: droplet-based digital PCR system), the third-generation digital PCR system has certain advantages. The droplet chip-based digital PCR system combines the advantages of the first-generation digital PCR system in terms of fast data reading speed with the advantages of the second-generation digital PCR system in terms of data stability, resulting in rapid and stable detection, as well as visualized droplet quality control. Summary of the Invention

[0012] To overcome the shortcomings of the prior art, the purpose of this disclosure is to provide an AAV capsid protein mutant that has a larger packaging capacity compared to the wild-type capsid protein. Furthermore, this disclosure also provides a method for detecting the increased packaging capacity compared to wild-type AAV after introducing a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant amino acids into multiple cells. Through the content provided in this disclosure, a quantitative method for AAV titer quantification with small quantitative error, high accuracy, and good stability can be obtained.

[0013] On one hand, this disclosure provides an AAV capsid protein mutant comprising an amino acid sequence having an amino acid mutation at one or more amino acid positions corresponding to positions 219, 228, 301, and 679 in the amino acid sequence of the parental or wild-type AAV capsid protein as shown in SEQ ID NO.1, compared to the amino acid sequence of the parental or wild-type AAV capsid protein.

[0014] According to the foregoing aspect, the amino acid sequence of the AAV capsid protein mutant is the amino acid sequence of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and any combination thereof.

[0015] Preferably, the amino acid sequence of the AAV capsid protein mutant is the amino acid sequence of serum AAV5.

[0016] According to the foregoing aspect, this disclosure provides a method for detecting that a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant amino acid, when introduced into multiple cells, imparts a larger packaging capacity compared to wild-type AAV.

[0017] On the other hand, this disclosure provides a method for generating multiple adeno-associated virus (AAV) particles by transfecting cells with nucleic acids encoding the aforementioned AAV capsid protein mutant, wherein the cells are mammalian cells or insect cells.

[0018] Additional aspects and advantages of this disclosure will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this disclosure. Attached Figure Description

[0019] Figure 1 The 3D structure of the AAV5 capsid VP3 protein is shown.

[0020] Figure 2 The locations of different AAV5 expansion mutation sites on the 3D structure of the AAV5 capsid VP3 protein are shown.

[0021] Figure 3 The titers of different AAV5 expanded capsid mutants and wild-type AAV5 are shown.

[0022] Figure 4 The location of the designed digital PCR primers in the AAV genome is shown.

[0023] Figure 5 The melting curve results of the digital PCR primers are shown. The correspondence between the primers and the melting curves in the figure is as follows: A: ZHXL43-DPCR-F and ZHXL44-DPCR-R, B: ZHXL45-DPCR-F and ZHXL46-DPCR-R, C: ZHXL47-DPCR-F and ZHXL48-DPCR-R, D: negative control.

[0024] Figure 6 The electrophoresis results of PCR products obtained by conventional PCR are shown, validated using a full-length gene expression cassette percentage detection methodology. Lane M represents the DNA marker, lane 1 represents half a fragment of the full-length gene expression cassette, and lane 2 represents the full-length gene expression cassette.

[0025] Figure 7 The results show a comparison between actual and expected results validated using the full-length gene expression cassette percentage detection methodology.

[0026] Figure 8 The results of digital PCR detection of expansion in different AAV5 expansion capsid mutants compared to the wild type are shown. Detailed Implementation

[0027] Ⅰ Definition

[0028] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this disclosure, definitions and explanations of relevant terms are provided below.

[0029] Unless otherwise stated, the nucleic acid or polynucleotide sequences listed in this article are in single-stranded form, oriented from 5' to 3', from left to right. The nucleotides and amino acids provided in this article follow the format recommended by the IUPACIUB Biochemical Nomenclature Committee, with amino acids using either single-letter or three-letter codes.

[0030] Unless otherwise stated, "polynucleotide" is a synonym for "nucleic acid" and refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, mixed sequences of them, or the like. Polynucleotides may include modified nucleotides, such as methylated or restricted nucleotides and nucleotide analogs.

[0031] In this document, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”).

[0032] In this paper, the term "vector" refers to one or more macromolecules that encapsulate polynucleotides, facilitating their delivery to target cells in vitro or in vivo. Types of vectors include, but are not limited to, plasmids, viral vectors, liposomes, and other gene delivery vectors. The polynucleotide to be delivered is sometimes referred to as an "expression cassette" or "transgenic cassette," and may contain, but is not limited to, the coding sequence of certain proteins or synthetic peptides (which can enhance, inhibit, weaken, protect, trigger, or prevent certain biological and physiological functions), coding sequences of interest in vaccine development (e.g., polynucleotides expressing proteins, peptides, or polypeptides suitable for evoking an immune response in mammals), coding sequences of RNAi materials (e.g., shRNA, siRNA, antisense oligonucleotides), or optional biomarkers.

[0033] In this document, the terms “AAV,” “AAV mutant,” or “recombinant AAV” or simply “AAV” refer to any known serotype of adeno-associated virus, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, or AAV-12, scAAV, rh10, chimeric or heterozygous AAV, or any combination, derivative, or variant thereof. AAVs are small, non-enveloped, single-stranded DNA viruses. They are non-pathogenic parvoviruses, and their replication may require helper viruses such as adenovirus, herpes simplex virus, vaccinia virus, and CMV. Wild-type AAVs are common in the general population and are not associated with any known pathologies. Heterozygous AAVs are AAVs containing the capsid protein of one AAV serotype and the genomic material of another AAV serotype. Chimeric AAVs contain gene and / or protein sequences derived from two or more AAV serotypes and may include mutations in the gene sequences of these two or more AAV serotypes. Exemplary chimeric AAVs may contain a chimeric AAV capsid, for example, a capsid protein having one or more amino acid regions derived from two or more AAV serotypes. An AAV variant is an AAV that contains one or more amino acid mutations in its genome or protein compared to its parent AAV, for example, an AAV that contains one or more amino acid mutations in its capsid protein compared to its parent AAV. As used herein, AAVs include avian AAVs, bovine AAVs, canine AAVs, equine AAVs, primate AAVs, non-primate AAVs, and sheep AAVs, wherein primate AAVs refer to AAVs that infect primates, and wherein non-primate AAVs refer to AAVs that infect non-primates, such as avian AAVs that infect birds. In some cases, wild-type AAVs contain rep and cap genes, wherein the rep gene is required for viral replication, and the cap gene is required for capsid protein synthesis.

[0034] In this article, the term "capsid" refers to the protein coat of a virus or viral vector. The term "AAV capsid" refers to the protein coat of adeno-associated virus (AAV), which consists of approximately 60 subunits of viral protein 1 (VP1), VP2, and / or VP3.

[0035] In this paper, the term “recombinant AAV vector” or “AAV vector” refers to a vector derived from any of the AAV serotypes mentioned above. In some cases, an AAV vector may contain complete or partial deletions of one or more wild-type AAV genes such as the rep and / or cap genes, but contain the functional elements required for packaging and gene therapy using the AAV virus. For example, functional inverted terminal repeat sequences or ITR sequences flanking a foreign sequence in an open reading frame or clone are known to be essential for the replication and packaging of AAV viral particles, but ITR sequences may be modified from wild-type nucleotide sequences, including nucleotide insertions, deletions, or substitutions. In some respects, self-complementary vectors (sc), such as self-complementary AAV vectors, can be used, which bypass the need for viral second-strand DNA synthesis and allow for higher expression rates of transgenic proteins, as described by reference in Wu, Hum Gene Ther. 2007, 18(2):171-82, incorporated herein by reference. In some respects, AAV vectors can be generated to allow for selection of optimal serotypes, promoters, and transgenes. In some cases, the vector can be a targeting vector or a modified vector that selectively binds to or infects immune cells.

[0036] In this document, the term "downstream" refers to the nucleotide sequence located at the 3' of the reference nucleotide sequence. In some embodiments, the downstream nucleotide sequence refers to the sequence following the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site.

[0037] In this document, the term "upstream" refers to the nucleotide sequence located at the 5' end of a reference nucleotide sequence. In some embodiments, the upstream nucleotide sequence refers to the sequence located 5' to the side of the coding region or transcription start site. For example, most promoters are located upstream of the transcription start site.

[0038] In this paper, the term "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a specific protein or polypeptide after transcription and translation.

[0039] In this paper, the terms “expression cassette,” “transgenic cassette,” and “transgenic expression cassette” are used interchangeably to refer to a polynucleotide fragment that encodes a specific protein, polypeptide, or RNAi element that can be cloned into a plasmid vector.

[0040] In some implementations, the "box" may also be packaged into AAV particles and used as a viral genome to deliver the transgenic product to target cells. The "box" may also include other regulatory elements, such as specific promoters / enhancers, polyA, regulatory introns, etc., to enhance or de-enhance the expression of the transgenic product.

[0041] In this article, the term "amino acid" includes alanine (Ala or A); arginine (Arg or R); asparagine (Asn or N); aspartic acid (Asp or D); cysteine ​​(Cys or C); glutamine (Gln or Q); glutamic acid (Glu or E); glycine (Gly or G); histidine (His or H); isoleucine (Ile or I); leucine (Leu or L); lysine (Lys or K); methionine (Met or M); phenylalanine (Phe or F); proline (Pro or P); serine (Ser or S); threonine (Thr or T); tryptophan (Trp or W); tyrosine (Tyr or Y); and valine (Val or V). Non-traditional amino acids are also within the scope of this disclosure and include leucine, ornithine, valine, homoserine, and other amino acid residue analogs, such as those described in Ellman et al., Meth. Enzym. 202:301-336 (1991). To generate such non-naturally occurring amino acid residues, procedures from Noren et al., Science 244:182 (1989), and the aforementioned Ellman et al., can be used. In simple terms, these procedures involve chemically activating inhibitory tRNA with non-naturally occurring amino acid residues, followed by in vitro transcription and translation of the RNA. The introduction of non-traditional amino acids can also be achieved using peptide chemistry known in the art. As used herein, the term "polar amino acid" includes amino acids having zero net charge but with non-zero partial charge at different portions of their side chains (e.g., M, F, W, S, Y, N, Q, C). These amino acids can participate in both hydrophobic and electrostatic interactions. As used herein, the term "charged amino acid" includes amino acids with non-zero net charge on their side chains (e.g., R, K, H, E, D). These amino acids can participate in hydrophobic and electrostatic interactions.

[0042] In this document, the term "conservative amino acid substitution" refers to a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, if an amino acid in a polypeptide is replaced by another amino acid from the same side chain family, the substitution is considered conserved. In another embodiment, a string of amino acids can be conservatively substituted with structurally similar strings of side chain family members in different sequences and / or compositions.

[0043] In this document, the term "mutation" and its grammatical equivalents may include the substitution, deletion, and insertion of one or more nucleotides in a polynucleotide. For example, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, or more nucleotides / amino acids in a polynucleotide (cDNA, gene) or polypeptide sequence may be substituted, deleted, and / or inserted. Mutations can affect the coding sequence of a gene or its regulatory sequence. Mutations can also affect the structure of a genome sequence or the structure / stability of the encoded mRNA. Mutations in nucleic acids can encode mutations that increase or decrease the hydrophilicity of the amino acid encoded at the mutation site. Mutations in nucleic acids can encode mutations that increase or decrease the hydrophobicity of the amino acid encoded at the mutation site. Mutations in nucleic acids can encode amino acids selected from: nonpolar aliphatic amino acids (e.g., G, A, V, L, I, M), aromatic amino acids (e.g., F, Y, W), positively charged amino acids (e.g., K, R, H), negatively charged amino acids (e.g., D, E), and polar amino acids (e.g., S, T, C, P, N, Q). Mutations in nucleic acids can alter the encoded amino acid within one of these groups (e.g., a mutation from V to I) or between groups (e.g., a mutation from F to L). In some embodiments, the mutation may encode a change from an aromatic amino acid to a nonpolar aliphatic amino acid. In some embodiments, the mutation may encode a change from a positively charged amino acid to a polar amino acid. In some embodiments, the mutation may encode a change from a nonpolar aliphatic amino acid to another nonpolar amino acid. In some embodiments, the mutation may encode a change from a nonpolar aliphatic amino acid to a negatively charged amino acid. In some embodiments, the mutation may encode a change from a nonpolar aliphatic amino acid to a positively charged amino acid.

[0044] In this document, the term "identity percentage" refers to the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by sequence comparison. In the art, depending on the specific context, "identity" also refers to the degree of sequence correlation between polypeptide or polynucleotide sequences, as determined by matching strings of such sequences. "Identity" can be readily calculated using known methods. Preferred methods for determining identity are designed to provide the best match between the sequences being tested. Methods for determining identity are compiled into publicly available computer programs. Sequence alignment and identity percentage calculation can be performed using sequence analysis software, such as the Megalign program of the LASERGENE Bioinformatics Computing Suite (DNASTAR Inc., Madison, Wisconsin), the GCG program suite (Wisconsin Package version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin), BLASTP, BLASTN, BLASTX (Altschul et al., J.Mol.Biol.215:403(1990)), and DNASTAR (DNASTAR, Inc. 1228 S. Park St., Madison, Wisconsin 53715, USA).

[0045] In this paper, the term "inverted terminal repeat (ITR)" includes any AAV viral terminal repeat or synthetic sequence that forms a hairpin structure and is used as a cis element to mediate viral replication, packaging, and integration.

[0046] In this paper, the term "packaging capacity" refers to the length of genomic DNA contained within the AAV capsid chamber. Given that DNA carries a negative charge under physiological conditions, increasing the positive charge or decreasing the negative charge of amino acids within the AAV capsid chamber, thereby reducing the charge repulsion between the AAV capsid protein and its genomic DNA or increasing the charge attraction between them, may allow DNA to be packaged more compactly, thus increasing the AAV capsid packaging capacity.

[0047] II. Detailed Description of Implementation Methods

[0048] This disclosure provides an AAV capsid protein mutant comprising an amino acid sequence having an amino acid mutation at one or more amino acid positions corresponding to positions 219, 228, 301, and 679 in the amino acid sequence of the parental or wild-type AAV capsid protein as shown in SEQ ID NO. 1, compared to the amino acid sequence of the parental or wild-type AAV capsid protein, and the AAV capsid protein mutant having a larger packaging capacity compared to the wild-type capsid protein.

[0049] In one implementation, the capsid protein mutant has an H219R mutation at position 219.

[0050] In one implementation, the capsid protein mutant has an R228H mutation at position 228.

[0051] In one embodiment, the capsid protein mutant has an S301K or S301R mutation at position 301.

[0052] In one implementation, the capsid protein mutant has an N679R mutation at position 679.

[0053] In one embodiment, the capsid protein mutant has an H219R mutation at position 219, an R228H mutation at position 228, an S301K or S301R mutation at position 301, and an N679R mutation at position 679.

[0054] In one embodiment, the amino acid sequence of the parental or wild-type AAV capsid protein is the amino acid sequence of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and any combination thereof.

[0055] In one implementation, the amino acid sequence of the AAV parent or wild-type capsid protein is the amino acid sequence of serum AAV5.

[0056] In one embodiment, the AAV parent or wild-type AAV capsid protein has the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical to it.

[0057] In one embodiment, the amino acid sequence of the AAV capsid protein mutant is an amino acid sequence that has 80% or more identity with the amino acid sequence shown in SEQ ID NO.1, preferably an amino acid sequence with 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more identity, and more preferably an amino acid sequence with 98% or 99% or more identity.

[0058] In one embodiment, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO.3 or has an amino acid sequence obtained by deleting, adding or substituting 1, 2 or 3 amino acids in SEQ ID NO.3.

[0059] In one embodiment, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO.5 or has an amino acid sequence obtained by deleting, adding or substituting 1, 2 or 3 amino acids in SEQ ID NO.5.

[0060] In one embodiment, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO.7 or has an amino acid sequence obtained by deleting, adding or substituting 1, 2 or 3 amino acids in SEQ ID NO.7.

[0061] In one embodiment, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO.9 or has an amino acid sequence obtained by deleting, adding or substituting 1, 2 or 3 amino acids in SEQ ID NO.9.

[0062] In one embodiment, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO. 11 or has an amino acid sequence obtained by deleting, adding or substituting 1, 2 or 3 amino acids in SEQ ID NO. 11.

[0063] This disclosure also provides a method for detecting that a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant amino acids, after being introduced into cells, confers a greater packaging capacity compared to wild-type AAV.

[0064] The method includes the following steps:

[0065] (1) Construct a mutant plasmid vector containing the nucleic acid sequence described above;

[0066] (2) Baculoviruses were obtained by transfecting the mutant plasmid vector into host cells;

[0067] (3) The baculovirus is mixed with another batch of host cells to package the AAV virus;

[0068] (4) Purify the AAV virus obtained in step (3);

[0069] (5) Measure the titer of the AAV virus obtained in step (4);

[0070] (6) The AAV virus obtained in step (4) was detected by digital PCR, and the proportion of the full-length expression cassette in the amplification product was measured.

[0071] In one embodiment, the mutant plasmid vector in step (1) of the aforementioned detection method is pFastBacDual, pFastBac1, pFastBacHT A, pFastBacHT B or pFastBacHT C, preferably pFastBacDual.

[0072] In one implementation, the primers used for digital PCR in step (6) of the aforementioned detection method are selected from combinations of the following primer sequences:

[0073] (1) A combination consisting of an upstream primer as shown in SEQ ID NO.16 and a downstream primer as shown in SEQ ID NO.17;

[0074] (2) A combination of an upstream primer as shown in SEQ ID NO. 18 and a downstream primer as shown in SEQ ID NO. 19;

[0075] (3) A combination of an upstream primer as shown in SEQ ID NO.13 and a downstream primer as shown in SEQ ID NO.14.

[0076] In one implementation, the probe used for digital PCR in step (6) of the aforementioned detection method is selected from the following probe sequences:

[0077] (1) The probe sequence shown in SEQ ID NO.20;

[0078] (2) The probe sequence shown in SEQ ID NO.21;

[0079] (3) The probe sequence shown in SEQ ID NO.15.

[0080] In one implementation, the PCR program used for digital PCR in step (6) of the aforementioned detection method is: 95°C for 3 seconds; 45 cycles of 95°C for 15 seconds, 60°C for 130 seconds, for 45 cycles; then the program is turned off.

[0081] This disclosure discloses a method for generating adeno-associated virus (AAV) particles by transfecting cells with nucleic acids encoding the aforementioned AAV capsid protein mutant amino acids, wherein the cells are mammalian cells or insect cells.

[0082] In one embodiment, the cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHO-K1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, a CHOK1SVTM cell including all variants, a CHOK1SV GS-KOTM (glutamine synthase knockout) cell including all variants, a HEK293 cell including adherent and suspension-adapted variants, a HeLa cell or an HT1080 cell, or an insect cell.

[0083] In one embodiment, the insect cells are selected from sf9 cells, sf21 cells, and Hi5 cells.

[0084] In one implementation, the insect cells are sf9 cells.

[0085] For the purpose of clarity and concise description, features are described herein as part of a number of identical or separate embodiments; however, it will be understood that the scope of this disclosure may include embodiments having combinations of all or some of the described features. In the description of this specification, references to the terms “one embodiment,” “some embodiments,” “example,” “specific example,” or “some examples,” etc., refer to a specific feature, structure, material, or characteristic described in connection with that embodiment or example, which is included in at least one embodiment or example of this disclosure. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0086] The present disclosure is described in more detail below with reference to specific embodiments. However, these embodiments are for illustrative purposes only and are not intended to limit the present disclosure. The embodiments described below are exemplary and are only used to explain the present disclosure, and should not be construed as limiting the present disclosure. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in the art or in accordance with the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0087] Example

[0088] Example 1: Design of mutation sites for AAV5 mutants and construction of their plasmid vectors

[0089] 1.1 Design of mutation sites in AAV5 mutants

[0090] The crystal structure file 7kp3(AAV5).pdb of the AAV5 capsid VP3 protein was downloaded from the RCSB protein database (https: / / www.rcsb.org / ) using bioinformatics methods. It was opened with PyMOL software, and the results are as follows: Figure 1 As shown. The amino acid residues inside the capsid of the AAV5 VP3 protein (Q9YIJ1, whose amino acid sequence is shown in SEQ ID NO.1 and whose nucleic acid sequence is shown in SEQ ID NO.2) were mutated in the direction of increasing the positive charge within the lumen. Bioinformatics analysis identified the following mutation sites: H219R, R228H, S301K, S301R, and N679R. The specific locations of these mutation sites in the AAV5 VP3 structure are shown in [link to relevant documentation]. Figure 2 .

[0091] Compared to the wild-type capsid VP3 protein (Q9YIJ1), the amino acid sequence of the mutant with the H219R mutation is shown in SEQ ID NO.3, and its nucleic acid sequence is shown in SEQ ID NO.4; the amino acid sequence of the mutant with the R228H mutation is shown in SEQ ID NO.5, and its nucleic acid sequence is shown in SEQ ID NO.6; the amino acid sequence of the mutant with the S301K mutation is shown in SEQ ID NO.7, and its nucleic acid sequence is shown in SEQ ID NO.8; the amino acid sequence of the mutant with the S301R mutation is shown in SEQ ID NO.9, and its nucleic acid sequence is shown in SEQ ID NO.10; the amino acid sequence of the mutant with the N679R mutation is shown in SEQ ID NO.11, and its nucleic acid sequence is shown in SEQ ID NO.12. 1.2 Construction of AAV5 mutant plasmid vector

[0092] Based on the above mutation information, an AAV5 capsid mutant plasmid was constructed. Following the standard method for constructing mutant vectors, a point mutation plasmid vector was constructed. The mutant baculovirus was obtained using the Bac-to-Bac expression system (Invitrogen). For the procedure, please refer to "Meyer, Nancy L et al. Structure of the gene therapy vector, adeno-associated virus with its cell receptor, AAVR.eLifevol.8e44707.22May.2019, doi:10.7554 / eLife.44707".

[0093] Example 2: AAV5 virus packaging

[0094] 2.1 Production of Baculoviruses

[0095] Sf9 cells (Thermofisher, B82501) were seeded into 6-well plates and incubated at 27°C for 30 min. The cell density before transfection was typically 80%-90%. In a sterile 1.5 mL EP tube, 2 μg of Bacmid plasmid and 100 μL of ESFAF (www.expressionsystems.com, 99-300-01) medium were added and gently mixed. In another sterile 1.5 mL EP tube, 8 μL of GeneJet Plus transfection reagent (www.signagen-china.com, SL100499) and 100 μL of ESFAF medium were added and gently mixed. The diluted GeneJet Plus transfection reagent was then transferred to the EP tube containing the Bacmid DNA. Mix thoroughly by pipetting several times, incubate at room temperature for 15 minutes to form a Bacmid-GeneJet plus mixture. Add 0.8 ml of ESFAF medium to the Bacmid-GeneJet plus mixture and mix thoroughly by pipetting several times. Discard the cell culture medium and add the Bacmid-GeneJet plus mixture to the cells. Incubate at 27°C for 4-6 hours, then discard the transfection medium and add 2 ml of fresh ESFAF medium. After 96 hours of transfection, harvest the baculovirus stock solution and store it at 4°C in the dark for a short period.

[0096] 2.2 AAV5 virus packaging

[0097] Sf9 cells were stained with trypan blue and counted using a cell counter to obtain cell density, cell viability, and cell diameter. When the cell density reached 8-10E+6 cells / mL and the cell viability was not less than 95%, it was suitable for AAV virus packaging. The procedure is illustrated using a 1000mL cell culture flask as an example. The final culture volume in the 1000mL cell culture flask was 320mL, and the final cell concentration was 4E+6 cells / mL, calculating the required total cell count as 1.28E+9 cells. The required total cell count (1.28E+9 cells) was divided by the Sf9 cell concentration to obtain the volume of cell suspension to be added. Baculovirus was added according to the ratio of Bac-itpRep-itpCap (MOI = 200) and Bac-GOI (MOI = 100), mixed well, and incubated at room temperature for 10-20 minutes. The required total baculovirus genome was obtained by multiplying the MOI of the added baculovirus by the total cell count (1.28E+9 cells). Divide the required total number of baculovirus genomes by the baculovirus concentration to obtain the volume of baculovirus suspension to be added. Add fresh ESFAF medium to a final volume of 320 mL. Incubate the cells with the added baculovirus in a constant-temperature shaker at 27°C and 150 rpm for 72 h. After incubation, remove the cells, stain with trypan blue, count them using a cell counter, and record the cell density, cell viability, and cell diameter. Aliquot the cell suspension into 50 mL centrifuge tubes (40 mL each), centrifuge at 3000 rpm for 10 min at 4°C, and discard the cell culture supernatant. Collect the cell culture supernatant into a sterile bottle, tighten the cap, and treat it according to the baculovirus waste disposal procedure. Collect the cell pellet and immediately perform AAV virus purification.

[0098] 2.3 AAV5 purification

[0099] (a) Lysing the cell pellet and obtaining the supernatant

[0100] Add 5 ml of cell lysis buffer, 5 μL of Benzonase (250 U / μL stock), and 50 μL of protease inhibitor to each cell pellet. Pipette the pellet thoroughly to resuspend it while allowing the cells to lyse completely (the cell lysis buffer will become homogeneous and viscous after complete lysis), releasing the AAV virus.

[0101] Mix four portions of cell lysate from the cell pellet to obtain one tube of cell lysate, approximately 20 mL. Divide eight portions of cell pellet into two tubes of cell lysate, each 20 mL. Place both tubes of 20 mL cell lysate in liquid nitrogen for 3 minutes; the cell lysate will rapidly coagulate. Place the coagulated cell lysate in a 37°C water bath, agitating occasionally, and incubate for 10 minutes until completely thawed. Place the thawed cell lysate back into liquid nitrogen for 3 minutes to allow it to coagulate rapidly again. Place the coagulated cell lysate in a 37°C water bath, agitating occasionally, and incubate for 10 minutes until completely thawed. Incubate at 37°C for 1 hour to digest nucleic acids. Add 0.6 mL of 5M NaCl to a salt ion concentration of 500 mM. Invert the tube eight times to mix thoroughly, centrifuge at 4500 rpm for 10 minutes at 4°C to remove cell debris, collect the supernatant, and immediately ultrapoise or store at 2-8°C for later use.

[0102] (b) Supernatant was centrifuged with iodixanol density gradient.

[0103] The cell lysis supernatant obtained in step (a) was subjected to iodixanol density gradient centrifugation. The iodixanol density gradient centrifugation system was prepared as follows: 60% iodixanol solution was diluted with DPBS to prepare 15%, 25%, 40%, and 58% iodixanol solutions. After preparation, 5.3 ml of 15% iodixanol, 4 ml of 25% iodixanol, 5.3 ml of 40% iodixanol, and 3.3 ml of 58% iodixanol were added sequentially to the ultracentrifugation tube, marking the boundary between the 40% and 58% iodixanol solutions. Then, the cell lysis supernatant was added to fill the ultracentrifugation tube, and the tube was capped.

[0104] Carefully place the supernatant tube into a 70Ti rotor and centrifuge at 63,000 rpm and 18°C ​​for 2 hours.

[0105] Remove the ultrafiltration tube, open the cap, and gently insert an 18G long-needle syringe into the ultrafiltration tube, aligning the needle tip with the boundary between 40% and 58% iodixanol. Draw approximately 3 ml of solution. Add the lysed and ultrafiltrated Sf9 cell pellet from the same source to the same 50 mL centrifuge tube. Wash the resulting solution three times with a 100 KD ultrafiltration tube to remove iodixanol. The washing process involves diluting 2.6–5.6 ml of the solution with DPBS containing 0.001% F68 to 15 mL, mixing with a 10 mL pipette, centrifuging at 4000 rpm for 10 min at 4°C, concentrating to a volume typically of 250–500 μL. This constitutes one washing cycle; repeat this process twice to obtain iodixanol-free AAV virus. Filter the virus sterilely using a 0.22 μm sterile filter membrane. Take a 100 μL sample for genomic titer and capsid protein detection. The remaining samples were temporarily stored at 4℃. After the test results were obtained, they were aliquoted into 1ml vials at 2E+12vg / ml and stored at -80℃.

[0106] 2.4 AAV titer detection

[0107] The titers of wild-type AAV5 and its capsid mutants were detected using digital PCR. The procedure is as follows: First, DNase I (Invitrogen) was used. TM AAV5 was processed using SEQ ID NO. 18047019 to remove the DNA outside the capsid to prevent interference with AAV5 titer determination. The reaction system was 50 μl (5 μl AAV sample + 1 μl DNase I + 5 μl reaction buffer + 49 μl deionized water), incubated at 37°C for 30 minutes, and then inactivated at 95°C for 15 minutes. The sequences of all upstream primers F1 (5' to 3') were quantified as: cctgtctgtgttcttctctgg (SEQ ID NO. 13), the sequences of downstream primers R1 (5' to 3') were: ccccagagaaggggaacagg (SEQ ID NO. 14), and the probe sequence (5' to 3') was: caccttcaagcacaagatggtg (SEQ ID NO. 15).

[0108] Configure a 25 μl reaction system according to the table below (Table 1), with two replicates for each AAV sample. Slowly insert the PCR sample into the corresponding well of the chip, place the chip into the digital PCR instrument, and execute the program: 95℃ for 3 seconds; (95℃ for 15 seconds, 60℃ for 130 seconds) for 45 cycles, then close the program.

[0109] Table 1. Digital PCR reaction system

[0110] perfect PCR Tough Mix 12.5 upstream primer F1 1 Downstream primer R1 1 Probe 1 1 fluorescein sodium salt 2.5 AAV samples after DNase I treatment 1 water Make up to 25

[0111] The above-mentioned chip was scanned using a digital PCR scanner, and the results were exported and analyzed. See below for the results. Figure 3 .Depend on Figure 3 It is evident that the titer of mutant H219R is significantly lower than that of wild-type AAV5 with no capsid mutation, indicating that its yield is significantly suppressed, while the titers of other mutants are not significantly affected.

[0112] Example 3: Establishment and validation of a multiplex digital PCR method for evaluating the proportion of different fragments

[0113] To verify whether this method can effectively assess the proportion of DNA fragments of different lengths in a mixture of DNA of different lengths (e.g., AAV virus products, lentivirus products, adenovirus products, etc.), this embodiment first uses PCR to prepare pure DNA fragments of different lengths, and then quantifies their concentrations using digital PCR. Afterwards, these fragments are mixed in a certain proportion, and the digital PCR method disclosed herein is used to experimentally detect the proportion of DNA fragments of different lengths. If the results detected by this method meet expectations, it indicates that the method is reliable.

[0114] 3.1 Primer Design

[0115] Primers are designed based on conventional primer design principles, which are as follows:

[0116] Avoid highly repetitive bases, especially G;

[0117] Tm = 55-65℃;

[0118] GC = 30-80%;

[0119] The forward primer and probe should be as close as possible, but they should not overlap;

[0120] PCR amplification product length:

[0121] The primer product size should not be too large, generally between 80-250bp is acceptable;

[0122] The optimal product size for primers is 80-150 bp (which can be extended to 300 bp);

[0123] Special care should be taken to avoid the presence of primer dimers and nonspecific amplification.

[0124] In addition to adhering to conventional primer design principles, this disclosure, in order to effectively assess the proportion of a fragment of a certain length, designs digital PCR primer pairs at both ends of the fragment, such as... Figure 4 As shown.

[0125] The primer names and sequence information designed based on the above principles are shown in the table below (Table 2):

[0126] Table 2. List of PCR primers

[0127] ZHXL43-DPCR-F cgaggtttgctgcttgcaat(SEQ ID NO.16) ZHXL44-DPCR-R gggctaagtccactggctg(SEQ ID NO.17) ZHXL45-DPCR-F gaggcccaggacctgtact(SEQ ID NO.18) ZHXL46-DPCR-R ggttccttcgcgacacacaa(SEQ ID NO.19) ZHXL47-DPCR-F cctgtctgtgttcttctctgg(SEQ ID NO.13) ZHXL48-DPCR-R ccccagagaaggggaacagg(SEQ ID NO.14)

[0128] The following procedure was used to validate the primers using qPCR:

[0129] Primer validation was performed using the ChamQ SYBR qPCR Master Mix (Novizan, Q311-02) kit:

[0130] Prepare a 20 μl qPCR Master Mix by adding 10 μl of 2×ChamQ SYBR qPCR Master Mix, 0.5 μl of forward primer (Ribokexing), 0.5 μl of reverse primer (Ribokexing), 1 μl of template plasmid DNA (10 ng / μl), and 8 μl of ddH2O. Perform triple replicates for each sample. Place the 96-well plate in a qPCR instrument (ROCGENE, Archimed) and execute the program.

[0131] Pre-denaturation: 95℃, 30 seconds;

[0132] Amplification: 95℃, 10 sec, 60℃, 30 sec, 40 cycles;

[0133] Melting curves: 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec. Primer validation results are shown below. Figure 5 .

[0134] Depend on Figure 5 As can be seen, the designed digital PCR primers have good specificity and can meet the needs of subsequent experiments. The correspondence between the primers and the melting curves in the figure is as follows: A: ZHXL43-DPCR-F and ZHXL44-DPCR-R, B: ZHXL45-DPCR-F and ZHXL46-DPCR-R, C: ZHXL47-DPCR-F and ZHXL48-DPCR-R, D: negative control without primers.

[0135] The probes designed based on the above primers follow the following principles:

[0136] The TaqMan probe should be positioned as close as possible to the amplification primers, but should not overlap with them;

[0137] The length is generally 18-40 bases; the G+C content is controlled at around 40%-80%;

[0138] Avoid the appearance of consecutive identical bases, especially avoid the appearance of GGGG or more Gs.

[0139] The probe sequences designed based on the above principles are shown in Table 3 below:

[0140] Table 3. Digital PCR Probe Names and Sequence Information

[0141] prob-FAM(43+44) ccattttagggtggacacaggacgc(SEQ ID NO.20) FAM BHQ1 prob-Cy5-(45+46) gatctttattttcattagatctgtgtgttggt(SEQ ID NO.21) Cy5 BHQ2 prob-VIC-(47+48) caccttcaagcacaagatggtg(SEQ ID NO.15) VIC BHQ1

[0142] 3.2 Conventional PCR amplification of DNA fragments of different lengths

[0143] The procedure for conventional PCR amplification of DNA fragments of different lengths is as follows:

[0144] Prepare PCR reaction solution according to the formula in Table 4:

[0145] Table 4. PCR reaction system

[0146]

[0147] Reaction program: 94℃, 5 min; (94℃, 30 sec; 58℃, 30 sec; 72℃, 90 sec) 30 cycles; 72℃, 10 min. DNA fragments were purified and recovered using a standard agarose gel DNA recovery kit (Tiangen Biotech Co., Ltd., DP209), as follows:

[0148] (1) Under ultraviolet light, use a clean and sharp scalpel to cut off the gel block containing the target DNA fragment and place it into a 1.5 mL centrifuge tube. Weigh the gel block.

[0149] (2) Add 400 μL Binding Solution B to every 100 mg agarose gel, place at 50-60°C for 5-10 min, and mix intermittently every 2-3 min until the gel block is completely melted.

[0150] (3) Transfer the above mixture to a GenClean column with a 2mL collection tube, place at room temperature for 2min, centrifuge at 6000rpm at room temperature for 1min, and remove.

[0151] (4) Place the GenClean column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the waste liquid in the collection tube. Repeat step 4 once.

[0152] 95. Place the GenClean column back into the collection tube and centrifuge at 12,000 rpm at room temperature for 1 min to completely remove the WashSolution.

[0153] (6. Place the GenClean column into a clean 1.5 mL centrifuge tube, add 30–50 μL of solution buffer to the center of the GenClean column membrane, and incubate at 37°C for 2 min. Centrifuge at 12,000 rpm for 1 min. The liquid in the centrifuge tube is the solution containing the target DNA fragment. Take 2–5 μL for electrophoresis detection (see...) Figure 6 The purified DNA can be used immediately for subsequent experiments.

[0154] Depend on Figure 6 It is evident that the different lengths of product bands produced by PCR amplification are relatively uniform, which can meet the needs of subsequent experiments.

[0155] The experimental procedure for detecting the proportion of DNA fragments of different lengths using multiplex digital PCR is as follows:

[0156] The purified DNA fragments were mixed in a specific ratio (full-length fragment: 1 / 2 fragment = 4:1, where the full-length fragment is a segment of the genome located between ITRs expressing the F8 gene) and labeled as the mixed template. A 25 μl reaction system was prepared according to the table below (Table 5), with two replicates per sample. The PCR sample was slowly inserted into the corresponding well of the chip. The chip was placed in the digital PCR instrument, and the program was executed: 95℃ for 3 seconds; (95℃ for 15 seconds, 60℃ for 130 seconds) for 45 cycles, after which the program was closed.

[0157] Table 5. Digital PCR Reaction System

[0158]

[0159]

[0160] The above-mentioned chip was scanned using a digital PCR scanner, and the results were exported and analyzed. See below for the results. Figure 7 .Depend on Figure 7 As can be seen, the expected results of the full-length gene expression cassette percentage detection are very close to the actual results, with no statistical difference, indicating that this method can be used to detect the full-length gene expression cassette percentage in AAV.

[0161] Example 4: Multiplex (triple) digital PCR detection of the proportion of full-length expression cassette viral particles in AAV5 capsid mutant products.

[0162] First, DNase I (Invitrogen) was used. TM To treat AAV5 (18047019), the DNA outside the capsid was digested to prevent interference with AAV5 titer determination. The reaction system was 50 μl (5 μl AAV sample + 1 μl DNase I + 5 μl reaction buffer + 49 μl deionized water), incubated at 37℃ for 30 minutes, and then at 95℃ for 15 minutes to inactivate DNase I. Prepare a 25 μl reaction system according to the table below (Table 6), with two replicates for each AAV sample. Slowly insert the PCR sample into the corresponding well of the chip, place the chip in the digital PCR instrument, and execute the program: 95℃ for 3 seconds; (95℃ for 15 seconds, 60℃ for 130 seconds) for 45 cycles; then close the program.

[0163] Table 6. Digital PCR Reaction System

[0164] Perfect PCR Tough Mix 12.5 ZHXL43-DPCR-F 1 ZHXL44-DPCR-R 1 ZHXL45-DPCR-F 1 ZHXL46-DPCR-R 1 ZHXL47-DPCR-F 1 ZHXL48-DPCR-R 1 Probe: prob-FAM(43+44) 1 Probe: prob-Cy5-(45+46) 1 Probe: prob-VIC-(47+48) 1 Fluorescein sodium salt 2.5 AAV samples after DNase I treatment 1

[0165] The above-mentioned chip was scanned using a digital PCR scanner, and the results were exported and analyzed. See below for the results. Figure 8 .Depend on Figure 8 It is evident that the proportion of full-length gene expression cassettes packaged by the mutant H219R is significantly higher than that of the NC group and other mutants AAV5. sequence list <110> Beijing Anlong Biomedical Co., Ltd. <120> AAV5 expanded capsid mutant and its expansion detection method <130> MTI21429 <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 724 <212> PRT <213> Adeno-associated virus 5 (AAV5) <400> 1 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 2 <211> 2175 <212> DNA <213> Adeno-associated virus 5 <400> 2 atgtcttttg ttgatcaccc tccagattgg ttggaagaag ttggtgaagg tcttcgcgag 60 tttttgggcc ttgaagcggg cccaccgaaa ccaaaaccca atcagcagca tcaagatcaa 120 gcccgtggtc ttgtgctgcc tggttataac tatctcggac ccggaaacgg tctcgatcga 180 ggagagcctg tcaacagggc agacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660 gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 tccctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgcttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc areacccat ctgggccaag atcccagaga cggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 footcagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaaaactcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 tttgccccgg acagcaccgg ggaatacaga accaccagac ctatcggaac ccgatacctt 2160 acccgacccc tttaa 2175 <210> 3 <211> 724 <212> PRT <213> Artificial Sequence <400> 3 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp Arg Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 4 <211> 2175 <212> DNA <213> Artificial Sequence <400> 4 atgtcttttg tggatcaccc acctgactgg cttgaagagg taggcgaggg gctcagagag 60 ttcctgggac ttgaagcagg tccccccaaa ccgaagccaa accaacagca tcaagaccag 120 gcgcgtggct tagtcctacc tggatacaac tatttgggcc cggggaatgg actagatcgc 180 ggtgaacctg ttaatagggc tgacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcgctgc 660 gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 tccctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgcttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc areacccat ctgggccaag atcccagaga cggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 footcagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaaaactcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 2160 acccgacccc tttaa 2175 <210> 5 <211> 724 <212> PRT <213> Artificial Sequence <400> 5 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp His Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 6 <211> 2175 <212> DNA <213> Artificial Sequence <400> 6 atgtcttttg tggatcaccc acctgactgg cttgaagagg taggcgaggg gctcagagag 60 ttcctgggac ttgaagcagg tccccccaaa ccgaagccaa accaacagca tcaagaccag 120 gcgcgtggct tagtcctacc tggatacaac tatttgggcc cggggaatgg actagatcgc 180 ggtgaacctg ttaatagggc tgacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660 gattccacgt ggatggggga ccacgtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 tccctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc areacccat ctgggccaag atcccagaga cggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 footcagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaaaactcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 2160 acccgacccc tttaa 2175 <210> 7 <211> 724 <212> PRT <213> Artificial Sequence <400> 7 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Lys Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 8 <211> 2175 <212> DNA <213> Artificial Sequence <400> 8 atgtcttttg tggatcaccc acctgactgg cttgaagagg taggcgaggg gctcagagag 60 ttcctgggac ttgaagcagg tccccccaaa ccgaagccaa accaacagca tcaagaccag 120 gcgcgtggct tagtcctacc tggatacaac tatttgggcc cggggaatgg actagatcgc 180 ggtgaacctg ttaatagggc tgacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660 gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 aagctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc aaggacccat ctgggccaag atcccagaga cgggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 cagtacagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaaaactcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 tttgccccgg acagcaccgg ggaatacaga accaccagac ctatcggaac ccgatacctt 2160 acccgacccc tttaa 2175 <210> 9 <211> 724 <212> PRT <213> Artificial Sequence <400> 9 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Arg Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 10 <211> 2175 <212> DNA <213> Artificial Sequence <400> 10 atgtcttttg tggatcaccc acctgactgg cttgaagagg taggcgaggg gctcagagag 60 ttcctgggac ttgaagcagg tccccccaaa ccgaagccaa accaacagca tcaagaccag 120 gcgcgtggct tagtcctacc tggatacaac tatttgggcc cggggaatgg actagatcgc 180 ggtgaacctg ttaatagggc tgacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660 gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 cgcctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc aaggacccat ctgggccaag atcccagaga cgggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 cagtacagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaaaactcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 tttgccccgg acagcaccgg ggaatacaga accaccagac ctatcggaac ccgatacctt 2160 acccgacccc tttaa 2175 <210> 11 <211> 724 <212> PRT <213> Artificial Sequence <400> 11 Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu 660 665 670 Trp Glu Leu Lys Lys Glu Arg Ser Lys Arg Trp Asn Pro Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu <210> 12 <211> 2175 <212> DNA <213> Artificial Sequence <400> 12 atgtcttttg tggatcaccc acctgactgg cttgaagagg taggcgaggg gctcagagag 60 ttcctgggac ttgaagcagg tccccccaaa ccgaagccaa accaacagca tcaagaccag 120 gcgcgtggct tagtcctacc tggatacaac tatttgggcc cggggaatgg actagatcgc 180 ggtgaacctg ttaatagggc tgacgaggtc gcgcgagagc acgacatctc gtacaacgag 240 cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300 gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360 aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420 ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480 aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540 ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600 ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660 gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720 agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780 aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840 cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900 tccctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960 accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020 ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080 tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140 gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200 aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260 cagaacctgt tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320 acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380 tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440 gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata ggatggagct cgagggcgcg 1500 agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560 tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620 acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680 gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac cactgccccc 1740 gcgaccggca cgtacaacct ccaggaaatc gtgcccggca gcgtgtggat ggagagggac 1800 gtgtacctcc aaggacccat ctgggccaag atcccagaga cgggggcgca ctttcacccc 1860 tctccggcca tgggcggatt cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920 acgcctgtgc ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc 1980 cagtacagca ccgggcaggt caccgtggag atggagtggg agctcaagaa ggaacgctcc 2040 aagaggtgga acccagagat ccagtacaca aacaactaca acgaccccca gtttgtggac 2100 tttgccccgg acagcaccgg ggaatacaga accaccagac ctatcggaac ccgatacctt 2160 acccgacccc tttaa 2175 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <400> 13 cctgtctgtg ttcttctctg g 21 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 ccccagagaa ggggaacagg 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <400> 15 caccttcaag cacaagatgg tg 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 cgaggtttgc tgcttgcaat 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <400> 17 gggctaagtc cactggctg 19 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <400> 18 gaggcccagg acctgtact 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 ggttccttcg cgacacacaa 20 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 ccattttagg gtggacacag gacgc 25 <210> twenty one <211> 32 <212> DNA <213> Artificial Sequence <400> twenty one gatctttatt ttcattagat ctgtgtgttg gt 32

Claims

1. An AAV capsid protein mutant, wherein the amino acid sequence of the AAV capsid protein mutant is shown in SEQ ID NO. 3, 5, 7, 9 or 11.

2. A method for detecting that a nucleic acid sequence encoding the AAV capsid protein mutant of claim 1, after being introduced into cells, confers a greater packaging capacity compared to wild-type AAV. The method includes the following steps: (1) Construct a mutant plasmid vector containing the nucleic acid sequence; (2) Baculoviruses are obtained by transfecting the mutant plasmid vector into host cells; (3) The baculovirus is mixed with another batch of host cells to package the AAV virus; (4) Purify the AAV virus obtained in step (3); (5) Measure the titer of the AAV virus obtained in step (4); (6) The AAV virus obtained in step (4) was detected by digital PCR, and the proportion of the full-length expression cassette in the amplification product was measured.

3. The method according to claim 2, wherein the mutant plasmid vector in step (1) is pFastBacDual, pFastBac1, pFastBacHT A, pFastBacHT B or pFastBacHT C.

4. The method according to claim 2, wherein the mutant plasmid vector in step (1) is pFastBacDual.

5. The method according to claim 2, wherein the primers used in the digital PCR in step (6) are selected from combinations of the following primer sequences: (1) A combination consisting of an upstream primer as shown in SEQ ID NO. 16 and a downstream primer as shown in SEQ ID NO. 17; (2) A combination of an upstream primer as shown in SEQ ID NO. 18 and a downstream primer as shown in SEQ ID NO. 19; (3) A combination of an upstream primer as shown in SEQ ID NO. 13 and a downstream primer as shown in SEQ ID NO.

14.

6. The method according to claim 2, wherein the probe used in the digital PCR in step (6) is selected from the following probe sequences: (1) The probe sequence shown in SEQ ID NO. 20; (2) The probe sequence shown in SEQ ID NO. 21; (3) The probe sequence shown in SEQ ID NO.

15.

7. The method according to claim 2, wherein the PCR program used for digital PCR in step (6) is 95°C for 3 seconds; 95°C for 15 seconds, 60°C for 130 seconds, for 45 cycles; and then the program is turned off.

8. A method for generating adeno-associated virus (AAV) particles by transfecting cells with nucleic acids encoding a mutant of the AAV capsid protein of claim 1, wherein the cells are mammalian cells or insect cells.

9. The method according to claim 8, wherein the cell is a mouse cell, a human cell, or a Chinese hamster ovary (CHO) cell.

10. The method according to claim 8, wherein the cells are selected from CHO-K1 cells, CHO-DXB11 cells, CHO-DG44 cells, CHOK1SVTM cells, CHOK1SV GS-KOTM cells, HEK293 cells, HeLa cells, HT1080 cells, sf9 cells, sf21 cells or Hi5 cells.

11. The method of claim 10, wherein the CHOK1SV GS-KOTM cells are glutamine synthase knockout cells.

12. The method according to claim 8, wherein the insect cells are selected from sf9 cells, sf21 cells, and Hi5 cells.

13. The method according to claim 8, wherein the insect cell is an sf9 cell.

Citation Information

Patent Citations

  • Adeno-associated virus capsid protein and application thereof

    CN117736274A