Application of soybean transcription factor GmGRAS487 in plant salt tolerance regulation

Abstract

The application discloses application of soybean transcription factor GmGRAS487 in plant salt tolerance regulation. The soybean transcription factor GmGRAS487 disclosed by the application is a protein with the amino acid sequence of sequence 2. The application introduces the coding gene of the transcription factor GmGRAS487 into hairy roots of a receptor soybean to obtain transgenic hairy roots and a transgenic chimera. The transgenic soybean hairy roots have significantly improved salt tolerance compared with the soybean hairy roots into which a blank vector is introduced. It is proved that the transcription factor GmGRAS487 and the coding gene thereof can regulate plant salt tolerance, and have important theoretical and practical significance for cultivating high-salt-tolerance plant varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically the application of soybean transcription factor GmGRAS487 in the regulation of plant salt tolerance. Background Technology

[0002] Changes in physical and chemical factors in the environment, such as drought, salinity, cold damage, frost damage, and waterlogging, are among the causes of severe crop yield reductions. Statistics from insurance payouts in the United States between 1939 and 1978 show that approximately 40.8% of payouts were due to salinity and drought, higher than waterlogging (16.4%), low temperatures (13.8%), hail (11.3%), and wind (7.0%), and far higher than insect infestations (4.5%), diseases (2.7%), and other factors. Therefore, cultivating salt- and drought-tolerant crops is one of the main goals of crop cultivation. Besides traditional breeding methods, molecular genetic breeding has become a focus of scientific research in improving crop salt and drought tolerance.

[0003] GRAS domain proteins are a class of plant-specific proteins, generally containing 400-700 amino acid residues, and can be divided into at least 13 subfamilies. As plant transcription factors, these proteins participate in many biological processes, such as gibberellin signaling, root and stem development, etc. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the salt tolerance of plants.

[0005] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the activity or content of said proteins:

[0006] D1) Regulates plant salt tolerance;

[0007] D2) Preparation of products that regulate plant salt tolerance;

[0008] D3) Cultivate plants with enhanced salt tolerance;

[0009] D4) Preparation and cultivation of salt-tolerant plant products;

[0010] D5) Plant breeding;

[0011] The protein is derived from soybean and is named GmGRAS487, as shown in A1), A2), or A3):

[0012] A1) The amino acid sequence is the same as sequence 2 of the protein;

[0013] A2) Proteins with the same function but with one or more amino acid residues replaced and / or deleted and / or added, according to the amino acid sequence shown in Sequence 2 of the Sequence Listing.

[0014] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0015] To facilitate the purification of proteins in A1), tags as shown in the table below can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in Sequence 2 of the sequence listing.

[0016] Table: Sequence of Labels

[0017] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0018] The GmGRAS487 protein in A2) above is a protein that shares 75% or more amino acid sequence identity with the protein shown in Sequence 2 and has the same function. The 75% or more identity refers to 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The GmGRAS487 protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0020] The gene encoding the GmGRAS487 protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in Sequence 1, and / or by performing a missense mutation on one or more base pairs, and / or by attaching the coding sequence of the tag shown in the table above to its 5′ end and / or 3′ end. The DNA molecule shown in Sequence 1 encodes the GmGRAS487 protein shown in Sequence 2.

[0021] In the above applications, the substance may be any one of B1) to B9):

[0022] B1) Nucleic acid molecules encoding GmGRAS487;

[0023] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0024] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0025] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0026] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0027] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0028] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0029] B8) Nucleic acid molecules that reduce GmGRAS487 expression;

[0030] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B8).

[0031] In the above applications, the nucleic acid molecule described in B1) may be as follows: b11), b12), b13), or b14):

[0032] b11) The coding sequence is a cDNA molecule or DNA molecule of sequence 1 in the sequence listing;

[0033] b12) cDNA or DNA molecules of sequence 1 in the sequence listing;

[0034] b13) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and is a cDNA molecule or DNA molecule encoding GmGRAS487.

[0035] b14) hybridizes under strict conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes a cDNA molecule or DNA molecule that encodes GmGRAS487.

[0036] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0037] Those skilled in the art can readily mutate the nucleotide sequence encoding the GmGRAS487 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence of the GmGRAS487 protein isolated according to this invention, provided they encode and function the GmGRAS487 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0038] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0039] In the above applications, the stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 7% SDS, 0.5M NaPO4, and 1mM EDTA. Hybridization was performed in a mixed solution of NaPO4 and 1 mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS. Alternatively, hybridization was performed in a solution of 6×SSC and 0.5% SDS at 65°C, followed by rinsing once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS. Alternatively, hybridization was performed in a solution of 2×SSC and 0.1% SDS at 68°C, followed by rinsing twice for 5 min each time, and then hybridization was performed in a solution of 0.5×SSC and 0.1% SDS at 68°C, followed by rinsing twice for 15 min each time. Alternatively, hybridization was performed in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS at 65°C, followed by rinsing.

[0040] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0041] In the above application, the expression cassette (GmGRAS487 gene expression cassette) containing a nucleic acid molecule encoding the GmGRAS487 protein described in B2) refers to DNA capable of expressing the GmGRAS487 protein in host cells. This DNA may include not only a promoter to initiate transcription of the GmGRAS487 gene, but also a terminator to terminate transcription of the GmGRAS487 gene. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by methyl jasmonic acid); heat shock promoter (US Patent 5,187,267); tetracycline inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), and seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator (see, for example, Odell et al. (I)). 985Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res. 15:9627.

[0042] Recombinant vectors containing the GmGRAS487 gene expression cassette can be constructed using existing expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3′ untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3′ end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3′ ends of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nosine synthase gene) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed. This can involve adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as the nptII gene for resistance to kanamycin and related antibiotics, the bar gene for resistance to the herbicide phosphinic acid, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methotrexate, and the EPSPS gene for resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0043] In the above applications, the vector can be a plasmid, a granule, a bacteriophage, or a viral vector. Specifically, the plasmid can be the pROKII vector or the pZH01 vector.

[0044] B3) The recombinant vector may specifically be pROKII-GmGRAS487. pROKII-GmGRAS487 is a recombinant vector obtained by replacing the DNA fragment between the BamHI and KpnI recognition sequences of the pROKII vector with the GmGRAS487 gene shown in Sequence 1 of the sequence listing. It can express the fusion protein formed by GmGRAS487 and NPTII shown in Sequence 2 of the sequence listing.

[0045] B9) The recombinant vector may specifically be pZH01-GmGRAS487-RNAi, which is a recombinant vector obtained by inserting the DNA fragment shown in positions 1077 to 1363 of sequence 1 twice between the multiple cloning sites of pZH01, with the two insertion directions being opposite.

[0046] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium rhizogenes K599.

[0047] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0048] In the above applications, the plant may be M1, M2, or M3:

[0049] M1) Dicotyledons or monocotyledons;

[0050] M2) Leguminosae (family legumes);

[0051] M3) soybeans.

[0052] This invention also provides any of the following methods:

[0053] X1) Methods for cultivating salt-tolerant plants include knocking out the gene encoding GmGRAS487 in the recipient plant, or inhibiting the expression of the gene encoding GmGRAS487 in the recipient plant, or reducing the content of GmGRAS487 in the recipient plant, or reducing the activity of GmGRAS487 in the recipient plant, to obtain the target plant with enhanced salt tolerance.

[0054] X2) Methods to enhance plant salt tolerance include knocking out the gene encoding GmGRAS487 in the recipient plant, or inhibiting the expression of the gene encoding GmGRAS487 in the recipient plant, or reducing the content of GmGRAS487 in the recipient plant, or reducing the activity of GmGRAS487 in the recipient plant, to obtain the target plant with enhanced salt tolerance and achieve the enhancement of plant salt tolerance.

[0055] In the above methods, the inhibition of the expression of the GmGRAS487 encoding gene in the recipient plant in X1) and X2) can be achieved by introducing a nucleic acid molecule that inhibits the expression of the GmGRAS487 encoding gene or a recombinant vector expressing the nucleic acid molecule into the recipient plant.

[0056] In the above method, the encoding gene can be the nucleic acid molecule described in B1).

[0057] In the above method, the gene encoding GmGRAS487 can be modified as follows before being introduced into the recipient plant to achieve better expression:

[0058] 1) Modify and optimize according to actual needs to enable efficient gene expression; for example, according to the codons preferred by the recipient plant, the amino acid sequence of the coding gene of GmGRAS487 described in this invention can be changed to conform to plant preference; during the optimization process, it is best to maintain a certain GC content in the optimized coding sequence to best achieve high-level expression of the introduced gene in the plant, wherein the GC content can be 35%, more than 45%, more than 50%, or more than about 60%;

[0059] 2) Modify the gene sequence adjacent to the initiation methionine to enable efficient translation initiation; for example, by using a sequence known to be effective in plants.

[0060] 3) Linked to promoters of various plant expression to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of development of the target receptor; although it has been shown that many promoters derived from dicotyledons are functional in monocotyledons and vice versa, ideally, dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters are selected for expression in monocotyledons;

[0061] 4) Linking with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked with the gene of the present invention.

[0062] 5) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and Bronzel) and viral leader sequences (e.g., derived from TMV, MCMV, and AMV).

[0063] The coding gene for GmGRAS487 can be introduced into recipient plants using a recombinant vector containing the coding gene for GmGRAS487. Specifically, the recombinant vector can be pCAMBIA1301-GmGRAS487.

[0064] The recombinant vector can be introduced into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The transformed plant host can be either a monocotyledonous plant or a dicotyledonous plant.

[0065] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes that produce color changes or luminescent compounds (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly through drought treatment without adding any selective marker genes.

[0066] The target plant is understood to include not only first-generation plants containing the GmGRAS487 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus tissue, intact plants, and cells.

[0067] In the above method, the recipient plant can be M1, M2, or M3:

[0068] M1) Dicotyledons or monocotyledons;

[0069] M2) Leguminosae (family legumes);

[0070] M3) soybeans.

[0071] The present invention also provides a product for enhancing plant salt tolerance, the product containing GmGRAS487 or the substance that regulates the activity or content of the protein.

[0072] The product may have GmGRAS487 or the substance that regulates the activity or content of the protein as its active ingredient, or it may combine GmGRAS487 or the substance that regulates the activity or content of the protein with a substance having the same function as its active ingredient.

[0073] GmGRAS487 or the substance that regulates the activity or content of the protein are also within the scope of protection of this invention.

[0074] In this invention, the salt tolerance specifically refers to the plant's tolerance to a high-salt environment simulated by NaCl. The simulated high-salt environment can be an environment with a NaCl concentration of 50mM-300mM (e.g., 100mM).

[0075] Salt tolerance in plants can be reflected by plant survival rate, degree of leaf wilting, and / or relative ion permeability of leaves.

[0076] This invention involves transferring the gene encoding the transcription factor GmGRAS487 into the hairy roots of recipient soybean, resulting in transgenic hairy roots and transgenic chimeras. The salt tolerance of these transgenic soybean hairy roots is significantly improved compared to those transgenic roots with an empty vector. This demonstrates that the transcription factor GmGRAS487 and its encoding gene can regulate plant salt tolerance, which has important theoretical and practical significance for cultivating highly salt-tolerant plant varieties. Attached Figure Description

[0077] Figure 1 The transcriptional pattern of GmGRAS487 under 120mM NaCl treatment.

[0078] Figure 2 Schematic diagram of plant expression vectors pROKII-GmGRAS487 and pZH01-GmGRAS487-RNAi.

[0079] Figure 3 Molecular identification of soybean hairy roots overexpressing GmGRAS487 and GmGRAS487-RNAi.

[0080] Figure 4 This describes the salt-tolerant phenotype of the hairy roots and chimeras of GmGRAS487.

[0081] Figure 5 Statistical analysis of physiological parameters of GmGRAS487 transgenic hairy root chimeras under salt stress. *, p < 0.05; **, p < 0.01. Detailed Implementation

[0082] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0083] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0084] The soybean cultivar Kefeng 1 (Glycine max L.Merr. Kefeng 1) in the following examples is described in WKZhang, YJWang, GZLuo, JSZhang, CYHe, XLWu, JYGai, SYChen, QTL mapping of ten agronomic traits on the soybean (Glycine max L.Merr.) genetic map and their association with EST markers, Theor. Appl. Genet, 2004, 108:1131-1139, which is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0085] Soybean [Glycine max(L.)Merr]NANNong 1138-2: Germplasm Bank of National Soybean Improvement Center, Nanjing Agricultural University, provided by National Soybean Improvement Center, Nanjing Agricultural University.

[0086] The expression vector pROKII (binary expression vector) used in the following examples is described in DC Baulcombe, GR Saunders, MW Bevan, MA Mayo and BD Harrison, Expression of biologically active viral satellite RNA from the nuclear genome of transformed plants. Nature 321 (1986), pp. 446–449, and is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0087] The pZH01 vector, from Stratagene, is described in Han Xiao, et al. Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference, Plant Molecular Biology, 2003, 52, 957-966. It is also available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0088] Agrobacterium rhizogenes K599 is described in Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of root biology, Nature Protocols, 2007, 2(4), 549-552. It is available to the public from Professor Peter M. Gressnon, The University of Queensland, St Lucia, Queensland 4072, Australia, or from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences with the consent of Professor Peter M. Gressnon (written consent).

[0089] Example 1: Screening of the gene encoding soybean transcription factor GmGRAS487 and its cDNA cloning

[0090] In transcriptome analysis of soybean varieties Kefeng 1 (salt-sensitive) and Nannong 1138-2 (salt-tolerant) under normal and high salt stress, the inventors screened for the gene Glyma08g15530 (Locus name: Glyma.08G146900). The transcription rate of Glyma08g15530 decreased sharply upon treatment with 120 mM NaCl, suggesting its potential negative regulation of salt tolerance in plants. After two weeks of photoculture of the salt-tolerant soybean variety Nannong 1138-2, RNA was extracted from seedlings. 1 g of fresh seedlings was crushed in liquid nitrogen and suspended in 4 mol / L guanidine thiocyanate. The mixture was extracted with acidic phenol and chloroform. Anhydrous ethanol was added to the supernatant to precipitate total RNA, which was then dissolved in water to obtain total RNA. cDNA was synthesized using reverse transcriptase. Primers were:

[0091] Gm15530-F1: ATGAAAACGATGGATTTTGA and

[0092] Gm15530-R1: CTATTTGACCTTGTCATCCAGATAA.

[0093] Real-Time PCR identification was performed. The Real-Time PCR reaction was conducted using the TOYOBO Real-Time PCR Master Mix kit, following the instructions. The soybean Tublin gene was used as an internal control, and the primers used were Primer-TF: 5'-AACCTCCTCCTCATCGTACT and Primer-TR: 5'-GACAGCATCAGCCATGTTCA.

[0094] Figure 1 The results showed that Glyma08g15530 decreased significantly after 1 hour of treatment with 120mM NaCl, continuing until reaching its lowest point after 3 hours. Sequencing revealed that Glyma08g15530 contains 1464 bp, encoding 487 amino acid residues, and this protein was named GmGRAS487. In Nanjing Agricultural University 1138-2, the amino acid sequence of GmGRAS487 is sequence 2 in the sequence listing, and the DNA coding sequence is sequence 1.

[0095] Example 2: Construction of a plant expression vector for soybean transcription factor GmGRAS487

[0096] I. Construction of the GmGRAS487 overexpression vector pROKII-GmGRAS487

[0097] Using cDNA from Nanjing Agricultural University 1138-2 as a template, PCR amplification was performed using Gm15530-pROKII-F2 and Gm15530-pROKII-R2 to obtain PCR products.

[0098] Gm15530-pROKII-F2: AGAACACGGGGGACTCTAGAATGAAAACGATGGATTTTGA;

[0099] Gm15530-pROKII-R2:GATCGGGGAAATTCGAGCTCCTATTTGACCTTGTCATCCAGATAA.

[0100] The pROKII vector was double-digested with restriction endonucleases BamHI and KpnI. The PCR-recovered fragments were ligated into the pROKII vector using homologous recombination to obtain the recombinant vector pROKII-GmGRAS487 (partial vector schematic shown in the figure). Figure 2pROKII-GmGRAS487 is a recombinant vector obtained by replacing the DNA fragment between the BamHI and KpnI recognition sequences of the pROKII vector with the GmGRAS487 gene shown in Sequence 1 of the sequence listing. It can express the fusion protein formed by GmGRAS487 and NPTII shown in Sequence 2 of the sequence listing.

[0101] II. Construction of the GmGRAS487 RNAi expression vector pZH01-GmGRAS487-RNAi

[0102] First, total RNA was extracted from soybean 1138-2 using the Trizol method. The cDNA obtained by reverse transcription was used as a template, and primers were constructed to amplify a 287bp DNA fragment from position 1077 to position 1363 of the CDS region of the GmGRAS487 gene for constructing an RNAi vector.

[0103] The RNAi vector used was pZH01, and the primers are as follows:

[0104] GmGRAS487Ri-F1: (A single underscore indicates the recognition sequence for Xba I, and a double underscore indicates the recognition sequence for Sac I);

[0105] GmGRAS487Ri-R1: (A single underscore indicates the recognition sequence for Sal I, and a double underscore indicates the recognition sequence for Kpn I).

[0106] First, the PCR product and the pZH01 vector were double-digested with Sac I and Kpn I, respectively. The resulting large fragment of the PCR product was then ligated to the vector backbone. The recombinant vector with the correct sequence was then double-digested with Xba I and Sal I, and the resulting large fragment of the PCR product was ligated to the vector backbone. The resulting recombinant vector with the correct sequence was designated as pZH01-GmGRAS487-RNAi. Figure 2 ).

[0107] All the vectors constructed above were sequenced, and the next step of the experiment was carried out after verifying that the sequences were correct.

[0108] Example 3: Obtaining hairy roots of soybean transgenic GmGRAS487 gene

[0109] The Agrobacterium rhizogenes infection method was slightly modified from the method of Attila Kereszt et al. (Attila Kereszt, et al., Agrobacterium rhizogenes-mediated transformation of soybean to study of rootbiology, Nature Protocols, 2007, 2(4), 549-552). Following the literature "Wang, Fang; Chen, Hao-Wei; Li, Qing-Tian; Wei, Wei; Li, Wei; Zhang, Wan-Ke; Ma, Biao; Bi, Ying-Dong; Lai, Yong-Cai; Liu, Xin-Lei; Man, Wei-Qun; Zhang, Jin-Song; Chen, Shou-Yi, GmWRKY27 interacts with GmMYB174 to reduce expression of GmNAC29 for stress tolerance in soybean plants, 2015, The Plant Journal, 83, 224–236”, or the patent “Chen Shouyi et al., Plant stress resistance-related transcription factor GmWRKY78 and its encoding gene and application, patent number: ZL2011 1 0053083.7, authorization date 2013.10.09”, which uses the Agrobacterium rhizogenes-mediated transgenic root method.

[0110] Preparation of hairy roots with overexpression of GmGRAS487 and GmGRAS487-RNAi:

[0111] 1) Obtaining recombinant Agrobacterium

[0112] The recombinant expression vectors pROKⅡ-GmGRAS487 and pZH01-GmGRAS487-RNAi obtained in Example 2 were introduced into Agrobacterium rhizogenes K599 by electroporation to obtain recombinant Agrobacterium. The recombinant Agrobacterium containing the above plasmids were named K599 / pROKⅡ-GmGRAS487 and K599 / pZH01-GmGRAS487-RNAi, respectively.

[0113] 2) Hairy root transformation

[0114] The recombinant Agrobacterium K599 / pROKⅡ-GmGRAS487 and K599 / pZH01-GmGRAS487-RNAi were inoculated into soybean seedlings of Kefeng 1 with two true leaves after 6 days of growth using syringes. Specific methods are described in the above citation. Growth was carried out under moist conditions: 16 hours of light, 25℃, and 50% humidity. Two weeks later, the hairy roots that emerged were the transgenic hairy roots. 121 overexpression chimeras of K599 / pROKⅡ-GmGRAS487 (GmGRAS487-OE) and 120 K599 / pZH01-GmGRAS487-RNAi chimeric plants (GmGRAS487-RNAi) were obtained for further transgenic identification and salt tolerance testing.

[0115] Using the same method, Agrobacterium rhizogenes K599 / pROKⅡ containing the empty vector pROKⅡ was transformed into soybean Kefeng 1, resulting in 124 hairy root systems transformed with the empty vector, which served as empty vector controls.

[0116] 3) Molecular identification of transgenic hairy roots

[0117] Total RNA was extracted from transgenic hairy roots and the empty vector control, and reverse transcribed into cDNA. Using cDNA as a template, the expression level of the GmGRAS487 gene was analyzed using Gm15530-F1: GGTGTGGGAGGAAGGGTTTT and Gm15530-R1: GCCATTGGTTCCCAGATTGAAG. The soybean GmTubulin gene was used as an internal control, with primers Primer-TF: 5'-AACCTCCTCCTCATCGTACT and Primer-TR: 5'-GACAGCATCAGCCATGTTCA. The experiment was repeated three times, and the results were taken as mean ± standard deviation.

[0118] Figure 3 The expression levels of GmGRAS487 in the empty vector control, GmGRAS487-OE, and GmGRAS487-RNAi hairy roots were approximately 0.024, 2.35, and 0.013, respectively. The expression level of GmGRAS487 in GmGRAS487-OE was significantly higher than that in the empty vector control, while the expression level of GmGRAS487 in GmGRAS487-RNAi hairy roots was significantly lower than that in the control. Figure 3 ).

[0119] Example 4: Salt tolerance assessment of hairy roots transformed with GmGRAS487 and GmGRAS487-RNAi

[0120] The experimental samples were the control obtained from Example 3, and the hairy roots and plants of GmGRAS487-OE, GmGRAS487-RNAi.

[0121] The three types of experimental samples were divided into two groups of approximately 12 samples each. One group was treated with a 100 mM NaCl aqueous solution for 3 days, i.e., immersed in a 100 mM NaCl solution at 25°C for 3 days; the second group was immersed in water as a control. The experiment was repeated three times, and the results were taken as the mean ± standard deviation.

[0122] After treatment with 100mM NaCl aqueous solution for 3 days, photographs were taken for observation. Figure 4 The results showed that the plant and leaf phenotypes of the empty vector hairy roots and the two transgenic hairy roots indicated that there was no significant difference in growth between the hairy roots of the empty vector (pROKⅡ) and the hairy root chimeras of GmGRAS487 and GmGRAS487-RNAi under water treatment (normal conditions). After 3 days of treatment with 100mM NaCl, the wilting degree of the hairy root chimera and leaves of GmGRAS487-RNAi was significantly lower than that of the control chimera and leaves, while the wilting degree of the hairy root chimera and leaves of the overexpression of GmGRAS487 (GmGRAS-OE) was significantly higher than that of the control.

[0123] Survival rate detection:

[0124] Figure 5 The right side shows that under hydroponic conditions, the survival rate of all plants was 100%. After 3 days of treatment with 100 mM NaCl, the survival rates of the control, GmGRAS-RNAi, and GmGRAS-OE chimeras were approximately 40%, 63%, and 18%, respectively. The differences between the overexpression chimeras and RNAi chimeras and the control were significant and highly significant, respectively. This indicates that overexpression of GmGRAS487 reduces the salt tolerance of plants, while reduced expression increases the salt tolerance of plants.

[0125] NaCl-treated ion permeability detection:

[0126] When plant tissues are subjected to abiotic stress, cell membrane function is impaired or structure is damaged, increasing permeability and causing various water-soluble substances, including electrolytes, to leak out. When plant tissues are immersed in deionized water, the water's conductivity increases due to electrolyte leakage. The more severe the damage and the more extensive the cell membrane damage, the greater the leakage and the higher the water conductivity. Therefore, a conductivity meter can be used to measure changes in the conductivity of the exudate, indirectly reflecting the degree of damage to the plant tissues. Thus, conductivity measurement allows for the calculation of relative ion permeability, which indicates the degree of damage to the plant cell membrane.

[0127] The method for determination is as follows: Soybean leaves are cut off and placed in a clean screw-top glass bottle, then rinsed three times with deionized water. Next, 80 mL of deionized water is added to completely immerse the leaves, and a vacuum is applied for 45 minutes. After standing at room temperature for 30 minutes, the conductivity E1 is measured using a conductivity meter (DDC-308A, Shanghai Boqu Instrument Co., Ltd.). The leaves are then boiled for 15 minutes, and after cooling to room temperature, the mixture is stirred and the conductivity E2 is measured using a conductivity meter.

[0128] Relative ion permeability EL (%) = E1 / E2 X 100, where E1 and E2 are electrical conductivity.

[0129] Figure 5 The left figure shows that under hydroponic conditions, the ion permeability of all plants was very low, about 6%. After 3 days of treatment with 100mM NaCl, the survival rates of the control, GmGRAS-RNAi and GmGRAS-OE chimeras were about 47%, 62% and 17%, respectively. This indicates that the GmGRAS487 overexpression chimera suffered the most severe damage to the leaf cell membrane under salt stress, followed by the control. On the other hand, reducing the expression of GmGRAS487 significantly protected the cell membrane from damage under salt stress.

[0130] The above results indicate that GmGRAS487 negatively regulates salt tolerance in plants. Reducing the expression of GmGRAS487 significantly improves the salt tolerance of plants.

[0131] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> Application of soybean transcription factor GmGRAS487 in the regulation of plant salt tolerance <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 1464 <212> DNA <213> Soybean (Glycine max (L.) Merrill) <400> 1 atgaaaacga tggattttga gcaattttat tactcatttg gccctcctta catgaatcaa 60 ctccatgagt gtatctcaga aaatgcattt ccatttcaaa cagaaaatct cttatctcca 120 aatactttcc tagatgaaat gtttgatcaa gagtactcca tggaaggatt gctgcagcaa 180 catgcaaaca accaggagga cttttggttc ttgaagcatg atgatccact agagactgaa 240 ttttgtcatg gatttagccc tagtgctgag gaaaatatgc atgtttcaat ggaagaaggg 300 gattcttgtt tgaagggaat ccaagcagag ctaatggaag agactagttt agctgatctg 360 ttgctaacag gagctgaagc tgttgaagca caaaactggc cccttgcttc agatataatt 420 gagaaactta acaatgcctc atctttagaa aatggtgatg gtttattgaa caggttggct 480 cttttcttta ctcagagtct ctattataaa agcacaaatg cccctgaatt gctacagtgt 540 ggtgctgttt ctacgcacac aaatgctttc tgtgtgtttc aggttctcca agaactctct 600 ccctatgtaa aatttgctca tttcactgca aaccaagcaa tcttagaggc cacagaaggt 660 gctgaagatc ttcacatcat tgatttgat atcatggagg ggattcagtg gccacccttg 720 atggttgacc ttgcaatgaa gaaaagtgtt aattccctta gagtaacagc catcacagtg 780 aaccaaagag gtgcagattc tgttcaacaa acaggaagaa ggctcaaaga gtttgcagct 840 tctatcaact ttccattcat gtttgaccag ttaatgatgg aaaggagaagattttcaa 900 ggaattgaac ttggtcaaac actcatagtc aactgcatga tacaccagtg gatgcctaat 960 aggagcttct cattggtcaa aacattcttg gatggtgtga ccaaattgtc cccaaggctt 1020 gttgttttag tggagaaga actatttaat tttcctaggc tcaagtccat gtcctttgtg 1080 gagttcttct gtgaggcttt gcatcactac actgcacttt gtgattcact tgctagtaat 1140 ctatggggta gccacaagat ggagttgagc ctgatagaaa aagaggttat tgggctcaga 1200 atattggaca gtgtgaggca gtttccttgt gagagaaagg agagaatggt gtgggagaa 1260 gggttttatt ccttgaaagg gtttaaacgt gtacctatga gtacatgtaa catttcacaa 1320 gccaaattct tggtaagcct ctttggtgga gggtattggg tccaatacga gaagggtagg 1380 ttggccttgt gttggaagtc aaggcctttg actgtggctt caatctggga accaatggct 1440 tatctggatg acaaggtcaa atag 1464 <210> 2 <211> 487 <212> PRT <213> Glycine max (L.) Merrill <400> 2 Met Lys Thr Met Asp Phe Glu Gln Phe Tyr Tyr Ser Phe Gly Pro Pro 1 5 10 15 Tyr Met Asn Gln Leu His Glu Cys Ile Ser Glu Asn Ala Phe Pro Phe 20 25 30 Gln Thr Glu Asn Leu Leu Ser Pro Asn Thr Phe Leu Asp Glu Met Phe 35 40 45 Asp Gln Glu Tyr Ser Met Glu Gly Leu Leu Gln Gln His Ala Asn Asn 50 55 60 Gln Glu Asp Phe Gly Phe Leu Lys His Asp Asp Pro Leu Glu Thr Glu 65 70 75 80 Phe Cys His Gly Phe Ser Pro Ser Ala Glu Glu Asn Met His Val Ser 85 90 95 Met Glu Glu Gly Asp Ser Cys Leu Lys Gly Ile Gln Ala Glu Leu Met 100 105 110 Glu Glu Thr Ser Leu Ala Asp Leu Leu Leu Thr Gly Ala Glu Ala Val 115 120 125 Glu Ala Gln Asn Trp Pro Leu Ala Ser Asp Ile Ile Glu Lys Leu Asn 130 135 140 Asn Ala Ser Ser Leu Glu Asn Gly Asp Gly Leu Leu Asn Arg Leu Ala 145 150 155 160 Leu Phe Phe Thr Gln Ser Leu Tyr Tyr Lys Ser Thr Asn Ala Pro Glu 165 170 175 Leu Leu Gln Cys Gly Ala Val Ser Thr His Thr Asn Ala Phe Cys Val 180 185 190 Phe Gln Val Leu Gln Glu Leu Ser Pro Tyr Val Lys Phe Ala His Phe 195 200 205 Thr Ala Asn Gln Ala Ile Leu Glu Ala Thr Glu Gly Ala Glu Asp Leu 210 215 220 His Ile Ile Asp Phe Asp Ile Met Glu Gly Ile Gln Trp Pro Pro Leu 225 230 235 240 Met Val Asp Leu Ala Met Lys Lys Ser Val Asn Ser Leu Arg Val Thr 245 250 255 Ala Ile Thr Val Asn Gln Arg Gly Ala Asp Ser Val Gln Gln Thr Gly 260 265 270 Arg Arg Leu Lys Glu Phe Ala Ala Ser Ile Asn Phe Pro Phe Met Phe 275 280 285 Asp Gln Leu Met Met Glu Arg Glu Glu Asp Phe Gln Gly Ile Glu Leu 290 295 300 Gly Gln Thr Leu Ile Val Asn Cys Met Ile His Gln Trp Met Pro Asn 305 310 315 320 Arg Ser Phe Ser Leu Val Lys Thr Phe Leu Asp Gly Val Thr Lys Leu 325 330 335 Ser Pro Arg Leu Val Val Leu Val Glu Glu Glu Leu Phe Asn Phe Pro 340 345 350 Arg Leu Lys Ser Met Ser Phe Val Glu Phe Phe Cys Glu Ala Leu His 355 360 365 His Tyr Thr Ala Leu Cys Asp Ser Leu Ala Ser Asn Leu Trp Gly Ser 370 375 380 His Lys Met Glu Leu Ser Leu Ile Glu Lys Glu Val Ile Gly Leu Arg 385 390 395 400 Ile Leu Asp Ser Val Arg Gln Phe Pro Cys Glu Arg Lys Glu Arg Met 405 410 415 Val Trp Glu Glu Gly Phe Tyr Ser Leu Lys Gly Phe Lys Arg Val Pro 420 425 430 Met Ser Thr Cys Asn Ile Ser Gln Ala Lys Phe Leu Val Ser Leu Phe 435 440 445 Gly Gly Gly Tyr Trp Val Gln Tyr Glu Lys Gly Arg Leu Ala Leu Cys 450 455 460 Trp Lys Ser Arg Pro Leu Thr Val Ala Ser Ile Trp Glu Pro Met Ala 465 470 475 480 Tyr Leu Asp Asp Lys Val Lys 485

Claims

1. Any of the following applications of substances that reduce protein content: D1) Cultivating soybeans with enhanced salt tolerance; D2) Preparation and cultivation of salt-tolerant soybean products; The protein is a protein whose amino acid sequence is sequence 2.

2. The application according to claim 1, characterized in that: The substance is either B1 or B2 below. B1) Nucleic acid molecules that reduce the expression level of the protein described in claim 1; B2) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B1).

3. Any of the following methods: X1) A method for cultivating salt-tolerant soybeans, comprising knocking out the gene encoding the protein of claim 1 in the recipient soybean, or inhibiting the expression of the gene encoding the protein of claim 1 in the recipient soybean, or reducing the content of the protein of claim 1 in the recipient soybean, to obtain the target soybean with enhanced salt tolerance. X2) A method for enhancing the salt tolerance of soybeans includes knocking out the gene encoding the protein of claim 1 in the recipient soybean, or inhibiting the expression of the gene encoding the protein of claim 1 in the recipient soybean, or reducing the content of the protein of claim 1 in the recipient soybean, to obtain the target soybean with enhanced salt tolerance, thereby achieving the enhancement of the salt tolerance of soybeans.

4. The method according to claim 3, characterized in that: In X1) and X2), the expression of the protein-coding gene of claim 1 in the recipient soybean is inhibited by introducing a nucleic acid molecule that inhibits the expression of the protein-coding gene of claim 1 or a recombinant vector expressing the nucleic acid molecule into the recipient soybean.

5. The method according to claim 4, characterized in that: The coding gene is a DNA molecule whose coding sequence is sequence 1 in the sequence listing.

6. The method according to claim 4, characterized in that: The coding gene is a cDNA molecule whose coding sequence is sequence 1 in the sequence listing.

7. The method according to claim 4, characterized in that: The encoding gene is the DNA molecule of sequence 1 in the sequence listing.

8. The method according to claim 4, characterized in that: The encoding gene is the cDNA molecule of sequence 1 in the sequence listing.

9. The method according to claim 4, characterized in that: The encoding gene is a DNA molecule that has more than 75% identity with the nucleotide sequence of Sequence 1 and encodes the protein of claim 1.

10. The method according to claim 4, characterized in that: The encoding gene is a cDNA molecule that has more than 75% identity with the nucleotide sequence of Sequence 1 and encodes the protein of claim 1.

Images