Recombinant plant lactobacillus engineering bacteria expressing hcp antigen gene and construction method and application thereof

Abstract

The application discloses a recombinant plant lactobacillus engineering bacterium expressing an Hcp antigen gene and a construction method and application thereof, and has the characteristics that the plant lactobacillus Ep-M17 expresses Pseudomonas plecoglossicida Hcp virulence antigen protein on the surface of the bacterium body, the construction method comprises the following steps: the steps of integrating an SPUsp45 signal peptide and an AcmA anchoring motif into a pMG36e carrier to construct a surface display carrier pMG36e-SPUsp45-AcmA; performing PCR amplification on the Pseudomonas plecoglossicida Hcp gene, recovering the Hcp protein by cutting a gel, and cloning the Hcp protein into a -T1 carrier to further prepare a pMG36e-SPUsp45-AcmA-Hcp; and finally, electrically transforming the pMG36e-SPUsp45-AcmA-Hcp recombinant plasmid into a plant lactobacillus Ep-M17 competent cell, picking positive bacteria, and obtaining the Hcp recombinant strain Ep-M17+pMG36e-SPUsp45-AcmA-Hcp, and the advantage is that the Hcp recombinant strain has an inhibiting effect on the Pseudomonas plecoglossicida.

Description

Technical Field

[0001] This invention relates to an oral vaccine using a recombinant live vector of Lactobacillus plantarum Hcp, and more particularly to a recombinant Lactobacillus plantarum engineered bacterium expressing the Hcp antigen gene, its construction method, and its application. Background Technology

[0002] Large yellow croaker (Larimichthyscrocea) is a major economic fish species in China's coastal waters, particularly in Zhejiang, Fujian, and Jiangsu provinces, where its farming has become a pillar industry of aquaculture. In recent years, with the gradual development of large yellow croaker farming towards intensification and industrialization, large-scale, high-density farming and water pollution have led to increasingly serious aquatic diseases, severely threatening the sustainable development of the industry. Visceral white spot disease caused by pathogenic *Pseudomonas aeruginosa* has frequently occurred in major yellow croaker farming areas in recent years. This disease is recurrent, has a high morbidity rate, and causes serious damage, resulting in significant economic losses for large yellow croaker farmers. Current reports on this disease both domestically and internationally mainly focus on pathogen isolation and identification, symptom and histopathological observation, and preliminary vaccine development and phage control, but effective prevention and control measures are still lacking. For a long time, the use of antibiotics to treat aquatic animal diseases has led to drug resistance, drug residues, and environmental spread, seriously affecting food safety and public health. With in-depth research into the relationship between gut microbiota and disease development, the use of probiotics for disease prevention and control is receiving increasing attention. Probiotic microecological preparations are a class of beneficial bacteria that regulate intestinal flora and enhance the nutritional and immune functions of animals. They can maintain the balance of the intestinal microecology and prevent secondary bacterial infections. Meanwhile, in recent years, the use of probiotics as engineered strains to express exogenous antigen proteins to prepare oral vaccines has become a research hotspot. Probiotic live vector vaccines not only perform probiotic functions but also exert vaccine protective effects, effectively controlling disease outbreaks and avoiding the problem of drug resistance in pathogens caused by long-term drug use.

[0003] *Pseudomonas splecoglossicida*, belonging to the class Gamma-Proteobacteria and the genus *Pseudomonas*, is a Gram-negative aerobic bacillus with polar flagella that enable motility. Colonies have smooth, white, semi-transparent, circular edges. This pathogen primarily infects fish including ayu (*Plecoglossus altivelis*), large yellow croaker (*Larimichthys crocea*), rainbow trout (*Oncorhynchus mykiss*), and grouper (*Epinepheluscoioides*). Infected fish show no obvious external symptoms, but dissection reveals white nodules (0.5-1.0 mm in diameter) on the spleen and kidneys; similar white spots later appear on the liver. This pathogen mainly affects fry and adult fish weighing over 200 grams, with a morbidity rate of approximately 30%. Due to the low temperatures, fish refuse to eat, making effective treatment with medication impossible, resulting in severe mortality (65%-70%). Currently, there are no effective control methods. Hcp is one of the main virulence factors of *Pseudomonas aeruginosa* and an important candidate vaccine antigen. However, as a subunit vaccine, it is costly and difficult to administer. In recent years, lactic acid bacteria have been widely used not only as probiotics in aquaculture but also as vaccine vectors to deliver antigen proteins into the host to exert immunomodulatory effects. Live vector vaccines have advantages that traditional vaccines cannot match. They can induce humoral and cellular immunity, stimulate systemic mucosal immunity, and have advantages such as high specificity, stable and sustained immune effects, specific induction sites, and simple immunization methods. Therefore, live vector vaccines based on virulence proteins are expected to become an effective tool for the prevention and control of *Pseudomonas aeruginosa*. Currently, there are no publicly available methods for constructing recombinant plant lactobacillus strains expressing the Hcp antigen gene or their applications. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a recombinant plant lactobacillus engineered bacterium expressing the Hcp antigen gene that has an inhibitory effect on Pseudomonas aeruginosa, as well as its construction method and application.

[0005] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: a recombinant plant lactobacillus engineered bacterium expressing the Hcp antigen gene, wherein the plant lactobacillus Ep-M17 expresses the Hcp virulence antigen protein of Pseudomonas aeruginosa on the surface of the bacterial cell.

[0006] The above method for constructing recombinant plant lactobacillus engineered bacteria expressing the Hcp antigen gene includes the following steps: (1) The SPUsp45 signal peptide and the AcmA anchoring motif were integrated into the pMG36e vector to construct the surface display vector pMG36e-SPUsp45-AcmA; (2) The Hcp gene of *Pseudomonas aeruginosa* was amplified by PCR, and the Hcp protein was recovered by gel extraction and cloned into... Carrier, named (3) Double digestion with BamHⅠ and HindⅢ The pMG36e-SPUsp45-AcmA plasmid was digested with BamHI and HindIII, and the recovered Hcp product was ligated into the digested pMG36e-SPUsp45-AcmA vector using T4 ligase. The vector was then transformed into E. coli DH5α competent cells and named pMG36e-SPUsp45-AcmA-Hcp. (4) Plant lactic acid bacteria Ep-M17 competent cells were prepared after eliminating endogenous plasmids in the Lactobacillus plantarum strain by SDS-thermotropic plasmid DNA elimination method. (5) Electroporate the pMG36e-SPUsp45-AcmA-Hcp recombinant plasmid into Lactobacillus plantarum Ep-M17 competent cells, and pick positive bacteria to obtain the Hcp recombinant strain Ep-M17+pMG36e-SPUsp45-AcmA-Hcp.

[0007] Further, the construction method of step (1) is as follows: according to the restriction site added to the shuttle vector pMG36e, the SPUsp45 signal peptide, the artificial peptide leisstcda and the AcmA anchoring motif are tandemly linked, and the SPUsp45-AcmA tandem sequence is synthesized by gene synthesis; according to the characteristics of the pET-28a(+) vector, the pET-28a(+) vector is double-digested with EcoRI and HindIII, and then the synthesized SPUsp45-AcmA tandem sequence is inserted to obtain the pET-28a(+)-SPUsp45-AcmA vector; the pET-28a(+)-SPUsp45-AcmA vector is double-digested with SalI and HindIII, and the digested fragments are recovered after electrophoresis to obtain the SPUsp45-AcmA product; at the same time, SalI and HindIII are used to digest the SPUsp45-AcmA product. III. Double digest pMG36e with enzymes, and directly purify and recover the digested product using a kit; preferably, ligate the recovered SPUsp45-AcmA product with the recovered pMG36e vector using T4 ligase to obtain the pMG36e-SPUsp45-AcmA vector displaying recombinant protein on the surface of lactic acid bacteria.

[0008] Furthermore, the SPUsp45 signal peptide sequence is: 5′-ATGAAAAAAAAGATTATCTCAGC TATTTTAATGTCTGCCCCGTTGTCAGGTGTTTACGCT-3′.

[0009] Furthermore, the AcmA anchoring sequence is: 5′-TCTTCTGCTGGTACTTCTAATTCCGGT -3′.

[0010] Further, step (2) specifically involves designing primers based on the Hcp gene DNA sequence of *Pseudomonas aeruginosa* and the map of the shuttle vector pValac: Upstream primer: 5′-CG GGATCC ATGGCATTTCCTATTTATATGACC-3′, where the 5′ end is digested with BamHI; downstream primer: 5′-CC AAGCTTThe DNA sequence TTACGTTCGATTGCGAATATC-3′, where the 5' end is digested with HindIII; the PCR reaction system was 25 μL: 2.5 μL buffer, 2 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL Taq enzyme, 1 μL cDNA template, and 17.25 mL ddH2O. The PCR reaction program was: 94℃ for 5 min, 94℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 10 min. After the PCR reaction, the PCR products were examined by 1.2 wt% agarose gel electrophoresis. The Hcp was then excised and cloned into... The carrier, and the resulting product are named

[0011] Furthermore, step (3) specifically involves double digestion with BamHI and HindIII. The Hcp product was recovered and the pMG36e-SPUsp45-AcmA plasmid was digested with BamHI and HindIII. The recovered Hcp product was then ligated into the digested pMG36e-SPUsp45-AcmA vector using T4 ligase and transformed into E. coli DH5α competent cells, named pMG36e-SPUsp45-AcmA-Hcp.

[0012] Furthermore, the *Lactobacillus plantarum* mentioned in step (4) was deposited at the China General Microbiological Culture Collection Center on March 21, 2022, with accession number CGMCC No. 24559.

[0013] Further, step (5) specifically involves: adding 1 μg of recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp to 40 μL of *Lactobacillus plantarum* Ep-M17 competent cells, incubating on ice for 5 min, and then adding it to a 0.2 mm electroporation cuvette pre-cooled to 4℃. The electroporation is performed at 2.0 kV and 200 Ω with a single pulse of 4.0 ms. After electroporation, immediately add 800 μL of MRS broth medium to the cuvette, incubate at 30℃ for 2 h, and then spread 200 μl of the culture medium onto erythromycin Erythromycin. + The bacteria were cultured on resistant MRS agar plates at 30°C for 20 h. Single colonies were picked and inoculated into 5 mL of MRS broth medium and cultured at 30°C for 20 h. The bacterial cells were collected and plasmids were extracted. The target fragment of Hcp was then detected by PCR, and positive bacteria were obtained, namely the Hcp recombinant strain Ep-M17+pMG36e-SPUsp45-AcmA-HCP.

[0014] The above-mentioned recombinant plant lactobacillus engineered bacteria expressing the Hcp antigen gene can be used in the preparation of Pseudomonas aeruginosa inhibitors or in the development of live vector oral vaccines to enhance the disease resistance of large yellow croaker to Pseudomonas aeruginosa.

[0015] Compared with existing technologies, the advantages of this invention are as follows: This invention discloses a recombinant plant lactobacillus engineered bacterium expressing the Hcp antigen gene, its construction method, and its application. The strain Ep-M17 itself possesses broad-spectrum antibacterial activity, exhibiting strong inhibitory effects against Vibrio parahaemolyticus, Pseudomonas aeruginosa, Aeromonas hydrophila, and Aeromonas vesiculosus, and can colonize the animal intestine. Furthermore, constructing a recombinant Ep-M17 strain displaying the Hcp antigen not only allows it to exert its original probiotic functions, such as inducing intestinal immune responses and regulating intestinal flora, but also fully expresses the Hcp antigen and directly presents it to intestinal epithelial immune cells, activating the fish's intestinal mucosal immune system and producing Hcp-specific mucosal antibodies in the intestine, thereby enhancing the fish's resistance to Pseudomonas aeruginosa. This live vector oral vaccine is easy to prepare and can be directly mixed into feed for fish. Oral immunization of large yellow croaker enhances the fish's disease resistance, thus enabling its widespread application in aquaculture and possessing significant economic value.

[0016] The aforementioned *Lactobacillus plantarum* strain is Ep-M17, classified and named *Lactobacillus plantarum*. It was deposited on March 21, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 24559. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Attached Figure Description

[0017] Figure 1 Designed for the SPUsp45-AcmA tandem secretion anchoring sequence; Figure 2 Design for constructing the surface-display recombinant expression plasmid pMG36e-SPUsp45-AcmA; Figure 3 Design for the construction of recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp; Figure 4 Electrophoresis diagrams during the construction of the G36e-SPUsp45-AcmA+Hcp plasmid; Figure 5For the detection of recombinant antigen Hcp protein expression, A: SDS-PAGE electrophoresis, B: Western blot detection, M: protein marker; 1: Lactobacillus plantarum Ep-M17; 2: recombinant Lactobacillus plantarum Ep-M17+pMG36e-SPUsp45-AcmA carrying empty vector; 3-4: recombinant Lactobacillus plantarum Ep-M17+pMG36e-SPUsp45-AcmA-Hcp. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. I. Specific Implementation Methods A method for constructing a recombinant plant lactobacillus engineered bacterium expressing the Hcp antigen gene includes the following steps: 1. Construction of the surface display substrate pMG36e-SPUsp45-AcmA SPUsp45 signal peptide sequence: 5′-ATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCTGCCCCGTTGTCAGGTGTTTACGCT-3′; AcmA anchoring sequence: 5′-TCTTCTGCTGGTACTTCTAATTCCGGTGGTTCAACAGCTACAA -3′.

[0020] The SPUsp45 signal peptide and AcmA anchoring motif were integrated into the pMG36e vector: Based on the shuttle vector pMG36e, restriction enzyme sites such as EcoRI, Sal I, EcoR V, BamHI, His, Xhol, and HindIII were added to tandem the SPUsp45 signal peptide, the artificial peptide leisstcda, and the AcmA anchoring motif (see sequence design). Figure 1 ), and synthesize the SPUsp45-AcmA tandem sequence through gene synthesis.

[0021] Based on the characteristics of the pET-28a(+) vector, the pET-28a(+) vector was double-digested with EcoRI and HindIII, and then the synthesized SPUsp45-AcmA tandem sequence was inserted to obtain the pET-28a(+)-SPUsp45-AcmA vector; the pET-28a(+)-SPUsp45-AcmA vector was then double-digested with SalI and HindIII. Figure 4 A) After electrophoresis, the digested fragments were recovered to obtain the SPUsp45-AcmA product. Simultaneously, pMG36e was double-digested with Sal I and Hind III, and the digested product was directly purified and recovered using a kit. Then, the recovered SPUsp45-AcmA product was ligated to the recovered pMG36e vector using T4 ligase to obtain the pMG36e-SPUsp45-AcmA vector displaying recombinant protein on the surface of lactic acid bacteria. The plasmid map is shown below. Figure 2 As shown.

[0022] The ligation product, pMG36e-SPUsp45-AcmA vector, was transformed into E. coli DH5α competent cells, and single clones were selected for bacterial testing. PCR testing was performed using a full-gold plasmid. Prepare the PCR reaction mixture (25 μl) according to the instructions of the PCR SuperMix kit, and add 12.5 μl of [unspecified ingredient] sequentially. PCR SuperMix was prepared using 1 μl each of the upstream and downstream primers for bacterial detection (upstream primer T7: 5′-TAATACGACTCACTATAGGG-3′; downstream primer T7-Ter: 5′-GCTAGTTATTGCTCAGCGG-3′), and 8.5 μl of nuclease-free water. After preparation, single colonies were picked up with a toothpick and transferred to centrifuge tubes, then mixed thoroughly. PCR reaction conditions were: 94℃ denaturation for 5 min, annealing at 60℃ for 60 sec, 35 cycles, extension at 72℃ for 10 min, and storage at 4℃. After PCR, detection was performed using a 1.2% agarose gel electrophoresis. 0.5 μl of bromophenol blue was added to each well, and the sample was then loaded for electrophoresis. The results showed a positive band size of 816 bp, consistent with the theoretical value. Figure 4 B). In addition, utilizing The HiPure Plasmid MiniPrep Kit (brand: TransGen; catalog number: EM111-01) was used to extract plasmids from positive bacteria, which were then verified by double digestion with BamHI and HindIII. The size of the digested product was 816 bp, consistent with the theoretical value. Figure 4 C).

[0023] 2. Amplification of the Hcp gene: Primers were designed based on the Hcp gene DNA sequence (ASJX01000083) of *Pseudomonas aeruginosa* and the pMG36e vector map.

[0024] Hcp gene sequence: ATGGCATTTCCTATTTATATGACCGTAACTGGCGCGGCACAAGGGCAGTTTAAAGGGGGGGTCGAAGAAGAGGGTCATAAAGAAAAAATTCGAGTGTTTGAGGTGGTTAGCGAGT CCGAAGTTAAGGTGCACCAGCAAACCGGTACAGCGGTTTCCCAGCGTCAGCATAAGGGTGTCACCGTGGTCAAAGAGCTCGATCCGGCTACGCCGCTGTTGATTCAGGCATTTAATAAGGGTGA GGCTTGTGAGGTGCTGCTGGAATATATGTGGATCAATAAAAAGAAGGGCGTAGAGGAGGTCTTTTACACCAAAAAACTTCAGGGTGGAGTAATCTCTAACCGTCAAGAGTTTCTGGATAGTGGTGCGTCGAATGAGGACGCGTTGTCAGGGCATATGGAGCGTATTACTTTTAACTGTAAGGTCACTACTGATACATGGGTTGATGGTGGTATTTCAACGGTTGATGATATTCGCAATCGAACGTAA.

[0025] Hcp gene forward amplification primer: 5′-CG GGATCC ATGGCATTTCCTATTTATATGACC-3′, where the 5' end is digested with BamHI; Hcp gene reverse amplification primer: 5′-CC AAGCTT TTACGTTCGATTGCGAATATC-3′, where the 5' end is cleaved to Hind III; The Hcp gene of *Pseudomonas aeruginosa* was amplified by PCR. The PCR reaction system was 25 μL: 2.5 μL buffer, 2 μL dNTPs, 1 μL forward primer, 1 μL reverse primer, 0.25 μL Taq enzyme, 1 μL cDNA template, and 17.25 μL ddH2O. The PCR reaction program was: 94℃ for 5 min, 94℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 10 min. After the PCR reaction, the PCR products were examined by 1.2 wt% agarose gel electrophoresis. The Hcp gene was recovered from the gel and cloned into... The vector was sequenced and identified, and named...

[0026] 3. Construction of Hcp recombinant expression plasmid Double digestion with BamHI and HindIII The vector was recovered, and the Hcp product was digested. The size of the digested product was 504 bp, consistent with the theoretical value. Figure 4 D) Simultaneously, the pMG36e-SPUsp45-AcmA plasmid was double-digested with BamHI and HindIII. Then, the recovered Hcp product was ligated into the digested pMG36e-SPUsp45-AcmA vector using T4 ligase and transformed into E. coli DH5α competent cells, named pMG36e-SPUsp45-AcmA-Hcp. The plasmid map is shown below. Figure 3 As shown. Positive clone strains were detected using the following primers. Upstream primer: 5′-CCCAATTGCTTCAATTAAGGCT-3′; Downstream primer: 5′-TACCGTCGCCTTTACCAACTG-3′.

[0027] To screen for positive bacteria using PCR, a 25 μL PCR reaction mixture was first prepared: 2.5 μL buffer, 2 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL Taq enzyme, and 18.25 μL ddH2O. Single colonies were then picked up with a toothpick and transferred to a PCR reaction tube, and mixed thoroughly with a pipette. The PCR reaction program was: 94℃ for 5 min, 94℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, for 35 cycles; then 72℃ for 10 min. After the PCR reaction, the PCR products were examined by 1.2 wt% agarose gel electrophoresis. The PCR amplification product size was 666 bp (e.g., ...). Figure 4 (As shown in E), consistent with the theoretical size. After bacterial testing, single-clone positive bacteria were selected for expanded culture, and the recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp was extracted and transformed into E. coli DH 5α competent cells. The cells were then treated with erythromycin Erythromycin. + Positive clones were screened using 10 μg / mL enzyme digestion, and the sequence of the recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp introduced into the positive strain was confirmed to be correct (e.g., ...). Figure 4 (as shown in F).

[0028] 4. Elimination of Endogenous Plasmids in *Lactobacillus plantarum* Ep-M17 and Preparation of Competent Cells: Endogenous plasmids in *Lactobacillus plantarum* Ep-M17 strain were eliminated using the SDS-thermotropic plasmid DNA elimination method. *Lactobacillus plantarum* Ep-M17 was inoculated into MRS broth and cultured at 37°C until the logarithmic growth phase. Then, 50 μL of the bacterial culture was inoculated into 10 mL of MRS medium containing 0.15 g / L sodium dodecyl sulfate (SDS) and cultured with shaking at 37°C for 24 h. Another 50 μL of the bacterial culture was then inoculated into 10 mL of MRS solid medium and cultured at 43°C for 24 h. This inoculation cycle was repeated 5-10 times. *Lactobacillus plantarum* strains with eliminated endogenous plasmids were streaked onto MRS solid medium and anaerobically cultured at 37°C until single colonies appeared. Single colonies were picked from the plates and inoculated into 10 mL of MRS liquid medium and incubated statically at 37°C until the OD phase was reached. 600 The value was 0.6-0.8. The above bacterial culture was inoculated at a rate of 1 wt% into 10 mL of MRS liquid medium containing 2 wt% glycine, and incubated statically at 37°C until the OD value reached 0.6-0.8. 600 The value is 0.2-0.3; incubate the above culture on ice for 10 min, centrifuge at 3500 r / min for 20 min, discard the supernatant and keep the bacterial pellet; add 1 mL of pre-cooled ddH2O to wash 3 times, centrifuge at 3500 r / min for 20 min, discard the supernatant; resuspend the bacterial pellet in ddH2O containing 10% glycerol to obtain Lactobacillus plantarum Ep-M17 competent cells, and store at -80℃ for later use.

[0029] 5. Transformation and Validation of Hcp Recombinant Strains Add 1 μg of recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp (less than 4 μL) to 40 μL of *Lactobacillus plantarum* Ep-M17 competent cells. After incubating on ice for 5 min, add the plasmid to a 0.2 mm electroporation cuvette pre-cooled to 4℃. Apply a single pulse at 2.0 kV and 200 Ω for 4.0 ms. Immediately after electroporation, add 800 μL of MRS broth medium (brand: Beijing Luqiao; catalog number: CM187) to the cuvette. Incubate at 30℃ for 2 h. Then, spread 200 μL of the culture medium onto an erythromycin Erythromycin plate. + (10 μg / mL) MRS agar plates with bacterial resistance (brand: Beijing Luqiao; catalog number: CM188) were incubated at 30℃ for 20 h. Single colonies were picked and inoculated into 5 mL of MRS broth medium, incubated at 30℃ for 20 h, and the bacterial cells were collected and utilized... The plasmid was extracted using the HiPure PlasmidMiniPrep Kit (brand: TransGen; catalog number: EM111-01). Then, PCR was used to detect the target Hcp fragment, yielding a positive bacterium, namely the recombinant Hcp strain Ep-M17+pMG36e-SPUsp45-AcmA-Hcp.

[0030] PCR bacterial testing uses full-gold plasmonic technology. Prepare the PCR reaction mixture (25 μl) according to the instructions using the PCR SuperMix kit. Add 1 μl of the extracted plasmid and 12.5 μl of... PCR SuperMix was used, containing 1 μl each of the upstream and downstream primers for bacterial detection (upstream primer: 5′-CCCA ATTGCTTCAATTAAGGCT-3′; downstream primer: 5′-TACCGTCGCCTTTACCAACTG-3′), and 8.5 μl of Nuclease-free Water. PCR reaction conditions were: 94℃ denaturation for 5 min, annealing at 60℃ for 60 sec, 35 cycles, extension at 72℃ for 10 min, and storage at 4℃. After PCR, the results were detected using a 1.2% agarose gel electrophoresis gel. 0.5 μl of bromophenol blue was added to each well, vortexed, and then the sample was loaded. Electrophoresis was performed, and the results were photographed. Figure 5 As shown in Figure A, the Hcp recombinant strain was successfully transformed.

[0031] 6. Scale-up culture and Western blot verification of Hcp recombinant strain Positive colonies were inoculated into 10 mL of fresh MRS broth and cultured statically for 20 h. Then, 5 mL of the bacterial culture was inoculated into 500 mL of MRS broth (1:100 volume ratio). After static culture for 20 h, the bacterial cells were collected by centrifugation at 5000 g, 4 °C for 10 min. The precipitate was washed twice with TES buffer (50 mM Tris-HCl, 1 mM EDTA, 25% sucrose aqueous solution; pH 8). The precipitate was then resuspended in TES buffer containing 1 mg / mL lysozyme, and 1 mM PMSF was added to prevent degradation of the target protein (Note: PMSF is toxic to humans; precautions should be taken). After incubation at 37 °C for 30 min, the mixture was sonicated for 15 min (36% amplitude, 5 s on, 5 s off). After sonication, the mixture was centrifuged at 5000 g, 4 °C for 10 min to collect the precipitate. An equal volume of 2×SDS loading agent was added to the sample. Boil the buffer for 10 minutes, then electrophoresis the sample in a 12 wt% separating gel for 3 hours. After electrophoresis, transfer the protein sample to a PVDF membrane and perform an immunoassay. The specific steps are as follows: Block the PVDF membrane in a 5 wt% skim milk solution at room temperature for 1 hour, wash the membrane three times with TBST for 5 minutes each time, then add His-Tag mouse antibody and incubate for 2 hours, wash the membrane three times, add HRP-labeled goat anti-mouse secondary antibody, incubate at room temperature for 1 hour, wash the membrane three times with TBST, and finally develop and observe the results using an ECL high-sensitivity chemiluminescence kit (brand: Sangon Biotech; catalog number: D601039). The results are as follows. Figure 5As shown in B, this indicates that the recombinant strain successfully expressed the Hcp protein.

[0032] II. Analysis of Experimental Results The aquaculture experiment was conducted at the pilot-scale ecological recirculating aquaculture system of the Marine College of Ningbo University. 400 healthy large yellow croakers (8-10cm in length, approximately 25-30g in weight) were purchased from a farm in Ninghai and randomly divided into 4 groups of 100 croakers each. Each group was housed in a 500L ecological aquaculture tank. The salinity was maintained at 28-30‰, the water temperature at 20±22℃, and the dissolved oxygen concentration at no less than 6.00mg / L. One-third of the disinfected filtered seawater was replaced daily, and feed was provided daily at 2-3% of the croakers' body weight. Four aquaculture groups were established, including control group 1: fed with commercial basal feed (model: 6.0...). # Brand: Jianma; Control group 2: fed with feed supplemented with Lactobacillus plantarum Ep-M17 (5.0×10⁻⁶). 8 CFU / mL); Control group 3: fed Ep-M17 feed supplemented with empty vector pMG36e-SPUsp45-AcmA (5.0×10⁻⁶ CFU / mL); 8 CFU / mL); Experimental group 4: Ep-M17 diet supplemented with pMG36e-SPUsp45-AcmA+Hcp expressing Hcp antigen (5.0×10⁻⁶ CFU / mL); 8 (CFU / mL). The culture experiment lasted for 45 days.

[0033] After the aquaculture experiment, a challenge experiment was conducted using *Pseudomonas aeruginosa*. Thirty fish were randomly selected from each group and cultured in 200L tanks. Fresh *Pseudomonas aeruginosa* was then added to achieve a final bacterial concentration of 1×10⁻⁶. 7 CFU / mL, shrimp were challenged with the virus for 7 consecutive days, and the mortality rate of shrimp in the tank was recorded daily. The mortality rate was calculated after the challenge ended.

[0034] Table 1. Relative immune protection rate after virus challenge. Table 1 shows that the experimental fish in control groups 1, 2, and 3 began to die on day 2, while the experimental fish in the oral M17-Hcp vaccine group began to die on day 4, and the time to death was longer than that in the control groups. The relative immunoprotection rate of the oral M17-Hcp vaccine group (75.0%) was higher than that of the three control groups (60.7%, 64.3%). This indicates that the M17-Hcp vaccine is safe and effective and can significantly improve the disease resistance of large yellow croaker.

[0035] In summary, *Lactobacillus plantarum* Ep-M17 possesses good adhesion properties and broad-spectrum antibacterial activity, enabling it to adhere and colonize aquatic animals such as shrimp, sweetfish, and large yellow croaker. It inhibits the growth of pathogens by regulating the intestinal flora and enhances the intestinal immune function of animals. Carrying the *Pseudomonas aeruginosa* antigen inhibits pathogen infection. By enabling *Lactobacillus plantarum* to carry the related antigen gene Hcp, it can exert the non-specific immunomodulatory ability of lactic acid bacteria and deliver Hcp to host cells to express the related antigen Hcp, inducing a specific immune response and improving the host's resistance to *Pseudomonas aeruginosa* infection.

[0036] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. The application of a recombinant plant lactobacillus engineered bacterium expressing the Hcp antigen gene in the preparation of a live vector oral vaccine that enhances the disease resistance of large yellow croaker to *Pseudomonas aeruginosa*, characterized in that: The recombinant plant-based Lactobacillus engineered bacteria is Lactobacillus plantarum Ep-M17 expressing the Hcp virulence antigen protein of Pseudomonas aeruginosa on its cell surface. The preservation number of the Lactobacillus plantarum Ep-M17 strain is CGMCC No. 24559, and the nucleotide sequence encoding the Hcp virulence antigen protein is as follows: ATGGCATTTCCTATTTATATGACCGTAACTGGCGCGGCACAAGGGCAGTTTAAAGGGGGGGTCGAAGAAGAGGGTCATAAAGAAAAAATTCGAGTGTTTGAGGTGGTTAGCGAGTCCGAAGTTAAGGTGCACCAGCAAACCGGTACAGCGGTTTCCCAGCGTCAGCATAAGGGTGTCACCGTGGTCAAAGAGCTCGATCCGGCTACGCCGCTGTTGATTCAGGCATT TAATAAGGGTGAGGCTTGTGAGGTGCTGCTGGAATATATGTGGATCAATAAAAAGAAGGGCGTAGAGGAGGTCTTTTACACCAAAAAACTTCAGGGTGGAGTAATCTCTAACCGTCAAGAGTTTCTGGAT AGTGGTGCGTCGAATGAGGACGCGTTGTCAGGGCATATGGAGCGTATTACTTTTAACTGTAAGGTCACTACTGATACATGGGTTGATGGTGGTATTTCAACGGTTGATGATATTCGCAATCGAACGTAA.

2. The application according to claim 1, characterized in that... The method for constructing recombinant plant lactobacillus engineered bacteria expressing the Hcp antigen gene includes the following steps: (1) The SPUsp45 signal peptide and the AcmA anchoring motif were integrated into the pMG36e vector to construct the surface display vector pMG36e-SPUsp45-AcmA; (2) The Hcp gene of *Pseudomonas aeruginosa* was amplified by PCR, recovered by gel extraction, and cloned into... pEASY ®-T1 vector, named pEASY ®-T1-Hcp; (3) Use BamH I and Hind III Double enzyme digestion pEASY ®-T1-Hcp vector, simultaneously using BamH I and Hind III. The pMG36e-SPUsp45-AcmA plasmid was double-digested with enzymes, and then the recovered Hcp product was ligated into the digested pMG36e-SPUsp45-AcmA vector using T4 ligase, and then transformed into... E. coli DH5α competent cells, named pMG36e-SPUsp45-AcmA-Hcp; (4) After eliminating endogenous plasmids in Lactobacillus plantarum strains by SDS-thermotropic plasmid DNA elimination method, Lactobacillus plantarum Ep-M17 competent cells were prepared. (5) Electroporate the recombinant plasmid pMG36e-SPUsp45-AcmA-Hcp into Lactobacillus plantarum Ep-M17 competent cells, and pick positive bacteria to obtain the Hcp recombinant strain Ep-M17+pMG36e-SPUsp45-AcmA-Hcp.

3. The application according to claim 2, characterized in that... The specific construction method of step (1) is as follows: Based on the addition of restriction enzyme sites to the shuttle vector pMG36e, the SPUsp45 signal peptide, the artificial peptide leisstcda, and the AcmA anchoring motif are tandemly linked, and the SPUsp45-AcmA tandem sequence is synthesized through gene synthesis; according to the characteristics of the pET-28a(+) vector, the pET-28a(+) vector is double-digested with EcoRI and HindIII, and then the synthesized SPUsp45-AcmA tandem sequence is inserted to obtain the pET-28a(+)-SPUsp45-AcmA vector; the pET-28a(+)-SPUsp45-AcmA vector is double-digested with SalI and HindIII, and the digested fragments are recovered after electrophoresis to obtain the SPUsp45-AcmA product; simultaneously, SalI and HindIII are used to digest the SPUsp45-AcmA product. pMG36e was double-digested with enzyme III, and the digested product was directly purified and recovered using a kit. The recovered SPUsp45-AcmA product was then ligated with the digested and recovered pMG36e vector using T4 ligase to obtain the pMG36e-SPUsp45-AcmA vector displaying recombinant protein on the surface of lactic acid bacteria.

4. The application according to claim 3, characterized in that... The SPUsp45 signal peptide sequence is as follows: 5′-ATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCTGCCCCGTTGTCAGGTGTTTACGCT-3′.

5. The application according to claim 3, characterized in that, The AcmA anchoring sequence is as follows: 5′--3′.

6. The application according to claim 2, characterized in that... Step (2) specifically involves designing primers based on the Hcp gene DNA sequence of *Pseudomonas aeruginosa* and the pMG36e vector map. The upstream primer is 5′-CG. GGATCC ATGGCATTTCCTATTTATATGACC-3′, where the 5′ restriction site is BamHI; downstream primer: 5′-CC AAGCTT The DNA sequence is TTACGTTCGATTGCGAATATC-3′, where the 5' end restriction site is Hind III. The PCR reaction system is 25 μL: 2.5 μL buffer, 2 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 0.25 μL Taq enzyme, 1 μL cDNA template, and 17.25 μL ddH2O. After the PCR reaction, the PCR products were examined by 1.2 wt% agarose gel electrophoresis. After gel extraction and cloning, the DNA was... pEASY ®-T1 vector, the resulting product is named pEASY ®-T1-Hcp.

7. The application according to claim 2, characterized in that... Step (3) specifically involves: using BamH I and Hind III double enzyme digestion pEASY ®-T1-Hcp vector, recovering Hcp products, and simultaneously using BamH I and Hind The pMG36e-SPUsp45-AcmA plasmid was double-digested with enzyme III, and then the recovered Hcp product was ligated into the digested pMG36e-SPUsp45-AcmA vector using T4 ligase, and then transformed into... E. coli DH 5α competent cells were named pMG36e-SPUsp45-AcmA-Hcp.

8. The application according to claim 2, characterized in that... The *Lactobacillus plantarum* mentioned in step (4) was deposited at the China General Microbiological Culture Collection Center on March 21, 2022, with accession number CGMCC No. 24559.

Images