Application of soybean transcription factor Gmburp272 in plant salt tolerance regulation

Abstract

The application discloses application of soybean transcription factor GmBURP272 in plant salt tolerance regulation. The soybean transcription factor GmBURP272 disclosed in the application is a protein with the amino acid sequence of sequence 2. The coding gene of the transcription factor GmBURP272 is introduced into hairy roots of a receptor soybean to obtain transgenic hairy roots and a transgenic chimera. The transgenic soybean hairy roots have significantly improved salt tolerance compared with the soybean hairy roots into which a blank vector is introduced. It is proved that the transcription factor GmBURP272 and the coding gene thereof can regulate plant salt tolerance, and have important theoretical and practical significance for cultivating plant high-salt-tolerance varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically the application of soybean transcription factor GmBURP272 in the regulation of plant salt tolerance. Background Technology

[0002] Changes in physical and chemical factors in the environment, such as drought, salinity, cold damage, frost damage, and waterlogging, are among the causes of severe crop yield reductions. Statistics from insurance payouts in the United States between 1939 and 1978 show that approximately 40.8% of payouts were due to salinity and drought, higher than waterlogging (16.4%), low temperatures (13.8%), hail (11.3%), and wind (7.0%), and far higher than insect infestations (4.5%), diseases (2.7%), and other factors. Therefore, cultivating salt- and drought-tolerant crops is one of the main goals of crop cultivation. Besides traditional breeding methods, molecular genetic breeding has become a focus of scientific research in improving crop salt and drought tolerance.

[0003] The BURP domain-containing protein family is an important class of proteins unique to plants. The BURP domain is located at the C-terminus of the protein and, based on its structure, can be divided into four subfamilies. In plants, these proteins participate in many biological processes, such as organ formation and responses to pathogen invasion. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the salt tolerance of plants.

[0005] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the activity or content of said proteins:

[0006] D1) Regulates plant salt tolerance;

[0007] D2) Preparation of products that regulate plant salt tolerance;

[0008] D3) Cultivate plants with enhanced salt tolerance;

[0009] D4) Preparation and cultivation of salt-tolerant plant products;

[0010] D5) Plant breeding;

[0011] The protein is derived from soybean and is named GmBURP272, as shown in A1), A2), or A3):

[0012] A1) The amino acid sequence is the same as sequence 2 of the protein;

[0013] A2) Proteins with the same function but with one or more amino acid residues replaced and / or deleted and / or added, according to the amino acid sequence shown in Sequence 2 of the Sequence Listing.

[0014] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0015] To facilitate the purification of proteins in A1), tags as shown in the table below can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in Sequence 2 of the sequence listing.

[0016] Table: Sequence of Labels

[0017] Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0018] The GmBURP272 protein in A2) above is a protein that has 75% or more amino acid sequence identity with the protein shown in Sequence 2 and has the same function. The 75% or more identity refers to 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The GmBURP272 protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0020] The gene encoding the GmBURP272 protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in Sequence 1, and / or by performing a missense mutation on one or more base pairs, and / or by attaching the coding sequence of the tag shown in the table above to its 5′ end and / or 3′ end. The DNA molecule shown in Sequence 1 encodes the GmBURP272 protein shown in Sequence 2.

[0021] In the above applications, the substance may be any one of B1) to B9):

[0022] B1) Nucleic acid molecules encoding GmBURP272;

[0023] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0024] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0025] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0026] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0027] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0028] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0029] B8) Nucleic acid molecules that reduce GmBURP272 expression;

[0030] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B8).

[0031] In the above applications, the nucleic acid molecule described in B1) may be as follows: b11), b12), b13), or b14):

[0032] b11) The coding sequence is a cDNA molecule or DNA molecule of sequence 1 in the sequence listing;

[0033] b12) cDNA or DNA molecules of sequence 1 in the sequence listing;

[0034] b13) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and is a cDNA molecule or DNA molecule encoding GmBURP272;

[0035] b14) hybridizes under strict conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes a cDNA molecule or DNA molecule that encodes GmBURP272.

[0036] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0037] Those skilled in the art can readily mutate the nucleotide sequence encoding the GmBURP272 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence of the GmBURP272 protein isolated according to this invention, provided they encode and function the GmBURP272 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0038] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0039] In the above applications, the stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 7% SDS, 0.5M NaPO4, and 1mM EDTA. Hybridization was performed in a mixed solution of NaPO4 and 1 mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS. Alternatively, hybridization was performed in a solution of 6×SSC and 0.5% SDS at 65°C, followed by rinsing once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS. Alternatively, hybridization was performed in a solution of 2×SSC and 0.1% SDS at 68°C, followed by rinsing twice for 5 min each time, and then hybridization was performed in a solution of 0.5×SSC and 0.1% SDS at 68°C, followed by rinsing twice for 15 min each time. Alternatively, hybridization was performed in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS at 65°C, followed by rinsing.

[0040] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0041] In the above application, the expression cassette (GmBURP272 gene expression cassette) containing a nucleic acid molecule encoding the GmBURP272 protein described in B2) refers to DNA capable of expressing the GmBURP272 protein in host cells. This DNA may include not only a promoter to initiate GmBURP272 gene transcription but also a terminator to terminate GmBURP272 gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by methyl jasmonic acid); heat shock promoter (US Patent 5,187,267); tetracycline inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), and seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator (see, for example, Odell et al. (I)). 985Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res. 15:9627.

[0042] Recombinant vectors containing the GmBURP272 gene expression cassette can be constructed using existing expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3′ untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3′ end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3′ end of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nosine synthase gene) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed. This can involve adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as the nptII gene for resistance to kanamycin and related antibiotics, the bar gene for resistance to the herbicide phosphinic acid, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methotrexate, and the EPSPS gene for resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0043] In the above applications, the vector can be a plasmid, a granule, a bacteriophage, or a viral vector. Specifically, the plasmid can be the pROKII vector or the pZH01 vector.

[0044] B3) The recombinant vector may specifically be pROKII-GmBURP272. pROKII-GmBURP272 is a recombinant vector obtained by replacing the DNA fragment between the BamHI and KpnI recognition sequences of the pROKII vector with the GmBURP272 gene shown in Sequence 1 of the sequence listing, and can express the fusion protein formed by GmBURP272 and NPTII shown in Sequence 2 of the sequence listing.

[0045] B9) The recombinant vector may specifically be pZH01-GmBURP272-RNAi, which is a recombinant vector obtained by inserting the DNA fragment shown in position 55 to position 284 of sequence 1 twice between the multiple cloning sites of pZH01, with the two insertions in opposite directions.

[0046] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0047] In the above applications, the plant may be M1, M2, or M3:

[0048] M1) Dicotyledons or monocotyledons;

[0049] M2) Leguminosae (family legumes);

[0050] M3) soybeans.

[0051] This invention also provides any of the following methods:

[0052] X1) Methods for cultivating salt-tolerant plants include knocking out the gene encoding GmBURP272 in the recipient plant, or inhibiting the expression of the gene encoding GmBURP272 in the recipient plant, or reducing the content of GmBURP272 in the recipient plant, or reducing the activity of GmBURP272 in the recipient plant, to obtain the target plant with enhanced salt tolerance.

[0053] X2) Methods to enhance plant salt tolerance include knocking out the gene encoding GmBURP272 in the recipient plant, or inhibiting the expression of the gene encoding GmBURP272 in the recipient plant, or reducing the content of GmBURP272 in the recipient plant, or reducing the activity of GmBURP272 in the recipient plant, to obtain the target plant with enhanced salt tolerance and thus achieve the enhancement of plant salt tolerance.

[0054] In the above methods, the inhibition of the expression of the GmBURP272 encoding gene in the recipient plant in X1) and X2) can be achieved by introducing a nucleic acid molecule that inhibits the expression of the GmBURP272 encoding gene or a recombinant vector expressing the nucleic acid molecule into the recipient plant.

[0055] In the above method, the encoding gene can be the nucleic acid molecule described in B1).

[0056] In the above method, the gene encoding GmBURP272 can be modified as follows before being introduced into the recipient plant to achieve better expression:

[0057] 1) Modify and optimize according to actual needs to enable efficient gene expression; for example, according to the codons preferred by the recipient plant, the amino acid sequence of the coding gene of GmBURP272 described in this invention can be changed to conform to plant preference; during the optimization process, it is best to maintain a certain GC content in the optimized coding sequence to best achieve high-level expression of the introduced gene in the plant, wherein the GC content can be 35%, more than 45%, more than 50%, or more than about 60%;

[0058] 2) Modify the gene sequence adjacent to the initiation methionine to enable efficient translation initiation; for example, by using a sequence known to be effective in plants.

[0059] 3) Linked to promoters of various plant expression to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of development of the target receptor; although it has been shown that many promoters derived from dicotyledons are functional in monocotyledons and vice versa, ideally, dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters are selected for expression in monocotyledons;

[0060] 4) Linking with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked with the gene of the present invention.

[0061] 5) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and Bronzel) and viral leader sequences (e.g., derived from TMV, MCMV, and AMV).

[0062] The coding gene for GmBURP272 can be introduced into recipient plants using a recombinant vector containing the coding gene for GmBURP272. Specifically, the recombinant vector can be pCAMBIA1301-GmBURP272.

[0063] The recombinant vector can be introduced into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The transformed plant host can be either a monocotyledonous plant or a dicotyledonous plant.

[0064] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes that produce color changes or luminescent compounds (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly through drought treatment without adding any selective marker genes.

[0065] The target plant is understood to include not only first-generation plants containing the GmBURP272 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus tissue, intact plants, and cells.

[0066] In the above method, the recipient plant can be M1, M2, or M3:

[0067] M1) Dicotyledons or monocotyledons;

[0068] M2) Leguminosae (family legumes);

[0069] M3) soybeans.

[0070] The present invention also provides a product for enhancing plant salt tolerance, the product containing GmBURP272 or the substance that regulates the activity or content of the protein.

[0071] The product may have GmBURP272 or the substance that regulates the activity or content of the protein as its active ingredient, or it may combine GmBURP272 or the substance that regulates the activity or content of the protein with a substance having the same function as its active ingredient.

[0072] GmBURP272 or the substance that regulates the activity or content of the protein are also within the scope of protection of this invention.

[0073] In this invention, the salt tolerance specifically refers to the plant's tolerance to a high-salt environment simulated by NaCl. The simulated high-salt environment can be an environment with a NaCl concentration of 50mM-300mM (e.g., 100mM).

[0074] Salt tolerance in plants can be reflected by plant survival rate, degree of leaf wilting, and / or relative ion permeability of leaves.

[0075] This invention involves transferring the gene encoding the transcription factor GmBURP272 into the hairy roots of recipient soybean, obtaining transgenic hairy roots and transgenic chimeras. The salt tolerance of these transgenic soybean hairy roots is significantly improved compared to those transgenic roots with an empty vector. This demonstrates that the transcription factor GmBURP272 and its encoding gene can regulate plant salt tolerance, which has important theoretical and practical significance for cultivating highly salt-tolerant plant varieties. Attached Figure Description

[0076] Figure 1 The transcription pattern of GmBURP272 under 120mM NaCl treatment.

[0077] Figure 2 Schematic diagram of pROKII-GmBURP272 and pZH01-GmBURP272-RNAi vectors.

[0078] Figure 3 Molecular identification of soybean hairy roots transgenic with the GmBURP272 gene.

[0079] Figure 4 This describes the salt-tolerant phenotype of the hairy roots and chimeras of GmBURP272.

[0080] Figure 5 Survival rate and relative electrical conductivity of transgenic GmBURP272 hairy roots under high salt stress. *, p < 0.05; **, p < 0.01. Detailed Implementation

[0081] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0082] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0083] The soybean cultivar Kefeng 1 (Glycine max L.Merr. Kefeng 1) in the following examples is described in WKZhang, YJWang, GZLuo, JSZhang, CYHe, XLWu, JYGai, SYChen, QTL mapping of ten agronomic traits on the soybean (Glycine max L.Merr.) genetic map and their association with EST markers, Theor. Appl. Genet, 2004, 108:1131-1139, which is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0084] Soybean [Glycine max(L.)Merr]NANNong 1138-2: Germplasm Bank of National Soybean Improvement Center, Nanjing Agricultural University, provided by National Soybean Improvement Center, Nanjing Agricultural University.

[0085] The expression vector pROKII (binary expression vector) used in the following examples is described in DC Baulcombe, GR Saunders, MW Bevan, MA Mayo and BD Harrison, Expression of biologically active viral satellite RNA from the nuclear genome of transformed plants. Nature 321 (1986), pp. 446–449, and is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0086] The pZH01 vector, from Stratagene, is described in Han Xiao, et al. Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference, Plant Molecular Biology, 2003, 52, 957-966. It is also available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0087] Agrobacterium rhizogenes K599 is described in Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of root biology, Nature Protocols, 2007, 2(4), 549-552. It is available to the public from Professor Peter M. Gressnon, The University of Queensland, St Lucia, Queensland 4072, Australia, or from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences with the consent of Professor Peter M. Gressnon (written consent).

[0088] Example 1: Screening and cDNA Cloning of the Gene Encoding GmBURP272, a Soybean Transcription Factor

[0089] In transcriptome analysis of soybean varieties Kefeng 1 (salt-sensitive) and Nannong 1138-2 (salt-tolerant) under normal and high salt stress conditions, the inventors screened for the gene named Glyma.12G217300 (Locus name: Glyma.12G217300, Alias: Glyma12g34550). The transcription rate of Glyma.12G217300 decreased sharply upon treatment with 120 mM NaCl. Figure 1 As shown, if the value is approximately 1.0 at 0 h, it is approximately 0.25 at 3 h and approximately 0.08 at 20 h. Therefore, this protein may negatively regulate salt tolerance in plants.

[0090] The salt-tolerant soybean variety Nannong 1138-2 was cultured under light for two weeks. RNA was extracted from seedlings after this period. 1g of fresh seedlings was crushed in liquid nitrogen and suspended in 4mol / L guanidine thiocyanate. The mixture was extracted with acidic phenol and chloroform. Anhydrous ethanol was added to the supernatant to precipitate total RNA. The precipitate was then dissolved in water to obtain total RNA, which was reverse transcribed into cDNA using reverse transcriptase. Primers were:

[0091] Gm217300-F1:ATGGCACTTCGTTGCTTGG and

[0092] Gm217300-R1:TTAAGCAACAATGTTGGTCTGA.

[0093] Real-Time PCR identification was performed. The Real-Time PCR reaction was conducted using the TOYOBO Real-Time PCR Master Mix kit, following the instructions. The soybean Tublin gene was used as an internal control, and the primers used were Primer-TF: 5'-AACCTCCTCCTCATCGTACT and Primer-TR: 5'-GACAGCATCAGCCATGTTCA.

[0094] Sequencing revealed that the Glyma.12G217300 gene contains 819 bp and encodes 272 amino acid residues, with the encoded protein named GmBURP272. In Nanjing Agricultural University 1138-2, the amino acid sequence of GmBURP272 is sequence 2 in the sequence listing, and the DNA coding sequence is sequence 1.

[0095] Example 2: Construction of a plant expression vector for soybean GmBURP272

[0096] I. Construction of the GmBURP272 overexpression vector pROKII-GmBURP272

[0097] Using cDNA from Nanjing Agricultural University 1138-2 as a template, PCR amplification was performed using GmBURP272-pROKII-F2 and GmBURP272-pROKII-R2 to obtain PCR products.

[0098] GmBURP272-pROKII-F2: AGAACACGGGGGACTCTAGA ATGGCACTTCGTTGCTTGG;

[0099] GmBURP272-pROKII-R2: GATCGGGGAAATTCGAGCTC TTAAGCAACAATGTTGGTCTGA.

[0100] The pROKII vector was double-digested with restriction endonucleases BamHI and KpnI. The PCR-recovered fragments were ligated into the pROKII vector using homologous recombination to obtain the recombinant vector pROKII-GmBURP272 (partial vector schematic shown in the figure). Figure 2 pROKII-GmBURP272 is a recombinant vector obtained by replacing the DNA fragment between the BamHI and KpnI recognition sequences of the pROKII vector with the GmBURP272 gene shown in Sequence 1 of the sequence listing. It can express the fusion protein formed by GmBURP272 and NPTⅡ shown in Sequence 2 of the sequence listing.

[0101] II. Construction of the GmBURP272RNAi expression vector pZH01-GmBURP272-RNAi

[0102] The RNAi vector was pZH01. Using cDNA obtained from reverse transcription of total RNA from Nanjing Agricultural University 1138-2 as a template, two RNAi vectors were constructed from two segments. The first ligation was performed by digestion with Sac I and Kpn I, followed by a second ligation by digestion with Xba I and Sal I.

[0103] pZH01-GmBURP272-RNAi primers:

[0104] GmBURP272RiF1: (A single underscore indicates the recognition sequence for Xba I, and a double underscore indicates the recognition sequence for Sac I);

[0105] GmBURP272RiR1: (A single underscore indicates the recognition sequence for Sal I, and a double underscore indicates the recognition sequence for Kpn I).

[0106] First, the PCR product and the pZH01 vector were double-digested with Sac I and Kpn I, respectively. The resulting large fragment of the PCR product was then ligated to the vector backbone. The recombinant vector with the correct sequence was then double-digested with Xba I and Sal I, and the resulting large fragment of the PCR product was ligated to the vector backbone. The resulting recombinant vector with the correct sequence was designated as pZH01-GmBURP272--RNAi( Figure 2 ).

[0107] All the constructed vectors were sequenced to verify that the construction was correct before proceeding to the next stage of experiments.

[0108] Example 3: Obtaining hairy roots of soybean transgenic with the GmBURP272 gene

[0109] The Agrobacterium rhizogenes infection method was slightly modified from the method of Attila Kereszt et al. (Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of rootbiology, Nature Protocols, 2007, 2(4), 549-552). Following the literature "Wang, Fang; Chen, Hao-Wei; Li, Qing-Tian; Wei, Wei; Li, Wei; Zhang, Wan-Ke; Ma, Biao; Bi, Ying-Dong; Lai, Yong-Cai; Liu, Xin-Lei; Man, Wei-Qun; Zhang, Jin-Song; Chen, Shou-Yi, GmWRKY27interacts with GmMYB174 to reduce expression of GmNAC29 for stress tolerance in soybean plants, 2015, The Plant Journal, 83, 224–236”, or the patent “Chen Shouyi et al., Plant stress resistance-related transcription factor GmWRKY78 and its encoding gene and application, patent number: ZL2011 10053083.7, authorization date 2013.10.09”, which uses the Agrobacterium rhizogenes-mediated transgenic root method.

[0110] Obtaining hairy roots by overexpression of GmBURP272 and GmBURP272-RNAi

[0111] 1) Obtaining recombinant Agrobacterium

[0112] The recombinant expression vectors pROKⅡ-GmBURP272 and pZH01-GmBURP272-RNAi obtained above were introduced into Agrobacterium rhizogenes K599 by electroporation to obtain recombinant Agrobacterium. The recombinant Agrobacterium containing the above plasmids were named K599 / pROKⅡ-GmBURP272 and K599 / pZH01-GmBURP272-RNAi, respectively.

[0113] 2) Hairy root transformation

[0114] The recombinant Agrobacterium K599 / pROKⅡ-GmBURP272 and K599 / pZH01-GmBURP272-RNAi were inoculated into soybean seedlings of Kefeng 1 with two true leaves after 6 days of growth using syringes. Specific methods are described in the above citation. Growth was carried out under moist conditions: 16 hours of light, 25℃, and 50% humidity. Two weeks later, the hairy roots that emerged were the transgenic hairy roots. 125 plants transgenic with K599 / pROKⅡ-GmBURP272 (BURP272-OE) and 126 plants transgenic with K599 / pZH01-GmBURP272-RNAi (BURP272-Ri) were obtained for further transgenic identification and stress tolerance testing.

[0115] Using the same method, Agrobacterium rhizogenes K599 / pROKⅡ containing the empty vector pROKⅡ was transformed into soybean Kefeng 1 seedlings, resulting in 123 hairy roots transformed with the empty vector, which served as empty vector controls.

[0116] 3) Molecular identification of transgenic hairy roots

[0117] Total RNA was extracted from transgenic hairy roots and hairy roots transfected with empty vector, and reverse transcribed into cDNA. Using cDNA as a template, the level of GmBURP272 mRNA in transgenic hairy roots was detected by qRT-PCR. The primers are as follows (annealing temperature 58℃):

[0118] QRT-BURP272F1: TGCCATGAAGTCCGTGAAAC;

[0119] QRT-BURP272R1:GCCTTGCTTCCAAGGAAATG.

[0120] The soybean GmTubulin gene was used as an internal control. The primers used were Primer-TF: 5'-AACCTCCTCCTCATCGTACT and Primer-TR: 5'-GACAGCATCAGCCATGTTCA. The experiment was repeated three times, and the results were taken as mean ± standard deviation. Figure 3 The results showed that the expression levels of GmBURP272 in the empty vector control, K599 / pROKⅡ-GmBURP272 hairy roots (BURP272-OE), and K599 / pROKⅡ-GmBURP272-RNAi (BURP272-Ri) were approximately 4%, 47%, and 0.3%, respectively. The expression level of GmBURP272 in the overexpression hairy roots (BURP272-OE) was significantly higher than that in the empty vector hairy roots (K599), while the expression level in the GmBURP272-Ri hairy roots was significantly lower than that in the empty vector hairy roots (K599).

[0121] Example 4: Salt tolerance identification of GmBURP272-transformed and GmBURP272-RNAi hairy root chimeras

[0122] The experimental samples were the control of the empty vector obtained in Example 3, and the hairy roots and plants of BURP272-OE and BURP272-Ri.

[0123] The three types of experimental samples were divided into two groups of approximately 20 samples each. One group was treated with a 120 mM NaCl aqueous solution for 3 days, i.e., immersed in a 120 mM NaCl solution at 25°C. The second group was immersed in water as a control. The experiment was repeated three times, and the results were taken as the mean ± standard deviation.

[0124] After treatment with 120mM NaCl aqueous solution for 3 days, photographs were taken for observation. Figure 4 The results showed that, based on the phenotypes of the hairy roots transgenic with the empty vector and the two transgenic hairy root chimeras, there was no significant difference between the hairy roots transgenic with the empty vector (pROKⅡ) and those transgenic with the GmBURP272 gene and GmBURP272-RNAi under water treatment (normal conditions). After 3 days of treatment with 120 mM NaCl, all plants showed some wilting of leaves, but the degree of wilting varied significantly. The degree of wilting in the chimera plants and leaves transgenic with GmBURP272-RNAi (BURP272-Ri) was significantly lower than that in the control plants and leaves transgenic with the empty vector hairy roots. However, the degree of wilting in the chimera plants and leaves transgenic with GmBURP272 overexpression (BURP272-OE) was significantly higher than that in the control.

[0125] The survival rate and relative ion permeability of the above-mentioned plants were statistically analyzed.

[0126] Figure 5 The left and middle figures show that the survival rate of all plants in the hydroponic control was 100%. After 3 days of treatment with 120mM NaCl, the survival rate of the empty vector control (K599) was about 38%, the survival rate of BURP272-OE plants was about 27%, which was significantly lower than the control, while the survival rate of BURP272-Ri plants was about 53%, which was significantly higher than the control.

[0127] Figure 5 The right-hand image shows the ion permeability measurement of plant leaves. When plant tissues are damaged by abiotic stress, cell membrane function is impaired or structure is disrupted, increasing permeability and causing various water-soluble substances, including electrolytes, to leak out. When plant tissues are immersed in deionized water, the water's conductivity increases due to electrolyte leakage. The more severe the damage and the more serious the cell membrane damage, the greater the leakage and the higher the water conductivity. Therefore, a conductivity meter can be used to measure changes in the conductivity of the exudate, indirectly reflecting the degree of damage to the plant tissues. Thus, conductivity measurement can be used to calculate relative ion permeability, which indicates the degree of damage to the plant cell membrane.

[0128] The method for determination is as follows: Soybean leaves are cut off and placed in a clean screw-top glass bottle, then rinsed three times with deionized water. Next, 80 mL of deionized water is added to completely immerse the leaves, and a vacuum is applied for 45 minutes. After standing at room temperature for 30 minutes, the conductivity E1 is measured using a conductivity meter (DDC-308A, Shanghai Boqu Instrument Co., Ltd.). The leaves are then boiled for 15 minutes, and after cooling to room temperature, the mixture is stirred and the conductivity E2 is measured using a conductivity meter.

[0129] Relative ion permeability EL (%) = E1 / E2 × 100, where E1 and E2 are electrical conductivity.

[0130] The relative ion permeability of soybeans in the 120NaCl treatment group and the control group was measured, such as... Figure 5 As shown, during hydroponics, the relative ion permeability of leaves of all plants was approximately 7-9%, with no significant difference. After salt treatment, the relative ion permeability of leaves of the empty vector control, BURP272-OE, and BURP272-Ri increased to approximately 46%, 57%, and 20%, respectively. This indicates that the increased expression of GmBURP272 led to severe damage to the leaf cell membrane under salt stress, while the decreased expression of GmBURP272 in the GmBURP272-Ri chimera resulted in much less damage to the cell membrane of the chimera leaves than the control.

[0131] Therefore, GmBURP272 negatively regulates the salt tolerance of plants, and reducing the expression level of GmBURP272 increases the salt tolerance of plants.

[0132] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> Application of soybean transcription factor GmBURP272 in the regulation of plant salt tolerance <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 819 <212> DNA <213> Glycine max (L.) Merrill) <400> 1 atggcacttc gttgcttggt gatgccctt tctgttctct tcactcttgg tcttgcgaga 60 gaaagccatg ccagagacga agatttttgg catgctgttt ggccaaacac tcccattcca 120 agttcattgc gagatcttct aaagcctggc cctgcaagtg ttgaaatcga tgatcaccct 180 atgcaaattg aagaaacaca gtacccgaaa accttcttct ataaagaaga ccttcatcca 240 ggcaaaacaa tgaaagtaca attcagcaag cctccctttc aaaccatg gggtgttggt 300 acatggttaa aggaaattaa agacactact aaagaaggat atagttttga agagctatgc 360 atcaagaaag aagccattga gggagaagag aagttttgtg caaaatcctt gggaacagta 420 attggttttg ccatttcaaa gctgggaaag aacattcaag tactttcaag ttcctttgtc 480 aataagcaag accaatacac tgtggaagga gtgcagaatc ttggagacaa agcagtgatg 540 tgtcataggc taaatttcag aactgcagta ttttactgcc atgaagtccg tgaaacaaca 600 gctttcatgg ttccattggt ggctggtgat ggaaccaaaa ctcaggcact tgctatttgc 660 cactcaaata cttctggaat gaatcatcaa atgcttcatc aacttatggg agttgatcct 720 ggaactaacc ctgtttgcca tttccttgga agcaaggcca ttttatgggt acccaattta 780 tctgtggaca ctgcctatca gaccaacatt gttgcttaa 819 <210> 2 <211> 272 <212> PRT <213> Glycine max (L.) Merrill) <400> 2 Met Ala Leu Arg Cys Leu Val Met Ser Leu Ser Val Leu Phe Thr Leu 1 5 10 15 Gly Leu Ala Arg Glu Ser His Ala Arg Asp Glu Asp Phe Trp His Ala 20 25 30 Val Trp Pro Asn Thr Pro Ile Pro Ser Ser Leu Arg Asp Leu Leu Lys 35 40 45 Pro Gly Pro Ala Ser Val Glu Ile Asp Asp His Pro Met Gln Ile Glu 50 55 60 Glu Thr Gln Tyr Pro Lys Thr Phe Phe Tyr Lys Glu Asp Leu His Pro 65 70 75 80 Gly Lys Thr Met Lys Val Gln Phe Ser Lys Pro Pro Phe Gln Gln Pro 85 90 95 Trp Gly Val Gly Thr Trp Leu Lys Glu Ile Lys Asp Thr Thr Lys Glu 100 105 110 Gly Tyr Ser Phe Glu Glu Leu Cys Ile Lys Lys Glu Ala Ile Glu Gly 115 120 125 Glu Glu Lys Phe Cys Ala Lys Ser Leu Gly Thr Val Ile Gly Phe Ala 130 135 140 Ile Ser Lys Leu Gly Lys Asn Ile Gln Val Leu Ser Ser Ser Phe Val 145 150 155 160 Asn Lys Gln Asp Gln Tyr Thr Val Glu Gly Val Gln Asn Leu Gly Asp 165 170 175 Lys Ala Val Met Cys His Arg Leu Asn Phe Arg Thr Ala Val Phe Tyr 180 185 190 Cys His Glu Val Arg Glu Thr Thr Ala Phe Met Val Pro Leu Val Ala 195 200 205 Gly Asp Gly Thr Lys Thr Gln Ala Leu Ala Ile Cys His Ser Asn Thr 210 215 220 Ser Gly Met Asn His Gln Met Leu His Gln Leu Met Gly Val Asp Pro 225 230 235 240 Gly Thr Asn Pro Val Cys His Phe Leu Gly Ser Lys Ala Ile Leu Trp 245 250 255 Val Pro Asn Leu Ser Val Asp Thr Ala Tyr Gln Thr Asn Ile Val Ala 260 265 270

Claims

1. Any of the following applications of substances that reduce protein content: D1) Cultivating soybeans with enhanced salt tolerance; D2) Preparation and cultivation of salt-tolerant soybean products; The protein is a protein whose amino acid sequence is sequence 2.

2. The application according to claim 1, characterized in that: The substance is either B1 or B2 below. B1) Nucleic acid molecules that reduce the expression level of the protein described in claim 1; B2) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B1).

3. Any of the following methods: X1) A method for cultivating salt-tolerant soybeans, comprising knocking out the gene encoding the protein of claim 1 in the recipient soybean, or inhibiting the expression of the gene encoding the protein of claim 1 in the recipient soybean, to obtain the target soybean with enhanced salt tolerance; X2) A method for enhancing the salt tolerance of soybeans includes knocking out the gene encoding the protein of claim 1 in the recipient soybean, or inhibiting the expression of the gene encoding the protein of claim 1 in the recipient soybean, to obtain the target soybean with enhanced salt tolerance, thereby achieving the enhancement of the salt tolerance of soybeans.

4. The method according to claim 3, characterized in that: In X1) and X2), the expression of the protein-coding gene of claim 1 in the recipient soybean is inhibited by introducing a nucleic acid molecule that inhibits the expression of the protein-coding gene of claim 1 or a recombinant vector expressing the nucleic acid molecule into the recipient soybean.

5. The method according to claim 4, characterized in that: The coding gene is a DNA molecule whose coding sequence is sequence 1 in the sequence listing.

6. The method according to claim 4, characterized in that: The encoding gene is the DNA molecule of sequence 1 in the sequence listing.

7. The method according to claim 4, characterized in that: The encoding gene is a DNA molecule that has more than 75% identity with the nucleotide sequence of Sequence 1 and encodes the protein of claim 1.

Images