A method for constructing and applying engineered bacteria that express exogenous hyaluronic acid.

Abstract

This invention relates to a method for constructing and applying an engineered bacterium that expresses hyaluronic acid exogenously, belonging to the field of engineered microbiology technology. The invention uses the xanthan gum-synthesizing strain *Xanthomonas oryzae* NRRL B-1459 as the starting strain, and introduces hyaluronic acid synthase exogenously while inhibiting xanthan gum metabolism. gumD The expression provides an engineered bacterium capable of exogenously expressing hyaluronic acid. This strain has lower substrate requirements, milder fermentation conditions, and high hyaluronic acid synthesis efficiency, and has important application value in the field of hyaluronic acid biosynthesis.

Description

Technical Field

[0001] This invention belongs to the field of engineered microbial technology, specifically relating to a method for constructing an engineered bacterium that expresses exogenous hyaluronic acid and a method for biosynthesizing hyaluronic acid based on this strain. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Microbial polysaccharides, due to their unique physicochemical properties, bioactivity, and safety and stability, are widely used in food, pharmaceuticals, petroleum, daily chemicals, and agriculture as emulsifiers, suspending agents, thickeners, stabilizers, gelling agents, humectants, film-forming agents, lubricants, and preservatives. Microbial polysaccharides are non-toxic, safe, have short production cycles, and are easy to separate and purify. They can be prepared from inexpensive, renewable raw materials through biotechnology, attracting close attention from industry and academia, and are gradually becoming effective alternatives to animal and plant-derived polysaccharides. However, current industrial production of microbial polysaccharides is still limited to a few types of microorganisms selected from nature, such as hyaluronic acid (HA), xanthan gum, and gellan gum, and their yield and functions are still subject to many limitations. In particular, the high production cost of hyaluronic acid, due to the high nutritional requirements of the culture medium for its synthesizing strains and its low yield, has become a serious constraint on its application expansion.

[0004] Xanthomonas aeruginosa ( Xanthomonas campestris Xanthan gum, a microbial polysaccharide, can be synthesized from starch through fermentation with a yield exceeding 45 g / L and a sugar conversion rate of up to 80%. It exhibits significant advantages in high-viscosity polysaccharide synthesis efficiency, low-cost substrate adaptability, and biosafety, making it an ideal foundational strain for constructing a universal microbial polysaccharide chassis cell platform. Xanthan bacillus can efficiently utilize starch to synthesize large quantities of polysaccharide molecules under high-viscosity, low-oxygen conditions. Furthermore, it can synthesize large quantities of precursors for polysaccharide synthesis, such as UDP-Glc, UDP-GlcUA, and UDP-GlcNAc, through its sugar metabolism pathway. This makes it suitable for the efficient expression of various high-viscosity microbial polysaccharides, such as hyaluronic acid, gellan gum, and veland gum. In addition, there are reports of obtaining hyaluronic acid through exogenous expression using Bacillus, Corynebacterium glutamicum, and yeast. However, due to technological limitations, industrial-scale production has not yet been achieved. Nevertheless, the efficient synthesis of hyaluronic acid through exogenous expression provides a methodological reference for fundamentally solving the bottleneck problem in hyaluronic acid production. Summary of the Invention

[0005] The technical problems this invention aims to solve include low fermentation yield and high production costs of high-viscosity microbial polysaccharides. To address these issues, this invention modifies the metabolic flux of existing microbial polysaccharide xanthan gum synthesis strains to obtain a chassis bacterium capable of low-cost exogenous expression of hyaluronic acid, showing promising application prospects in the field of hyaluronic acid synthesis. Specifically, the above solution is achieved through the following technical solutions: Firstly, a strain is provided that expresses hyaluronic acid exogenously, the starting strain being Xanthomonas spp. expressing xanthan gum exogenously. Xanthomonas campestris Compared to the starting strain, the engineered strain was modified to have increased expression of hyaluronic acid synthase while inhibiting xanthan gum metabolic synthesis activity.

[0006] In the above scheme, the phrase "modified to have increased hyaluronic acid synthase expression while inhibiting xanthan gum metabolic synthesis activity" means that the engineered strain has undergone gene modification compared to the original strain. After modification, the activity of hyaluronic acid synthase is increased, while the metabolic synthesis activity of xanthan gum is inhibited. Among them, feasible modification methods for increasing activity include introducing exogenous active genes, while feasible modification methods for inhibiting activity include inhibiting the expression of related genes or modifying expression regulatory sequences.

[0007] In one embodiment verified by the present invention, the starting strain of the engineered strain is the xanthan gum synthesizing strain Xanthomonas brassicae (… Xanthomonas campestris NRRL B-1459, the present invention uses the above strain as the starting strain to modify the hyaluronic acid biosynthesis metabolic pathway, which helps to obtain an engineered strain with lower requirements for substrate and fermentation conditions, and is conducive to improving the economic benefits of hyaluronic acid biosynthesis technology.

[0008] Preferably, the inhibition of xanthan gum metabolic synthesis activity is achieved by inhibiting... gumD The expression is achieved, and the inhibition of gene expression can be achieved through gene knockout via homologous recombination. It should be noted that, depending on the starting strain, the protein or gene sequences related to xanthan gum metabolic synthesis activity may differ. However, identifying the corresponding gene or even gene mutant based on activity display is not difficult for those skilled in the art and is still included within the technical concept of this invention.

[0009] Preferably, the hyaluronic acid synthase is spHasA, In one specific embodiment, the spHasA It originates from Streptococcus pyogenes.

[0010] In one specific embodiment, the starting strain of the engineered bacteria is Xanthomonas vesicae NRRL B-1459, and the amplification of this strain... gumDThe upstream and downstream homologous arm genes were extracted; and the corresponding knockout plasmid was constructed and transformed into E. coli to obtain the recombinant strain DH-5α / pK18mobSacB-ΔgumD; the plasmid was extracted from the recombinant strain DH-5α / pK18mobSacB-ΔgumD and transferred to the starting strain by electroporation transformation; and the xanthan gum-synthesizing chassis cells of Xanthomonas javanica that do not synthesize xanthan gum were screened by sucrose lethal plate. Xanthomonas campestris Δ gumD Modified Xanthomonas campestris Δ gumD middle gumD The sequence was partially knocked out, wild type gumD The sequence is shown in SEQ ID NO. 1, after knockout. Xanthomonas campestris Δ gumD Among the plants gumD The sequence is shown in SEQ ID NO. 2.

[0011] Hyaluronic acid synthase gene spHasA The sequence is shown in SEQ ID NO. 3; a hyaluronic acid synthase exogenous expression plasmid was constructed and transformed into Escherichia coli to obtain the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA. Plasmids were extracted from the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA and electroporated into chassis cells. Xanthomonas campestris Δ gumD In this process, an engineered bacterium expressing exogenous hyaluronic acid was obtained, and the engineered strain was named Xanthomonas javanica (…). Xanthomonas campestris HA.

[0012] In a second aspect, a method for biosynthesizing hyaluronic acid based on the above-mentioned engineered strain is provided, the method comprising inoculating the seed culture of the above-mentioned engineered strain into a fermentation medium for shake-flask fermentation. The fermentation medium comprises the following components in the following proportions: corn starch 3.0~5.0g / 100mL; soybean flour 0.3~0.5g / 100mL; calcium carbonate 0.1~0.3g / 100mL; kanamycin 100ng / mL; the remainder being softened water; pH 7.0~7.2.

[0013] Preferably, the fermentation conditions are: 28~32°C; 280~320 r / min; inoculum size is 9~11% ( v / v The volume of liquid in the shake flask is 80mL / 500mL, and the fermentation time is 70~75h.

[0014] In addition, the present invention also provides a method for activating the above-mentioned strains and preparing seed culture: The activation method for the strain is as follows: The refrigerated strain was aseptically inoculated onto an agar slant culture medium and incubated at 28-32°C for 1-2 days to obtain activated strains. The agar slant solid culture medium was LB medium containing 100 ng / mL kanamycin.

[0015] The method for preparing the seed culture of the strain is as follows: Select production strains that have been activated and cultured on slant agar ( Xanthomonas campestris Add 2-3 loops of HA to the fermentation seed liquid and incubate at 28-32°C for 16-20 hours to obtain mature seed liquid.

[0016] Preferably, the seed culture medium comprises the following components in the following proportions: corn starch 0.8~1.2g / 100mL; soybean flour 0.1~0.4g / 100mL; calcium carbonate 0.1~0.3g / 100mL; kanamycin 100ng / mL; the remainder being softened water; pH 7.0~7.2.

[0017] The beneficial effects of one or more of the above technical solutions are: (1) Compared with existing technologies, the technology disclosed in this invention constructs a chassis cell that can express other microbial polysaccharides by knocking out the key enzymes for polysaccharide synthesis in the original strain. Based on the polysaccharide synthesis and metabolism characteristics of the chassis cell, a variety of microbial polysaccharides can be synthesized, laying a good technical foundation for promoting the healthy development of the microbial polysaccharide industry.

[0018] (2) The exogenous expression of hyaluronic acid constructed using the technology disclosed in this invention can significantly reduce its production cost and improve fermentation production efficiency, and can significantly promote the expansion of the hyaluronic acid industry.

[0019] (3) The engineered strain Xanthomonas hyaluronic acid HA provided by this invention has a high exogenous expression efficiency of hyaluronic acid. The synthesis efficiency using the second method is as follows: a. The yield of hyaluronic acid was 1.1~1.5 g / 100 g fermentation broth; b. The viscosity of the hyaluronic acid fermentation broth is 8450~11860 mPa·s; c. The molecular weight of hyaluronic acid is 1.36 ± 0.11 × 10⁻⁶. 6 Da, compared with commercially available hyaluronic acid products (1.33±0.15 ×10). 6 There was no significant difference in molecular weight between Da and Da. Attached Figure Description

[0020] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0021] Figure 1 pK18mobSacB-△ as described in Example 1 GumD A schematic diagram of the structure; Figure 2 pBBR1-kan-Ptac- as described in Example 1 SPHasA A structural diagram. Detailed Implementation

[0022] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0023] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0024] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0025] Example 1 1. Construction of exogenous hyaluronic acid expression strains (1) Xanthan gum synthesizing strain Xanthomonas oryzae ( Xanthomonas campestris NRRL B-1459 was used as the starting strain, and the genome of this strain was amplified to obtain gumD The upstream and downstream homologous arm genes of (key genes in the metabolism and synthesis of xanthan gum, a microbial polysaccharide) were obtained by double enzyme digestion to obtain the linearized pK18mobSacB vector, and then the T5 DNA ligase was used to ligate... gumD The upper and lower homologous arm fragments were inserted into the multiple cloning site on the plasmid to construct the acetyltransferase. gumD The knockout plasmid pK18mobSacB-Δ gumD .

[0026] wild type gumD The sequence is shown in SEQ ID NO. 1, after knockout. Xanthomonas campestris Δ gumD Among the plants gumD The sequence is shown in SEQ ID NO. 2.

[0027] Primer sequences: upstream homologous arm primer F1(BamHI):CGCGGATCCTTGTTGTCCAAATATTCGGCA (SEQ ID NO. 4) R1:GGCTCAGGTAATGACTGATC(SEQ ID NO. 5) Downstream homologous arm primer F2: CCGGCCCGGTGTTCTTCC (SEQ ID NO. 6) R2(HindIII): CCCAAGCTTTCAGTACGCGGTCTTCTGTC (SEQ ID NO. 7) (2) The knockout plasmid pK18mobSacB-Δ gumD Transformed into DH-5α strain, transformants were obtained, resulting in the recombinant strain DH-5α / pK18mobSacB-Δ gumD (SEQ ID NO. 8).

[0028] (3) The recombinant strain DH-5α / pK18mobSacB-Δ gumD The extracted plasmid was transferred to [a specific technology / organization] via electroporation (CN201210379735.0). Xanthomonas campestris NRRL B-1459, single-exchange strain selected by Kanamycin plate screening, and knocked out by sucrose lethal plate screening. gumD The double-crossover strain was named Xanthomonas campestris Δ gumD Xanthomonas aeruginosa polysaccharide-synthesizing chassis cells that do not synthesize xanthan gum were obtained.

[0029] (4) Construct an exogenous expression vector for hyaluronic acid and obtain a codon-optimized hyaluronic acid synthase gene through DNA synthesis. spHasA (Streptococcus pyogenes) (SEQ ID NO. 3), the PBBR1-kan-Ptac linearized plasmid vector was obtained by double enzyme digestion, and seamless cloning was performed to... spHasA The gene fragment was inserted into the multiple cloning site on the plasmid to construct the exogenous expression plasmid PBBR1-kan-Ptac-spHasA for hyaluronic acid synthase.

[0030] (5) The hyaluronic acid synthase expression plasmid PBBR1-kan-Ptac-spHasA was transformed into the DH-5α strain to obtain transformants and the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA (SEQ ID NO. 9).

[0031] (6) The plasmid extracted from the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA was transferred to the constructed chassis cells via electroporation (CN201210379735.0). Xanthomonas campestris Δ gumD Transformants were obtained through kanamycin plate screening, resulting in an engineered strain capable of exogenously expressing hyaluronic acid synthase, which was named *Xanthomonas spp.* Xanthomonas campestris )HA.

[0032] 2. Application of Xanthomonas hyaluronic acid in the preparation of hyaluronic acid. (1) Activation culture of microbial strains: Xanthomonas hygroscopicus HA, stored at -80°C, was aseptically inoculated onto LB slant medium containing 100 ng / mL kanamycin and incubated at 28°C for 2 days to obtain activated strains, which were then used for the preparation of seed culture for fermentation production.

[0033] (2) Seed liquid preparation: Select 2-3 loops of Xanthomonas haplocalyx HA strain activated by slant culture, inoculate it into the fermentation seed liquid, and culture at 30°C for 16-20 h to obtain mature seed liquid.

[0034] The seed culture medium consists of the following components in mass fractions (g / 100mL): corn starch 1.0; soybean flour 0.3; calcium carbonate 0.2; kanamycin 100ng / mL; the remainder is softened water; pH 7.0~7.2.

[0035] (3) Preparation of hyaluronic acid by fermentation of Xanthomonas hyaluronic acid with HA from rapeseed. The mature seed culture of Xanthomonas haplocalyx strain HA was inoculated into sterilized fermentation broth and fermented in shake flasks at 28°C and 300 rpm for 72 h; the inoculum size was 10% ( v / v ); The volume of liquid in the shake flask is 80mL / 500mL.

[0036] The fermentation broth has the following composition by mass fraction (g / 100mL): corn starch 5.0; soybean flour 0.4; calcium carbonate 0.2; kanamycin 100ng / mL; the rest is softened water; pH 7.0~7.2.

[0037] The results of preparing hyaluronic acid using Xanthomonas hyaluronic acid fermentation are as follows: a. The yield of hyaluronic acid was 1.38 ± 0.11 g / 100g fermentation broth; b. The viscosity of the hyaluronic acid fermentation broth is 9080±120 mPa·s; c. The molecular weight of hyaluronic acid is 1.35 ± 0.14 × 10⁻⁶.6 Da, compared with commercially available hyaluronic acid products (1.33±0.15 ×10). 6 There was no significant difference in molecular weight between Da and Da.

[0038] As can be seen from the results of the above embodiments, the present invention utilizes the xanthan gum synthesizing strain Xanthomonas oryzae NRRL B-1459 to achieve the preparation of microbial polysaccharide hyaluronic acid using inexpensive raw materials such as starch and soybeans through the knockout of key genes for polysaccharide synthesis and the introduction of key genes for exogenous polysaccharide synthesis. This provides a solid technical foundation for promoting the healthy development and technological upgrading of the microbial polysaccharide industry and has good promotional value.

[0039] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An engineered bacterium that expresses hyaluronic acid exogenously, characterized in that, Its starting strain is xanthan gum synthesizing strain Xanthomonas oryzae (… Xanthomonas campestris NRRL B-1459; compared to the original strain, the engineered strain was modified to possess hyaluronic acid synthase. spHasA Expression, while suppression gumD Express.

2. The engineered bacteria expressing exogenous hyaluronic acid as described in claim 1, characterized in that, The gumD Expression suppression is achieved by homologous recombination.

3. The engineered bacteria expressing exogenous hyaluronic acid as described in claim 2, characterized in that, The engineered bacteria were constructed as follows: the starting strain was Xanthomonas campestris NRRL B-1459, and the strain was amplified... gumD The upstream and downstream homologous arm genes were extracted; and the corresponding knockout plasmid was constructed and transformed into E. coli to obtain the recombinant strain DH-5α / pK18mobSacB-ΔgumD; the plasmid was extracted from the recombinant strain DH-5α / pK18mobSacB-ΔgumD and transferred to the starting strain by electroporation transformation; and the xanthan gum-synthesizing chassis cells of Xanthomonas javanica that do not synthesize xanthan gum were screened by sucrose lethal plate. Xanthomonas campestris Δ gumD ; Hyaluronic acid synthase gene spHasA The sequence is shown in SEQ ID NO. 3; a hyaluronic acid synthase exogenous expression plasmid was constructed and transformed into Escherichia coli to obtain the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA. Plasmids were extracted from the recombinant strain DH-5α / PBBR1-kan-Ptac-spHasA and electroporated into chassis cells. Xanthomonas campestris Δ gumD In this process, the engineered bacteria expressing exogenous hyaluronic acid were obtained.

4. The engineered bacteria expressing exogenous hyaluronic acid as described in claim 3, characterized in that, wild type gumD The sequence is shown in SEQ ID NO.

1. Xanthomonas campestris Δ gumD Among the plants gumD The sequence is shown in SEQ ID NO.

2.

5. A method for the biosynthesis of hyaluronic acid based on the engineered bacteria of any one of claims 1 to 4, characterized in that, The synthesis method includes inoculating the seed liquid of the above-mentioned engineered bacteria into a fermentation medium for shake-flask fermentation. The fermentation medium comprises the following components in the following proportions: corn starch 3.0~5.0g / 100mL; soybean flour 0.3~0.5g / 100mL; calcium carbonate 0.1~0.3g / 100mL; kanamycin 100ng / mL; the remainder being softened water; pH 7.0~7.

2.

6. The method for biosynthesis of hyaluronic acid by engineered bacteria as described in claim 5, characterized in that, The fermentation conditions are: 28~32°C; 280~320r / min; inoculum size of 9~11%; liquid volume in shake flasks of 80mL / 500mL; and fermentation time of 70~75h.

7. The method for biosynthesis of hyaluronic acid by engineered bacteria as described in claim 5, characterized in that, The strain activation method is as follows: The refrigerated strain was aseptically inoculated onto an agar slant culture medium and incubated at 28-32°C for 1-2 days to obtain activated strains. The agar slant solid culture medium was LB medium containing 100 ng / mL kanamycin.

8. The method for biosynthesis of hyaluronic acid by engineered bacteria as described in claim 5, characterized in that, The method for preparing the bacterial seed culture is as follows: Select 2-3 loops of engineered bacteria that have been activated by slant culture, inoculate them into the fermentation seed liquid, and culture at 28-32°C for 16-20 hours to obtain mature seed liquid.

9. The method for biosynthesis of hyaluronic acid by engineered bacteria as described in claim 8, characterized in that, The seed solution comprises the following components in the following proportions: corn starch 0.8~1.2g / 100mL; soybean flour 0.1~0.4g / 100mL; calcium carbonate 0.1~0.3g / 100mL; kanamycin 100ng / mL; the remainder being softened water; pH 7.0~7.2.

Images