Yeast engineering strain and construction and application thereof
Patent Information
- Application Number
- CN202210273343.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-18
- Publication Date
- 2026-09-29
- Estimated Expiration
- 2042-03-18
AI Technical Summary
由于罗汉果的种植条件苛刻、类似物复杂且产品纯化难,仅依赖从罗汉果中提取罗汉果苷无法实现大规模生产,因而限制了罗汉果苷在食品、医药等领域中的应用
[0035]本发明提供了赛门苷的新合成路线以及合成方法。本发明通过构建糖基转移酶表达质粒以及重组菌株,以罗汉果醇或罗汉果苷为原料,通过全细胞反应将上述原料转化为高倍甜味剂赛门苷。整个过程中无需额外补充UDP-葡萄糖,就能够实现赛门苷的高效合成。本发明方法成本低、过程简单、转化效率高,具有重要的应用潜力。
Smart Images

Figure CN116790392B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to genetic engineering and microbial fermentation, and in particular to an engineered bacterium that overexpresses a glycosyltransferase gene and its construction and application. Background Technology
[0002] Plant-derived natural non-sugar sweeteners are gaining increasing attention due to their advantages such as high sweetness, low calories, safety, and non-caries-causing properties. K,Wegner K,Piotrowska A,et al.Plants as a source of natural high-intensity sweeteners:a review.J Appl Bot Food Qual,2019,92:160–171;Jin ML,Muguruma M,Moto M,et al.Thirteen-week repeated dose toxicity of Siraitia grosvenori extract in Wistar Hannover(GALAS)rats.Food ChemToxicol,2007,45(7):1231–1237.). Mogroside is the main sweetener in monk fruit. In addition to the advantages of the aforementioned sweeteners, it also possesses various physiological activities such as regulating blood sugar balance and antioxidation (Zhou Y, Zheng Y, Ebersole J, et al. Insulin secretion stimulating effects of mogroside V and fruit extract of Luo Han Kuo (Siraitia grosvenori Swingle) fruit extract. ActaPharm Sin, 2009, 44(11): 1252–1257; Chen WJ, Wang J, Qi XY, et al. The antioxidant activities of natural sweeteners, mogrosides, from fruits of Siraitia grosvenori. Int J Food Sci Nutr, 2007, 58(7): 548–556.). Currently, my country, Japan, the United Kingdom, Singapore, South Korea, and other countries allow the use of mogroside as a food additive.
[0003] Mogroside is a tetracyclic triterpenoid compound with mogroside as its core, and different numbers of glucose molecules linked at the C3, C24, and C11 positions. The position and number of glucose molecules linked are important factors affecting the sweetness of mogroside. Currently, more than 30 triterpenoid mogrosides have been isolated and identified. Among them, mogroside V is the main component of mogrosides, accounting for 0.5%-1.4% of the dried fruit content, and its sweetness is 425 times that of sucrose (Matsumoto K, Kasai R, Ohtani K, et al. Minor cucurbitane-glycosides from fruits of Siraitia grosvenori (Cucurbitaceae). Chem Pharm Bull, 1990, 38(7): 2030–2032.). Siamenoside I (Sia I) has the highest sweetness, 563 times that of sucrose, but its content in mogrosides is extremely low (Matsumoto, K.; Kasai, R.; Ohtani, K.; Tanaka, O. Minor cucurbitane glycosides from fruits of Siraitiagrosvenori (Cucurbitaceae). Chem. Pharm. Bull. 1990, 38, 2030–2032. Due to the demanding cultivation conditions of monk fruit, the complexity of its analogues, and the difficulty in product purification, large-scale production of mogrosides cannot be achieved solely through extraction from monk fruit, thus limiting their application in food, medicine, and other fields. Increasing the content of high-sweetness mogrosides, including symmenidine, and finding alternative synthetic pathways and methods are crucial issues for addressing the application of mogrosides, including symmenidine.
[0004] Structurally, symmenidine is based on mogrool, with a glucose group at C3 and three glucose groups at C24. This specific glycosylation modification gives these compounds their high sweetness. Compared to the complex steps of chemical glycosylation, which requires multiple protection and deprotection processes, biocatalysis can effectively generate specific glycosylated products, making it an effective method for synthesizing such compounds. This patent utilizes the characteristic of glycosyltransferases forming specific glycosidic bonds, screened glycosyltransferase genes, and constructed an engineered yeast strain. The resulting *Saccharomyces cerevisiae* strain was deposited on February 21, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 24415. Summary of the Invention
[0005] This invention constructs a glycosyltransferase expression plasmid and uses a yeast strain with the EXG1 hydrolase gene knocked out to construct a glycosyltransferase expression strain. A new method for synthesizing symmenidine is provided by whole-cell transformation of compounds such as mogroside and mogroside.
[0006] The present invention adopts the following technical solution:
[0007] The present invention provides a strain of glycosyltransferase, characterized in that the strain contains nucleic acids encoding glycosyltransferase MG1 and glycosyltransferase MS2.
[0008] According to the present invention, the amino acid sequence of the glycosyltransferase MS2 is shown in SEQ ID NO:2. The amino acid sequence of the glycosyltransferase MG1 is shown in SEQ ID NO:4. Preferably, the nucleotide sequence of the glycosyltransferase MS2 is shown in SEQ ID NO:1. The nucleotide sequence of the glycosyltransferase MG1 is shown in SEQ ID NO:3.
[0009] According to the present invention, the strain is the target strain obtained by ligating glycosyltransferase MG1 and glycosyltransferase MS2 nucleic acids into a vector to obtain a recombinant vector, and then introducing it into a host bacterium.
[0010] According to the present invention, the host bacterium is any one of *Escherichia coli*, *Bacillus subtilis*, *Corynebacterium glutamicum*, lactic acid bacteria, yeast, or Chinese hamster ovary cells. Preferably, the host bacterium is a yeast strain. More preferably, the strain is a yeast strain deficient in the glycoside hydrolase gene EXG1.
[0011] According to the present invention, the amino acid sequence of the glycoside hydrolase gene EXG1 is shown in SEQ ID NO:6. The nucleotide sequence of the glycoside hydrolase gene EXG1 is shown in SEQ ID NO:5.
[0012] According to the present invention, the defective strains are knocked out by methods such as homologous recombination, random insertion mutation, RNA interference, and CRISPR / Cas9 gene editing.
[0013] According to the present invention, the vector may be a prokaryotic expression vector or a eukaryotic expression vector, for example, any one of the expression vectors. Preferably, the vector is selected from any one of YCPlac, pYES2, YEplac, YIp, pYZ290, and pYZ291.
[0014] According to the present invention, the nucleic acids encoding glycosyltransferase MG1 and glycosyltransferase MS2 are ligated with a vector by ligase or PCR recombination to form a recombinant vector.
[0015] According to the present invention, the strain was deposited at the China General Microbiological Culture Collection Center on February 21, 2022, with the collection center registration number CGMCC No. 24415.
[0016] The present invention also provides a method for constructing the above-mentioned strain, comprising the steps of obtaining a recombinant vector by ligating a nucleic acid encoding a glycosyltransferase MG1 and a glycosyltransferase MS2 into a host bacterium.
[0017] According to the present invention, the method includes the following steps:
[0018] 1) Construction of recombinant expression vectors;
[0019] 2) Construction of glycoside hydrolase gene knockout strains;
[0020] 3) Construction of the recombinant strain.
[0021] According to the present invention, in step 3), the plasmid containing the vector in step 1) is transformed into the strain in step 2) using the lithium acetate conversion method.
[0022] The present invention also provides the application of the above-mentioned strain in the synthesis of mogroside, including contacting the strain with a substrate to carry out a catalytic reaction.
[0023] Furthermore, the present invention also provides a method for producing mogroside, comprising contacting the strain with a substrate to carry out a catalytic reaction.
[0024] According to the present invention, the mogroside is one or more of mogroside IE, IIE, IIIE, IIIA, IVA, Sia I, or V. Preferably, the mogroside is symbioside Sia I and / or mogroside V.
[0025] The present invention also provides the application of functional strains overexpressing glycosyltransferase genes in the synthesis of sialoside (Sia I), characterized in that the functional strains overexpressing glycosyltransferase genes are the strains of the present invention.
[0026] According to the present invention, the application includes contacting the strain with a substrate to carry out a catalytic reaction.
[0027] According to the method or application of the present invention, the substrate is one or more of mogrosides, mogrosides IE, IIE, IIIE, or mogroside extract. The mogroside extract is a mixture containing mogrosides IIE, III, IV, and V, extracted directly from mogrosides.
[0028] According to the present invention, the method or application further includes:
[0029] (1) Culture of the strain and expression of the target glycosyltransferase;
[0030] (2) Method for detecting mogrosides using HPLC-MS.
[0031] According to the present invention, in step (1), the strain is inoculated into SD medium (uracil-deficient type) and cultured at 30°C and 200 rpm for 24 h to obtain the corresponding seed culture. The above seed culture is transferred to new SD medium at an inoculation rate of 1% and cultured for 96 h. The bacterial cells are collected by centrifugation at 5000 rpm for 10 min as whole-cell catalyst.
[0032] According to the present invention, in step (2), a C18 analytical column is used with an injection volume of 20 μL; mobile phases A and B are used, and the gradient elution conditions are: 0-25 min, 25%-85% gradient elution with pump A; the mobile phase flow rate is 1 mL / min, and the UV detection wavelength is 203 nm. Wherein, mobile phase A is acetonitrile + 0.1% formic acid; and mobile phase B is water + 0.1% formic acid.
[0033] According to the present invention, the mass spectrometry conditions are as follows: ESI ion source; positive ion mode scanning; scanning range of 100-1000 (m / z); injection voltage of 4500V; capillary temperature of 400℃; nebulized nitrogen flow rate of 6mL / min; drying temperature of 180℃; nebulization pressure of 1bar.
[0034] Beneficial effects
[0035] This invention provides a novel synthetic route and method for symbioside. By constructing a glycosyltransferase expression plasmid and using recombinant bacterial strains, this invention converts mogroside or mogroside as raw materials into the high-intensity sweetener symbioside through a whole-cell reaction. The entire process requires no additional UDP-glucose supplementation, achieving highly efficient synthesis of symbioside. This invention's method is low-cost, simple, and highly efficient, possessing significant application potential. Attached Figure Description
[0036] Figure 1 Construction of the recombinant expression vector pYZ290-MS2.
[0037] Figure 2 Construction of the recombinant expression vector pYZ291-MG1.
[0038] Figure 3 Construction of the recombinant expression vector pYZ291-MG1-MS2.
[0039] Figure 4 A method for detecting mogrosides using HPLC-MS. Specific Implementation
[0040] To facilitate understanding of the present invention, it will be described in more detail below. However, it should be understood that the present invention can be implemented in many different forms and is not limited to the embodiments or examples described herein. Rather, these embodiments or examples are provided to make the disclosure of the present invention more thorough and complete.
[0041] The following description is for illustrative purposes only, and only a small portion of the examples are presented; however, it should not be construed as limiting the invention. Unless otherwise specified, all reagents used in this invention are commercially available.
[0042] Preservation Information
[0043] The engineered Saccharomyces cerevisiae strain (Sg-M3) containing the glycosyltransferase expression plasmid pYZ291-MG1-MS2 of this invention was deposited at the China General Microbiological Culture Collection Center on February 21, 2022, with the collection center registration number CGMCC No. 24415.
[0044] Example 1. Construction of recombinant expression vectors pYZ290-MS2 and pYZ291-MG1
[0045] The rice-derived glycosyltransferase MS2 (nucleotide sequence as SEQ ID NO:1, amino acid sequence as SEQ ID NO:2) and the monk fruit-derived glycosyltransferase MG1 (nucleotide sequence as SEQ ID NO:3, amino acid sequence as SEQ ID NO:4) are preserved in our laboratory.
[0046] Design PCR primers for amplifying MG1 and MS2 gene fragments:
[0047] Upstream primer (MG1-F):
[0048] TCTAATCTAAGTTTTGGCGGCCGCTAAAATCATGGCTAGCATGGATGCTGCCCAACAAGG
[0049] Downstream primer (MG1-R):
[0050] GCACAAAAGCAGAGATGATCATTACTCGAGTATTTTAAGCAAGAGAGAAATTTCAGCGAC
[0051] Upstream primer (MS2-F): TAAAATCATGGCTAGCATGGACTCCGGCTACTCCTCCTC
[0052] Downstream primer (MS2-R): TGATCATTACTCGAGTCAATCCTTGTAAGATCTCAATTG
[0053] Design PCR primers for amplifying the pYZ291 linearized vector:
[0054] Upstream primer (pYZ291-F):
[0055] GTTGCTGAAATCTCTTTGTTGTTGAAGATTCTCGAGTAATGATCATCTCTGCTTTTGTGC
[0056] Downstream primer (pYZ291-R):
[0057] CCTTGTTGAGCAGCGTCCATGCTAGCCATGATTTTAGCGGCCGCCAAAACTTAGATTAGA
[0058] Design PCR primers for amplifying the pYZ290 linearized vector:
[0059] Upstream primer (pYZ290-F): GAAGTTATAAAGACCTCGAGTAATGATCATCTCTGCTTT
[0060] Downstream primer (pYZ290-R): GTAGCCACTATCCATGCTAGCCATGATTTTAGCGGCCGC
[0061] Using the synthesized genetic DNA as a template, a PCR reaction was performed. The reaction system is shown in Table 1.
[0062] Table 1. PCR amplification system
[0063]
[0064] The PCR procedure is shown in Table 2:
[0065] Table 2. PCR amplification conditions
[0066]
[0067] DpnI was added to the PCR product to digest the template, and the PCR product was purified and recovered using the Omega Cycle-Pure Kit. After recovery, recombination ligation was performed using the Vazyme ClonExpress II One Step Cloning Kit, as detailed in Table 3. After mixing all components, the mixture was incubated in a 37°C water bath for 30 min, and then immediately placed on ice for 2 min to terminate the reaction. The reaction product was directly used for competent cell transformation.
[0068] Select 2-3 transformants and send them to the company for sequencing. Once the sequence is verified to be correct, the target plasmid will be obtained. Figure 1 and Figure 2 ).
[0069] Table 3. DNA Recombination System
[0070]
[0071] Example 2. Construction of recombinant expression vector pYZ291-MG1-MS2
[0072] PCR primers were designed, using the vector pYZ290-MS2 as a template, to amplify the MS2 gene and its promoter and terminator fragments.
[0073] Upstream primer (P-MS2-TF): TTAGTTTCGACGGATATGGATAGTGGCTACTCCTCATCTTA
[0074] Downstream primer (P-MS2-TR): TGATCATTACTCGAGGTCTTTATAACTTCTCAATTGTTG
[0075] Design PCR primers using pYZ291-MG1 as a template to amplify the linearized pYZ291-MG1 vector:
[0076] Upstream primer (pYZ291-MG1-F): AAGTTATAAAGACCTCGAGTAATGATCAGCGAATTTCTTA
[0077] Downstream primer (pYZ291-MG1-R): GTAGCCACTATCCATATCCGTCGAAACTAAGTTCTGGTGT
[0078] The PCR reaction system, amplification procedure, and recombination system are shown in Tables 1, 2, and 3. Two to three transformants were selected and sent to the company for sequencing. After verification, the target plasmid was obtained. Figure 3 ).
[0079] Example 3. Construction of glycoside hydrolase gene knockout strain
[0080] To knock out the EXG1 gene (nucleotide sequence as SEQ ID NO:5, amino acid sequence as SEQ ID NO:6) of glycoside hydrolase in yeast strains, primers were designed to replace the gene with a resistance gene.
[0081] Upstream primer (EXG1-KO-F):
[0082] CAAAAGTTTTGAATAACACGTGCCTTTGATTTTTTGTTTACTTTTCTTTTTCTAGTTAATTACCAACTAAATACGCTGCAGGTCGACAACC
[0083] Downstream primer (EXG1-KO-R):
[0084] GTTCTGTTAAGTTTTGCTGATGAAAAATAACATTAGAAAATTCAGCTAAAATGAGCGGACTGAGGGCGACCTAGTGGATCTGATATCACC
[0085] The PCR reaction system and amplification procedure are shown in Tables 1 and 2.
[0086] DpnI was added to the PCR product to digest the template, and the PCR product was purified and recovered using the Omega Cycle-Pure Kit. The fragment was transformed into Saccharomyces cerevisiae using the lithium acetate conversion method, and the cells were thawed at 30°C for 2 hours. The cells were then plated on antibiotic-resistant plates and incubated at 30°C for 2-4 days until single colonies grew.
[0087] The lithium acetate conversion method is as follows:
[0088] 1. Pick colonies and grow them in 5-7 mL of liquid YPD, incubate at 30°C overnight (approximately 16 hours).
[0089] 2. Add 1.5 mL of overnight culture to 50 mL of fresh YPD, and incubate at 200 rpm and 30°C until OD reaches zero. 600 =1-1.5.
[0090] 3. During cell growth, prepare sufficient transformation buffer, filter and sterilize for later use. 0.6 mL 50% (w / v) PEG3350, 81.3 μL 1M lithium acetate, 20 μL Rockland salmon sperm DNA.
[0091] 4. Transfer the cells to a 50ml centrifuge tube, centrifuge at 3000rpm for 3min, and remove the supernatant.
[0092] 5. Resuspend the cells in 10 ml of 100 mM lithium acetate solution.
[0093] 6. Centrifuge at 3000 rpm for 3 min, remove the supernatant, and resuspend the cells in 300 μL of 100 mM lithium acetate.
[0094] 7. Aliquot 60 μL of the above cells into 1.5 mL centrifuge tubes.
[0095] 8. Add 10 μg of the above-mentioned DNA fragment to the cells and add 300 μL of Trans-Buffer.
[0096] 9. Resuscitate cells at 30℃ for 30 min, then incubate at 42℃ for 20 min.
[0097] 10. Centrifuge at 1500 rpm for 30 seconds to remove as much supernatant as possible.
[0098] 11. Spread 200 μL of fresh YPD medium, gently suspending the cells, onto selective medium and incubate at 30°C for 2-3 days.
[0099] Example 4. Construction of recombinant strains pYZ291-MG1, pYZ290-MS2, and pYZ291-MG1-MS2
[0100] Recombinant plasmids pYZ291-MG1, pYZ290-MS2, and pYZ291-MG1-MS2 were extracted and transformed into the above-mentioned Saccharomyces cerevisiae with the EXG1 gene knocked out using the lithium acetate transformation method. After recovery at 30°C for 2 hours, the plasmids were plated on SD defective plates and incubated at 30°C for 2-4 days, resulting in single colonies.
[0101] The lithium acetate conversion method is as follows:
[0102] 1. Pick colonies and grow them in 5-7 mL of liquid YPD, incubate at 30°C overnight (approximately 16 hours).
[0103] 2. Add 1.5 mL of overnight culture to 50 mL of fresh YPD, and incubate at 200 rpm and 30°C until OD reaches zero. 600 =1-1.5.
[0104] 3. During cell growth, prepare sufficient transformation buffer, filter and sterilize it for later use.
[0105] 4. Transfer the cells to a 50ml centrifuge tube, centrifuge at 3000rpm for 3min, and remove the supernatant.
[0106] 5. Resuspend the cells in 10 ml of 100 mM lithium acetate solution.
[0107] 6. Centrifuge at 3000 rpm for 3 min, remove the supernatant, and resuspend the cells in 300 μL of 100 mM lithium acetate.
[0108] 7. Aliquot 60 μL of the above cells into 1.5 mL centrifuge tubes.
[0109] 8. Add 0.1-1 μg of the above plasmid DNA to the cells and add 300 μL of Trans-Buffer.
[0110] 9. Resuscitate cells at 30℃ for 30 min, then incubate at 42℃ for 20 min.
[0111] 10. Centrifuge at 1500 rpm for 30 seconds to remove as much supernatant as possible.
[0112] 11. Spread 200 μL of fresh SC-dropout medium, gently suspending the cells, onto selective medium and incubate at 30°C for 2-3 days.
[0113] Example 5. Culture of engineered strains and expression of target glycosyltransferase
[0114] The engineered Saccharomyces cerevisiae strains (Sg-M1, Sg-M2, and Sg-M3) containing the glycosyltransferase expression plasmids pYZ291-MG1, pYZ290-MS2, and pYZ291-MG1-MS2 were inoculated into SD medium (uracil-deficient type) and cultured at 30°C and 200 rpm for 24 h to obtain the corresponding seed cultures. The seed cultures were then transferred to fresh SD medium at a 1% inoculation rate and cultured for 96 h. The cells were collected by centrifugation at 5000 rpm for 10 min as whole-cell catalysts.
[0115] Example 6. Method for detecting mogrosides using HPLC-MS
[0116] Analytical methods: C18 analytical column (4.6 × 250 mm, 5 μm); injection volume 20 μL; mobile phase A (acetonitrile + 0.1% formic acid) and B (water + 0.1% formic acid), gradient elution conditions: 0–25 min, 25%–85% gradient elution with pump A; mobile phase flow rate 1 mL / min; UV detection wavelength 203 nm. Mass spectrometry conditions: ESI ion source; positive ion mode; scan range 100–1000 m / z; injection voltage 4500 V; capillary temperature 400 °C; nebulized nitrogen flow rate 6 mL / min; drying temperature 180 °C; nebulization pressure 1 bar. Under the above HPLC-MS analytical conditions, the retention times of mogrol (Sia I, IV, IIIE, IIE) and mogrol (Sia IV, IV, IV, IIE) were 6.3 min, 6.9 min, 7.8 min, 9.0 min, and 22.3 min, respectively, and the [M+H] content in the mass spectrometry signal was [M+H]. + The molecular weights are 1125.6, 1125.6, 963.55, 801.5, and 477.39, respectively.
[0117] Example 7. Using engineered bacterial strains to convert mogrosides into sermonoside
[0118] The engineered Saccharomyces cerevisiae (Sg-M3) containing the glycosyltransferase expression plasmid pYZ291-MG1-MS2 was cultured for 96 h according to the method in Example 5. The cells were then collected by centrifugation, and the cells were washed twice with PB buffer (pH 7.0). Finally, the cells were resuspended in PB buffer (containing 5% glucose, 0.2 mM mogroside, pH 7.0) to achieve the desired final OD value. 600 The reaction mixture was set at 100 rpm and 40 °C for 24–96 h. The results showed that the final substrate conversion was 50%, with Sia I accounting for 50% of the product, IV for 40%, and III for 10%.
[0119] Example 8. Transformation of mogroside IIIE into cimenoside using engineered strains
[0120] The engineered Saccharomyces cerevisiae containing the glycosyltransferase expression plasmids pYZ291-MS2 or pYZ291-MG1-MS2 was cultured for 96 h according to the method in Example 5. The cells were then collected by centrifugation, and the cells were washed twice with PB buffer (pH 7.0). Finally, the cells were resuspended in PB buffer (containing 5% glucose, 0.2 mM mogroside IIe, pH 7.0) to achieve the desired final OD value. 600The value was 100. The above reaction solution was placed at 700 rpm and 40°C for 24-96 h. The final substrate conversion was 85%, of which Sia I was 50% of the product and V was 50% of the product.
[0121] Example 9. Transformation of mogroside IIIE into siamansi using engineered strains
[0122] The engineered Saccharomyces cerevisiae containing the glycosyltransferase expression plasmids pYZ291-MS2 or pYZ291-MG1-MS2 was cultured for 96 h according to the method in Example 5. The cells were then collected by centrifugation, and the cells were washed twice with PB buffer (pH 7.0). Finally, the cells were resuspended in PB buffer (containing 5% glucose, 0.2 mM mogroside IIIE, pH 7.0) to achieve the desired final OD value. 600 The reaction mixture was 100. The reaction solution was placed at 700 rpm and 40°C for 24-96 h. The final substrate conversion was 90%, with Sia I representing 95% of the product and V representing 5% of the product.
[0123] Example 10. Transforming monk fruit extract (a mixture of mogrosides extracted from monk fruit, containing 3.5% mogroside V) using engineered strains to generate monk fruit V.
[0124] The *Saccharomyces cerevisiae* engineered strains containing the glycosyltransferase expression plasmid pYZ291-MG1-MS2 were cultured for 96 hours according to the method in Example 5. The cells were then collected by centrifugation, and the cells were washed twice with PB buffer (pH 7.0). Finally, the cells were resuspended in PB buffer (containing 5% glucose, 10 mg *Siraitia grosvenorii* extract, pH 7.0) to achieve the desired final OD value. 600 The reaction solution was set at 700 rpm and 40°C for 24-96 hours. After the reaction, the content of mogroside V increased from 3.5% to 5.8%, an increase of 65.7%; the content of Sia I was 0.35%.
[0125] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. SEQUENCE LISTING <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> An engineered yeast strain and its construction and application <130> CPCN22410277 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 1389 <212> DNA <213> Artificial synthesis <400> 1 atggatagtg gctactcctc atcttatgct gctgccgctg gtatgcacgt tgtgatctgc 60 ccttggttgg cctttggtca cctgttacca tgtctggatt tagcccaaag actggcctca 120 agaggccata gagtatcatt tgtgtctact cctagaaata tctctcgttt accaccagtc 180 agacctgctc tagctcctct agttgcattc gttgctcttc cacttccaag agtagaagga 240 ttgccagacg gcgctgaatc tactaatgac gtaccacatg atagacctga catggtcgaa 300 ttgcatagaa gagcctttga tggattggca gctccatttt ctgagttcct gggcacagca 360 tgtgcagact gggttatagt cgatgtattt catcactggg ctgctgcagc cgcattggaa 420 cataaggtgc cttgtgctat gatgttgtta gggtcagcac acatgatcgc atccatagct 480 gatagaagat tggaaagagc tgaaacagaa tccccagccg cagcaggaca aggtaggcca 540 gctgccgccc caacctttga agtggctaga atgaaattga ttcgtactaa aggtagttca 600 gggatgagtc ttgctgaaag gttttctctg acattatcta gatcatcatt agttgtaggt 660 agatcctgcg tcgagttcga acctgaaaca gtacctttac tatctacttt gagaggcaaa 720 cctattactt tccttggtct aatgcctcca ttacatgaag gaaggagaga agatggtgaa 780 gatgctactg ttaggtggtt agatgcccaa cctgctaagt ctgttgtta cgttgcattg 840 ggttctgagg taccactagg gttggaaaag gtgcatgaat tagcattagg acttgagctg 900 gccggaacaa gattcctttg ggctttgaga aaaccaaccg gtgtttctga cgccgacttg 960 ctaccagctg ggttcgaaga gagaacaaga ggccgtggtg tcgttgctac tagatgggtc 1020 ccacaaatga gtattctagc tcatgcagct gtaggggcct ttctaaccca ttgcggttgg 1080 aactcaacaa tagaaggact gatgtttggt catccactta ttatgttacc aatcgcgggc 1140 gatcagggac ctaacgcaag attgattgag gcaaagaacg caggtctgca ggttgcacgt 1200 aatgatggtg atggttcctt tgatagagaa ggcgttgcag ctgccatcag agcagtcgcc 1260 gttgaggaag agtcatctaa agttttccaa gctaaggcca aaaaattaca agagattgtg 1320 gctgacatgg cttgtcacga aagatacatc gatggtttca tccaacaatt gagaagttat 1380 aaagactaa 1389 <210> 2 <211> 462 <212> PRT <213> Artificial Synthesis <400> 2 Met Asp Ser Gly Tyr Ser Ser Ser Tyr Ala Ala Ala Ala Gly Met His 1 5 10 15 Val Val Ile Cys Pro Trp Leu Ala Phe Gly His Leu Leu Pro Cys Leu 20 25 30 Asp Leu Ala Gln Arg Leu Ala Ser Arg Gly His Arg Val Ser Phe Val 35 40 45 Ser Thr Pro Arg Asn Ile Ser Arg Leu Pro Pro Val Arg Pro Ala Leu 50 55 60 Ala Pro Leu Val Ala Phe Val Ala Leu Pro Leu Pro Arg Val Glu Gly 65 70 75 80 Leu Pro Asp Gly Ala Glu Ser Thr Asn Asp Val Pro His Asp Arg Pro 85 90 95 Asp Met Val Glu Leu His Arg Arg Ala Phe Asp Gly Leu Ala Ala Pro 100 105 110 Phe Ser Glu Phe Leu Gly Thr Ala Cys Ala Asp Trp Val Ile Val Asp 115 120 125 Val Phe His His Trp Ala Ala Ala Ala Ala Leu Glu His Lys Val Pro 130 135 140 Cys Ala Met Met Leu Leu Gly Ser Ala His Met Ile Ala Ser Ile Ala 145 150 155 160 Asp Arg Arg Leu Glu Arg Ala Glu Thr Glu Ser Pro Ala Ala Ala Gly 165 170 175 Gln Gly Arg Pro Ala Ala Ala Pro Thr Phe Glu Val Ala Arg Met Lys 180 185 190 Leu Ile Arg Thr Lys Gly Ser Ser Gly Met Ser Leu Ala Glu Arg Phe 195 200 205 Ser Leu Thr Leu Ser Arg Ser Ser Leu Val Val Gly Arg Ser Cys Val 210 215 220 Glu Phe Glu Pro Glu Thr Val Pro Leu Leu Ser Thr Leu Arg Gly Lys 225 230 235 240 Pro Ile Thr Phe Leu Gly Leu Met Pro Pro Leu His Glu Gly Arg Arg 245 250 255 Glu Asp Gly Glu Asp Ala Thr Val Arg Trp Leu Asp Ala Gln Pro Ala 260 265 270 Lys Ser Val Val Tyr Val Ala Leu Gly Ser Glu Val Pro Leu Gly Val 275 280 285 Glu Lys Val His Glu Leu Ala Leu Gly Leu Glu Leu Ala Gly Thr Arg 290 295 300 Phe Leu Trp Ala Leu Arg Lys Pro Thr Gly Val Ser Asp Ala Asp Leu 305 310 315 320 Leu Pro Ala Gly Phe Glu Glu Arg Thr Arg Gly Arg Gly Val Val Ala 325 330 335 Thr Arg Trp Val Pro Gln Met Ser Ile Leu Ala His Ala Ala Val Gly 340 345 350 Ala Phe Leu Thr His Cys Gly Trp Asn Ser Thr Ile Glu Gly Leu Met 355 360 365 Phe Gly His Pro Leu Ile Met Leu Pro Ile Ala Gly Asp Gln Gly Pro 370 375 380 Asn Ala Arg Leu Ile Glu Ala Lys Asn Ala Gly Leu Gln Val Ala Arg 385 390 395 400 Asn Asp Gly Asp Gly Ser Phe Asp Arg Glu Gly Val Ala Ala Ala Ile 405 410 415 Arg Ala Val Ala Val Glu Glu Glu Ser Ser Lys Val Phe Gln Ala Lys 420 425 430 Ala Lys Lys Leu Gln Glu Ile Val Ala Asp Met Ala Cys His Glu Arg 435 440 445 Tyr Ile Asp Gly Phe Ile Gln Gln Leu Arg Ser Tyr Lys Asp 450 455 460 <210> 3 <211> 1362 <212> DNA <213> Artificial sequence <400> 3 atggaaaagg gtgacactca catcttggtt ttcccattcc cagctcaagg tcacattaac 60 ccattgttgc aattgtctaa gcacttgatc gctaagggta ttaaggtttc tttggtcact 120 accttgcacg tctctaacag aatgcaattg caaggtgctt actctaactc tgttaagatc 180 gaagtcattt ctgacggttc tgaagacaga ttggaaactg acaccttgag acaatacttg 240 gacagattca gacaaaagat gaccaagaac ttggaagactt cttgcaaaag gctatggtt 300 tcttctaacc caccaaagtt catcatctac gactctacta tgccatgggt tttggaagtc 360 gctaaggaat tcggtttgga cagagctcca ttctacaccc aatcttgtgc tttgaactct 420 atcaactacc acgttttgca cggtcaattg aagttgccac cagaaactcc aaccatttct 480 ttgccatcta tgccattgtt aagaccatct gacttgccag cttacgactt cgacccagct 540 tctactgaca ccatcattga cttgttgact tctcaatact ctaacatcca agacgctaac 600 ttgttgttct gtaacacttt cgacaagttg gaaggtgaaa tcattcaatg gatggaaacc 660 ttgggtagac cagttaagac tgtcggtcca accgttccat ctgcttactt gcaagagaga 720 gtcgaaaacg acaagcacta cggtttgtct ttgttcaagc your caaac cgtttgtttg 780 aagtggttgg actcttaagcc atctggttct gttttgtacg tctcttacgg ttctttggtc 840 900 ttcttgtggg ttgtcagaga caccgaagct gaaaagttgc caccaaactt cgttgaatct 960 gtcgctgaaa agggtttggt tgtctcttgg tgttctcaat tggaagttt ggctcaccca 1020 tctgtcggtt gtttcttcac tcactgtggt tggaactcta ccttggaagc tttgtgtttg 1080 ggtgttccag ttgtcgcttt cccacaatgg gctgaccaag tcactaacgc taagttcttg 1140 gaagcttt ggaaggtcgg taaaagagtt aagagaaacg aacaaagatt ggcttctaag 1200 gaagaagtta gatcttgtat ctgggaagtc atggaaggtg aaagagcttc tgaattcaag 1260 tctaactcta tggaatggaa gaagtgggct aaggaagctg ttgacgaagg tggttcttct 1320 gacaagaaca ttgaagaatt cgtcgctatg ttgaagcaaa cc 1362 <210> 4 <211> 454 <212> PRT <213> Artificial Synthesis <400> 4 Met Glu Lys Gly Asp Thr His Ile Leu Val Phe Pro Phe Pro Ala Gln 1 5 10 15 Gly His Ile Asn Pro Leu Leu Gln Leu Ser Lys His Leu Ile Ala Lys 20 25 30 Gly Ile Lys Val Ser Leu Val Thr Thr Leu His Val Ser Asn Arg Met 35 40 45 Gln Leu Gln Gly Ala Tyr Ser Asn Ser Val Lys Ile Glu Val Ile Ser 50 55 60 Asp Gly Ser Glu Asp Arg Leu Glu Thr Asp Thr Leu Arg Gln Tyr Leu 65 70 75 80 Asp Arg Phe Arg Gln Lys Met Thr Lys Asn Leu Glu Asp Phe Leu Gln 85 90 95 Lys Ala Met Val Ser Ser Asn Pro Pro Lys Phe Ile Ile Tyr Asp Ser 100 105 110 Thr Met Pro Trp Val Leu Glu Val Ala Lys Glu Phe Gly Leu Asp Arg 115 120 125 Ala Pro Phe Tyr Thr Gln Ser Cys Ala Leu Asn Ser Ile Asn Tyr His 130 135 140 Val Leu His Gly Gln Leu Lys Leu Pro Pro Glu Thr Pro Thr Ile Ser 145 150 155 160 Leu Pro Ser Met Pro Leu Leu Arg Pro Ser Asp Leu Pro Ala Tyr Asp 165 170 175 Phe Asp Pro Ala Ser Thr Asp Thr Ile Ile Asp Leu Leu Thr Ser Gln 180 185 190 Tyr Ser Asn Ile Gln Asp Ala Asn Leu Leu Phe Cys Asn Thr Phe Asp 195 200 205 Lys Leu Glu Gly Glu Ile Ile Gln Trp Met Glu Thr Leu Gly Arg Pro 210 215 220 Val Lys Thr Val Gly Pro Thr Val Pro Ser Ala Tyr Leu Asp Lys Arg 225 230 235 240 Val Glu Asn Asp Lys His Tyr Gly Leu Ser Leu Phe Lys Pro Asn Glu 245 250 255 Asp Val Cys Leu Lys Trp Leu Asp Ser Lys Pro Ser Gly Ser Val Leu 260 265 270 Tyr Val Ser Tyr Gly Ser Leu Val Glu Met Gly Glu Glu Gln Leu Lys 275 280 285 Glu Leu Ala Leu Gly Ile Lys Glu Thr Gly Lys Phe Phe Leu Trp Val 290 295 300 Val Arg Asp Thr Glu Ala Glu Lys Leu Pro Pro Asn Phe Val Glu Ser 305 310 315 320 Val Ala Glu Lys Gly Leu Val Val Ser Trp Cys Ser Gln Leu Glu Val 325 330 335 Leu Ala His Pro Ser Val Gly Cys Phe Phe Thr His Cys Gly Trp Asn 340 345 350 Ser Thr Leu Glu Ala Leu Cys Leu Gly Val Pro Val Val Ala Phe Pro 355 360 365 Gln Trp Ala Asp Gln Val Thr Asn Ala Lys Phe Leu Glu Asp Val Trp 370 375 380 Lys Val Gly Lys Arg Val Lys Arg Asn Glu Gln Arg Leu Ala Ser Lys 385 390 395 400 Glu Glu Val Arg Ser Cys Ile Trp Glu Val Met Glu Gly Glu Arg Ala 405 410 415 Ser Glu Phe Lys Ser Asn Ser Met Glu Trp Lys Lys Trp Ala Lys Glu 420 425 430 Ala Val Asp Glu Gly Gly Ser Ser Asp Lys Asn Ile Glu Glu Phe Val 435 440 445 Ala Met Leu Lys Gln Thr 450 <210> 5 <211> 2295 <212> DNA <213> Artificial sequence <400> 5 atgcctgcca aaatacacat ttctgcagac ggtcagtttt gcgataaaga tggcaacgag 60 atccaattgc gtggtgtcaa tttggatccg tcagttaaaa tccctgcaaa gccattccta 120 tccacccacg ctcccataga aaatgacacg tttttcgagg atgctgataa agtcagtttc 180 atcaatcacc ccttagttct tgatgatatc gaacagcata tcatcagatt gaaatcactg 240 ggttacaata ccattcgttt acccttcacc tgggaatctc ttgaacatgc tggtccagga 300 cagtacgatt ttgactatat ggattatatc gtcgaggtac taaccaggat taacagcgta 360 caacaaggta tgtacattta tttggaccct caccaagacg tctggtctag gtttagcggt 420 ggatctggag caccgctatg gaccttatac tgtgcagggt ttcaacctgc aaacttcctg 480 gccaccgatg ctgcaatctt acataattat tatattgacc ccaaaacggg cagggaagtt 540 ggcaaagatg aagagtccta ccctaagatg gtttggccta caaactactt caaactggcg 600 tgtcaaacaa tgtttacgtt attctttggt gggaaacaat atgctcctaa gtgcacaatt 660 aatggagaaa acatacagga ttacttgcaa ggaaggttta atgatgcaat catgacactg 720 tgcgcaagaa ttaaagaaaa ggctcctgag ttgtttgaga gcaactgcat tattggatta 780 gagtctatga acgagccaaa ctgtggttac attggtgaaa caaatctcga tgtgattccg 840 aaagagagaa atttgaaatt gggcaaaacg ccaacggcat ttcaaagctt tatgctgggt 900 gaaggtattg agtgcacaat agatcaatat aaaaggacat tttttggatt ttctaaggga 960 aaaccgtgca caatcaatcc caaaggcaaa aaagcttggc tgagtgcaga ggaaagagat 1020 gcgatagatg cgaagtataa ttgggaaagg aaccctgaat ggaaaccaga cacttgcatt 1080 tggaaactcc atggtgtttg ggagattcag aatggtaaac gccctgtttt actcaaacca 1140 aattacttta gccaacctga tgcaacggta tttaataaaca atcattttgt tgactattac 1200 actggaattt ataacaagtt tagggaattc gatcaagaat tgtttattat aatccaaccg 1260 ccggtaatga agccaccacc caatttacaa aattctaaaa tattggacaa taggacgatt 1320 tgtgcatgtc attttatga tggtatgaca ctaatgtata agacatggaa taaacgaatt 1380 ggcatagaca cctatggact agtaaacaaa aaatactcaa atcctgcctt tgctgtagtg 1440 cttggcgaaa acaatatacg gaaatgcatt aggaagcaat tatcagaaat gcaaaaggac 1500 gctaaatcca tgcttggaaa aaaagtacct gtattcttca ccgaaattgg tattccattt 1560 gacatggacg acaagaaagc atatattaca aatgactatt cttcacagac cgctgcattg 1620 gatgctcttg gatttgcatt agaaggaagt aatctttcgt acaccttatg gtgttattgc 1680 agtattaatt cacatatatg gggtgacaat tggaacaatg aagatttttc gatttggtcc 1740 ccggatgaca aaccactcta tcacgatacc cgagcaaaaa ctcctactcc tgagccatct 1800 ccagcctcta ctgtggcttc ggtatccact tctacatcta aatcgggttc ttcacaacca 1860 ccaagtttca taaaccaga taatcattta gatttggata gtccctcgtg cactttaaag 1920 agcgacttgt cagggttcag agctcttgat gctataatga gaccattccc catacaaatt 1980 cacggaagat ttgagtttgc tgagtttaac ttatgtaata aatcctacct tttgaaatta 2040 gttggtaaaa cgacacctga acagataact gtccctacat atatttttat accacggcac 2100 cattttacac caagccggtt gtcaattcgt tcatcatcag gtcattatac ctataacact 2160 gactaccagg ttcttgaatg gtttcacgag cctggccatc agttcattga aatttgcgca 2220 aaatcgaagt caaggcccaa cacccctgga agtgacactt cgaatgactt accagcggaa 2280 tgcgttatca gctaa 2295 <210> 6 <211> 764 <212> PRT <213> Artificial Synthesis <400> 6 Met Pro Ala Lys Ile His Ile Ser Ala Asp Gly Gln Phe Cys Asp Lys 1 5 10 15 Asp Gly Asn Glu Ile Gln Leu Arg Gly Val Asn Leu Asp Pro Ser Val 20 25 30 Lys Ile Pro Ala Lys Pro Phe Leu Ser Thr His Ala Pro Ile Glu Asn 35 40 45 Asp Thr Phe Phe Glu Asp Ala Asp Lys Val Ser Phe Ile Asn His Pro 50 55 60 Leu Val Leu Asp Asp Ile Glu Gln His Ile Ile Arg Leu Lys Ser Leu 65 70 75 80 Gly Tyr Asn Thr Ile Arg Leu Pro Phe Thr Trp Glu Ser Leu Glu His 85 90 95 Ala Gly Pro Gly Gln Tyr Asp Phe Asp Tyr Met Asp Tyr Ile Val Glu 100 105 110 Val Leu Thr Arg Ile Asn Ser Val Gln Gln Gly Met Tyr Ile Tyr Leu 115 120 125 Asp Pro His Gln Asp Val Trp Ser Arg Phe Ser Gly Gly Ser Gly Ala 130 135 140 Pro Leu Trp Thr Leu Tyr Cys Ala Gly Phe Gln Pro Ala Asn Phe Leu 145 150 155 160 Ala Thr Asp Ala Ala Ile Leu His Asn Tyr Tyr Ile Asp Pro Lys Thr 165 170 175 Gly Arg Glu Val Gly Lys Asp Glu Glu Ser Tyr Pro Lys Met Val Trp 180 185 190 Pro Thr Asn Tyr Phe Lys Leu Ala Cys Gln Thr Met Phe Thr Leu Phe 195 200 205 Phe Gly Gly Lys Gln Tyr Ala Pro Lys Cys Thr Ile Asn Gly Glu Asn 210 215 220 Ile Gln Asp Tyr Leu Gln Gly Arg Phe Asn Asp Ala Ile Met Thr Leu 225 230 235 240 Cys Ala Arg Ile Lys Glu Lys Ala Pro Glu Leu Phe Glu Ser Asn Cys 245 250 255 Ile Ile Gly Leu Glu Ser Met Asn Glu Pro Asn Cys Gly Tyr Ile Gly 260 265 270 Glu Thr Asn Leu Asp Val Ile Pro Lys Glu Arg Asn Leu Lys Leu Gly 275 280 285 Lys Thr Pro Thr Ala Phe Gln Ser Phe Met Leu Gly Glu Gly Ile Glu 290 295 300 Cys Thr Ile Asp Gln Tyr Lys Arg Thr Phe Phe Gly Phe Ser Lys Gly 305 310 315 320 Lys Pro Cys Thr Ile Asn Pro Lys Gly Lys Lys Ala Trp Leu Ser Ala 325 330 335 Glu Glu Arg Asp Ala Ile Asp Ala Lys Tyr Asn Trp Glu Arg Asn Pro 340 345 350 Glu Trp Lys Pro Asp Thr Cys Ile Trp Lys Leu His Gly Val Trp Glu 355 360 365 Ile Gln Asn Gly Lys Arg Pro Val Leu Leu Lys Pro Asn Tyr Phe Ser 370 375 380 Gln Pro Asp Ala Thr Val Phe Ile Asn Asn His Phe Val Asp Tyr Tyr 385 390 395 400 Thr Gly Ile Tyr Asn Lys Phe Arg Glu Phe Asp Gln Glu Leu Phe Ile 405 410 415 Ile Ile Gln Pro Pro Val Met Lys Pro Pro Pro Asn Leu Gln Asn Ser 420 425 430 Lys Ile Leu Asp Asn Arg Thr Ile Cys Ala Cys His Phe Tyr Asp Gly 435 440 445 Met Thr Leu Met Tyr Lys Thr Trp Asn Lys Arg Ile Gly Ile Asp Thr 450 455 460 Tyr Gly Leu Val Asn Lys Lys Tyr Ser Asn Pro Ala Phe Ala Val Val 465 470 475 480 Leu Gly Glu Asn Asn Ile Arg Lys Cys Ile Arg Lys Gln Leu Ser Glu 485 490 495 Met Gln Lys Asp Ala Lys Ser Met Leu Gly Lys Lys Val Pro Val Phe 500 505 510 Phe Thr Glu Ile Gly Ile Pro Phe Asp Met Asp Asp Lys Lys Ala Tyr 515 520 525 Ile Thr Asn Asp Tyr Ser Ser Gln Thr Ala Ala Leu Asp Ala Leu Gly 530 535 540 Phe Ala Leu Glu Gly Ser Asn Leu Ser Tyr Thr Leu Trp Cys Tyr Cys 545 550 555 560 Ser Ile Asn Ser His Ile Trp Gly Asp Asn Trp Asn Asn Glu Asp Phe 565 570 575 Ser Ile Trp Ser Pro Asp Asp Lys Pro Leu Tyr His Asp Thr Arg Ala 580 585 590 Lys Thr Pro Thr Pro Glu Pro Ser Pro Ala Ser Thr Val Ala Ser Val 595 600 605 Ser Thr Ser Thr Ser Lys Ser Gly Ser Ser Gln Pro Pro Ser Phe Ile 610 615 620 Lys Pro Asp Asn His Leu Asp Leu Asp Ser Pro Ser Cys Thr Leu Lys 625 630 635 640 Ser Asp Leu Ser Gly Phe Arg Ala Leu Asp Ala Ile Met Arg Pro Phe 645 650 655 Pro Ile Gln Ile His Gly Arg Phe Glu Phe Ala Glu Phe Asn Leu Cys 660 665 670 Asn Lys Ser Tyr Leu Leu Lys Leu Val Gly Lys Thr Thr Pro Glu Gln 675 680 685 Ile Thr Val Pro Thr Tyr Ile Phe Ile Pro Arg His His Phe Thr Pro 690 695 700 Ser Arg Leu Ser Ile Arg Ser Ser Ser Gly His Tyr Thr Tyr Asn Thr 705 710 715 720 Asp Tyr Gln Val Leu Glu Trp Phe His Glu Pro Gly His Gln Phe Ile 725 730 735 Glu Ile Cys Ala Lys Ser Lys Ser Arg Pro Asn Thr Pro Gly Ser Asp 740 745 750 Thr Ser Asn Asp Leu Pro Ala Glu Cys Val Ile Ser 755 760
Claims
1. A strain of glycosyltransferase, characterized in that, This strain contains nucleic acids encoding glycosyltransferase MG1 and glycosyltransferase MS2; The strain contains a glycoside hydrolase gene. EXG1 A gene-deficient Saccharomyces cerevisiae strain, wherein the amino acid sequence of the glycosyltransferase MS2 is shown in SEQ ID NO:2; the amino acid sequence of the glycosyltransferase MG1 is shown in SEQ ID NO:4; and the amino acid sequence of the glycoside hydrolase EXG1 is shown in SEQ ID NO:
6.
2. The strain according to claim 1, characterized in that, The strain is obtained by ligating glycosyltransferase MG1 and glycosyltransferase MS2 nucleic acids into a vector to obtain a recombinant vector, and then introducing it into a host bacterium.
3. The strain according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the glycosyltransferase MS2 is shown in SEQ ID NO:1; the nucleotide sequence of the gene encoding the glycosyltransferase MG1 is shown in SEQ ID NO:
3.
4. The strain according to claim 1, characterized in that, The glycoside hydrolase gene EXG1 The nucleotide sequence is shown in SEQ ID NO:
5.
5. The strain according to claim 1, characterized in that, The defective strains were knocked out using homologous recombination, RNA interference, and CRISPR / Cas9 gene editing methods.
6. The strain according to claim 2, characterized in that, The vector is a eukaryotic expression vector.
7. The strain according to claim 6, characterized in that, The carrier is selected from any one of YCPlac, pYES2, YEplac, and YIp.
8. The strain according to claim 2, characterized in that, The nucleic acids encoding glycosyltransferase MG1 and glycosyltransferase MS2 are ligated with the vector via ligase or PCR recombination to form a recombinant vector.
9. The strain according to claim 1, characterized in that, The strain was deposited on February 21, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with the registration number CGMCC No. 24415.
10. A method for constructing the strain according to any one of claims 1-8, comprising the steps of obtaining a recombinant vector by ligating a nucleic acid vector encoding glycosyltransferase MG1 and glycosyltransferase MS2, and then introducing it into a host bacterium to obtain a recombinant strain.
11. The method according to claim 10, characterized in that, The method includes the following steps: 1) Construction of recombinant expression vectors; 2) Construction of glycoside hydrolase gene knockout strains; 3) Construction of recombinant strains.
12. The method according to claim 11, characterized in that, In step 3), the plasmid containing the vector from step 1) is transformed into the strain from step 2) using the lithium acetate conversion method.
13. The use of any one of the strains described in claims 1-9 in the synthesis of mogrosides, comprising contacting the strain with a substrate to carry out a catalytic reaction, wherein the substrate is one or more selected from mogroside IIE, IIIE, or mogroside extract; wherein, Monk fruit extract is a mixture containing mogrosides IIE, III, IV and V, extracted directly from monk fruit; When the substrate is mogroside, the mogroside products are sialoside Sia I, mogroside IV, and mogroside III; When the substrate is mogroside IIE or mogroside IIIE, the mogroside products are symbioside Sia I and mogroside V; When the substrate is monk fruit extract, the mogroside product includes sialoside Sia I and mogroside V.
14. A method for producing mogroside, comprising contacting any one of the strains described in claims 1-9 with a substrate to carry out a catalytic reaction; wherein the substrate is one or more selected from mogroside IIE, IIIE, or mogroside extract; wherein, Monk fruit extract is a mixture containing mogrosides IIE, III, IV and V, extracted directly from monk fruit; When the substrate is mogroside, the mogroside products are sialoside Sia I, mogroside IV, and mogroside III; When the substrate is mogroside IIE or mogroside IIIE, the mogroside products are symbioside Sia I and mogroside V; When the substrate is monk fruit extract, the mogroside product includes sialoside Sia I and mogroside V.
15. The application of functional strains expressing glycosyltransferase genes in the synthesis of symbioside SiaI, characterized in that, The functional strain expressing the glycosyltransferase gene is any one of the strains described in claims 1-9, and the application includes contacting any one of the strains described in claims 1-9 with a substrate to carry out a catalytic reaction; the substrate is one or more of mogroside IIE and IIIE.
16. The method according to claim 14 or the application according to claim 13 or 15, characterized in that, The method or application also includes: the culture of the strain and the expression of the target glycosyltransferase.
17. The method according to claim 14 or the application according to claim 13 or 15, characterized in that, The method or application further includes: inoculating the strain into uracil-deficient SD medium, culturing at 30°C and 200 rpm for 24 h to obtain the corresponding seed culture, transferring the above seed culture to a new SD medium at an inoculation rate of 1%, culturing for 96 h; and collecting the bacterial cells by centrifugation at 5000 rpm for 10 min as a whole-cell catalyst.
Citation Information
Patent Citations
Method for preparing siamenoside of momordica grosvenori through enzyme-catalyzed semi-synthesis
CN113481275A
Engineering bacterium for improving content of rebaudioside A through whole-cell catalysis
CN113930377A