Sucrose synthase mutants with improved catalytic properties

Abstract

The application discloses a sucrose synthase mutant with improved catalytic properties, and belongs to the technical field of enzyme engineering. The mutant SuSy-M6 provided by the application has a half-life of 50 min, which is 50 times that of WT. The relative enzyme activity of the mutant SuSy-M6 at 55 DEG C is 24.4 U / mg, which is increased by 40% compared with WT. The mutant successfully overcomes the loss of enzyme activity caused by stability, realizes the simultaneous improvement of stability and enzyme activity, and meets the demand of industrial production.

Description

Technical Field

[0001] This invention relates to a sucrose synthase mutant with enhanced catalytic properties, belonging to the field of enzyme engineering technology. Background Technology

[0002] UDP-Glc is an activated monosaccharide widely found in plants, animals, and microorganisms. It serves as a glucose donor in the synthesis of sucrose, starch, glycogen, and other oligosaccharides and polysaccharides, and can also be converted into uridine diphosphate galactose and uridine diphosphate glucuronic acid. Starting with UDP-Glc, uridine diphosphate galactose (UDP-Gal) can be generated under the action of galactose epimerase, and uridine diphosphate glucuronic acid (UDP-GlcA) can be generated under the catalysis of UDP-Glc dehydrogenase. Further, under the action of UDP-xylose synthase and UDP-xylose epimerase, uridine diphosphate xylose (UDP-Xyl) and uridine diphosphate arabinose (UDP-Ara) can be generated, respectively. These nucleotide sugars are common sugar donors in organisms and play important roles in cell growth, such as participating in protein glycosylation. They also provide important sugar donors for the synthesis of oligosaccharides, such as human milk oligosaccharides and glycosaminoglycans. UDPG has also been used in the development of new drugs and new sweeteners. For example, UDPG was used as a glycosyl donor to synthesize the antibiotic BE-7585A via ORF-36-28 enzyme catalysis; and 14C-UDPG labeled with a six-carbon atom was used as the sole glycosyl donor to synthesize the main glycoside of steviol via UDP glycosyltransferase catalysis.

[0003] Nucleotide sugars such as UDP-Glc are difficult to obtain from nature and are relatively expensive. Therefore, chemical and enzymatic methods have become common means of artificially preparing UDP-sugars. Chemical synthesis of UDP-Glc typically requires stringent conditions (such as low temperatures) and long reaction times, generally exceeding 12 hours. Enzymatic synthesis, on the other hand, demonstrates its potential for industrial application due to its milder and greener reaction conditions.

[0004] Sucrose synthase (SuSy, EC 2.4.1.13) is a glycosyltransferase (GT) widely found in plants. This enzyme catalyzes the reversible transfer of glucose residues between fructose and uridine diphosphate (UDP) (sucrose + UDP = UDP-glucose + fructose). It is primarily involved in sucrose synthesis in microorganisms and plants and is closely related to plant photosynthesis. UDP-Glc exhibits a complex de novo synthetic pathway in organisms, with Glc being catalyzed sequentially by hexokinase, phosphoglucose mutase, and UDP-glucose pyrophosphorylase to yield UDP-Glc. The discovery of sucrose synthase has made the one-step synthesis of UDP-Glc more attractive and has garnered widespread attention. However, sucrose synthase is thermostable, typically requiring a reaction time of 10-12 hours at mesophilic temperatures (30-45℃), which significantly increases the risk of contamination. Therefore, improving the thermostability of sucrose synthase to achieve a reaction at higher temperatures can not only shorten the reaction time and accelerate UDP-Glc synthesis but also reduce the likelihood of contamination. Furthermore, in enzyme engineering research, improved thermostability often leads to a loss of enzyme activity; this is a common trade-off between stability and activity inherent in enzyme molecules. Therefore, developing sucrose synthases that simultaneously improve thermostability and enzyme activity will facilitate the economical and low-cost production of UDP-Glc, thereby reducing the price of nucleotide sugars and providing inexpensive and readily available substrate raw materials for the synthesis of active sugars. Summary of the Invention

[0005] [Technical Problem] The technical problem to be solved by this invention is the poor thermal stability and low sucrose synthase activity.

[0006] [Technical Solution] This invention provides a sucrose synthase mutant with improved thermostability and enzyme activity, wherein the amino acid sequence of the sucrose synthase mutant is different from that of SEQ ID NO. 1 at positions 79, 148, 162, 240, 612 and 769, and is named SuSy-M6.

[0007] In one embodiment of the present invention, relative to SEQ ID NO. 1, the amino acid sequence of the sucrose synthase mutant is mutated from alanine to phenylalanine at position 79, from valine to serine at position 148, from glutamine to tryptophan at position 162, from serine to tyrosine at position 240, from glycine to proline at position 612, and from lysine to histidine at position 769.

[0008] The present invention also provides a gene encoding the mutant.

[0009] The present invention also provides an expression vector carrying the gene.

[0010] In one embodiment of the present invention, the expression vector includes a pET vector.

[0011] The present invention also provides an engineered Escherichia coli strain expressing the mutant.

[0012] In one embodiment of the present invention, Escherichia coli BL21 was used as the host cell and pET 28a(+) was used as the expression vector.

[0013] The present invention also provides a method for preparing the sucrose synthase mutant, comprising the following steps: (1) The gene is ligated into an expression vector to obtain a recombinant expression vector. (2) The recombinant expression vector was transferred into the host, and the host was cultured to express the sucrose synthase mutant. (3) The sucrose synthase mutant was isolated and purified from the host culture medium.

[0014] The present invention also provides a method for preparing UDP-Glc, using the mutant as a catalyst and UDP and sucrose as substrates for the reaction.

[0015] In one embodiment of the present invention, the reaction is carried out at 50-55°C for at least 2 hours.

[0016] The present invention also provides the application of the mutant, the gene, the expression vector, or the engineered Escherichia coli in the preparation of UDP-Glc.

[0017] [Beneficial Effects] This invention modifies sucrose synthase using genetic engineering techniques. Through single-point mutation and combinatorial mutation, transformants with enhanced enzyme activity are obtained, enabling efficient synthesis of UDP-Glc at optimal temperatures, thus meeting the needs of industrial production.

[0018] The half-life of SuSy-M6 is 50 min, which is 50 times that of WT. Relative enzyme activity assays showed that the relative enzyme activity of the mutant SuSy-M6 at 55℃ was 40% higher than that of WT, with a specific activity of 24.4 U / mg. The mutant successfully overcame the loss of enzyme activity caused by instability, achieving a simultaneous increase in both stability and enzyme activity. Attached Figure Description

[0019] Figure 1 Thermal stability curves of the mutant; Figure 2 Progress curve of mutant-catalyzed production of UDP-Glc. Detailed Implementation

[0020] The LB medium used in the following examples consists of: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride (NaCl), pH 7.4; LB liquid medium with 2% agar added is LB solid medium. The PB buffer used in the following examples: 2.299g Na2HPO4, 0.455g NaH2PO4, adjusted to 1L.

[0021] Solution A (equilibrium solution) used in the following examples: 0.3404 g / L imidazole (5 mM) and 29.22 g / L NaCl (0.5 M) were added to the above PB solution to adjust the pH to 7.4.

[0022] The following examples use solution B (elution buffer): 34.075 g / L imidazole (500 mM) and 29.22 g / L NaCl (0.5 M) were added to the above PB solution to adjust the pH to 7.4.

[0023] The enzyme activity assay method used in the following examples was as follows: The enzyme was incubated at 50°C for 1 min in 50 mmol / L PB buffer (pH 6.5) containing 100 μL of sucrose, 10 mmol / L UDP, and a total volume of 100 μL.

[0024] Enzyme activity is defined as the amount of enzyme required to convert 1 μmol of UDP-Glc within 1 min, which is 1 unit of enzyme activity (U).

[0025] Enzyme activity calculation: Enzyme activity (U / mg) = Enzyme activity (U) / Protein content (mg) Enzyme thermal stability assay: The activity of the pure enzyme was measured at 55 °C, with the enzyme activity at 0 min taken as the highest value of 100%. The pure enzyme was then stored at this temperature, and the remaining enzyme activity was measured at intervals to investigate the thermal stability of the enzyme.

[0026] The determination method of the product in the following examples: The determination of UDP-Glc used a C18 column, a mobile phase of 40% tetrabutylammonium bromide, a flow rate of 1.51 ml / min, and an ultraviolet detector.

[0027] Example 1: Construction of sucrose synthase NmSusy and its mutants (1) Construction of recombinant plasmids containing genes encoding sucrose synthase choose Nitrosospira europaea The sucrose synthase from this source is wild-type, and the amino acid sequence of the enzyme is shown in SEQ ID NO. 1, while the nucleotide sequence encoding the sucrose synthase is shown in SEQ ID NO. 2.

[0028] The nucleotide sequence SEQ ID NO. 2 was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence was selected from pET28a. Eco RI and Sac I was used as the insertion site for the target gene, and the target gene was amplified using the upstream primer: ATGAATTCATGGCTAGCCTTCATAAATTT, and the downstream primer: ACGAGCTCTCACTGAGGA AGAGCCTGAGCCATA, thus giving the target gene an enzyme restriction site. pET28a was double-digested and purified to obtain a linear plasmid fragment. The target gene with the restriction site was ligated to the linear plasmid fragment via homologous recombination. The system used for homologous recombination contained: 1 μL of the restriction linear plasmid, 1 μL of the target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of H2O. Homologous recombination was performed at 37°C for 30 min. The ligation product was then stored at -20°C.

[0029] Transform the linker product into Escherichia coli DE3 (BL21) competent cells were cultured at 37℃ for 1 hour, and then the bacterial culture was spread on LB solid medium plates containing kanamycin resistance. After overnight culture, single colonies were picked, scaled up, and plasmids were extracted. Colony PCR was performed using universal primers. Plasmids with positive PCR results were sequenced for verification, and the correct sucrose synthase gene recombinant plasmid WT-SuSy-pET28a was finally obtained.

[0030] (2) Construction of recombinant plasmids of sucrose synthase mutants Using the WT-SuSy-pET28a plasmid as a template, full-plasmid PCR was performed using the primers listed in Table 1, sequentially introducing the six mutation sites. The recombinant plasmid SuSy-M6-pET28a was then... Dpn After approximately 2 hours of digestion, E. coli is introduced using the heat shock method. E. coli Single colonies were selected from BL21 (DE3) competent cells and cultured overnight in LB medium at 37°C and 200 rpm. Plasmids were extracted from the single colony cultures and sent to a sequencing company for sequencing. The mutant with the correct sequencing result was the successfully mutated SuSy-M6.

[0031] Table 1 Primers for mutant construction

[0032] (3) Induction and purification of the target protein The correctly sequenced single-clone strain was activated by shaking in LB medium for 12 h, then inoculated into fresh LB medium and cultured at 37°C and 200 rpm until the OD reached 0.8. IPTG inducer was added to a final concentration of 1 mM, and the culture was continued at 16°C and 200 rpm for 20 h. After culture, the precipitate was collected by centrifugation, and the supernatant was obtained after cell disruption by centrifugation to obtain crude enzyme solution. The wild-type crude enzyme solution had an activity of 2.2 U / mL, and the mutant SuSy-M6 crude enzyme solution had an activity of 2.4 U / mL. Pure enzyme was obtained using a nickel column purification method.

[0033] The method for nickel column purification is as follows: First, equilibrate the nickel column with equilibration solution A, then increase the flow rate by 1 mL / min. -1 The sample was injected at a flow rate of [flow rate missing]. After injection, the column was washed again with solution A for 10 min. Then, the mixing ratio of solution B and solution A was adjusted to achieve an imidazole concentration of 100 mM in the eluent. Impurities were then eluted with the eluent. The imidazole concentration in the eluent was then adjusted to 200 mM, and the target protein was eluted and collected. The collected eluent containing the target protein (sucrase synthase mutant) was desalted and concentrated using an ultrafiltration tube. The concentrate was stored at 4°C for subsequent experiments.

[0034] Example 2: Properties of the mutant SuSy-M6 The stability of the mutant pure enzyme at 55℃ was determined, and the results are as follows: Figure 1 As shown in the figure, the fitting analysis results indicate that the half-life of SuSy-M6 is 50 min, which is 50 times that of WT, while the half-life of wild-type WT is approximately 1 min. Relative enzyme activity assays show that the relative enzyme activity of the mutant SuSy-M6 at 55℃ is 40% higher than that of WT, with a specific enzyme activity of 24.4 U / mg, compared to 17.4 U / mg for the original sucrose synthase as a control. The mutant successfully overcame the loss of enzyme activity due to instability, achieving a simultaneous increase in both stability and enzyme activity.

[0035] Example 3: Synthesis of UDP-Glc using the sucrose synthase mutant SuSy-M6 200 mM UDP and 1.5 M sucrose were added to 10 mL of phosphate buffer (pH 6.5), followed by 0.2 g / L wild-type sucrose synthase and the mutant SuSy-M6. The reaction was carried out at 55°C for 2 h. 10 μL samples were taken at different time points during the reaction, and the contents of UDP-Glc, UDP, and UMP were determined. The amount of UDP-Glc synthesized during the reaction is shown in the figure. Figure 2As shown, the reaction reached equilibrium within 2 hours, with a UDP-Glc yield of 165 mM, a space-time yield of 47 g / L / h, and a UDP conversion rate of 83%, achieving rapid and efficient synthesis of UDP-Glc at relatively high temperatures.

[0036] Comparative Example 1: The specific implementation method is as described in Examples 2 and 3, except that the mutant Q162W-G612P-A79F-S240Y was used to replace the mutant SuSy-M6. The results showed that the specific enzyme activity of the mutant Q162W-G612P-A79F-S240Y was 15.7 U / mg, the half-life was 28 min, which was 28 times that of WT, and the UDP-Glc yield reached 131 mM after 2 h, which was only 79% of the yield in Example 3.

[0037] Comparative Example 2: The specific implementation method is as described in Examples 2 and 3, except that the mutant SuSy-M6 is replaced with the mutant S240Y, which has a specific enzyme activity of 7.5 U / mg and a half-life of 5 min. The catalytic results show that the yield of UDP-Glc is only 15 mM after 2 h, which is only 9% of the yield in Example 3.

[0038] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A sucrose synthase mutant, characterized in that, The amino acid sequence of sucrose synthase, as shown in SEQ ID NO.1, is modified by mutating the following positions: position 79 from alanine to phenylalanine, position 148 from valine to serine, position 162 from glutamine to tryptophan, position 240 from serine to tyrosine, position 612 from glycine to proline, and position 769 from lysine to histidine.

2. The gene encoding the mutant of claim 1.

3. An expression vector carrying the gene of claim 2.

4. The expression vector as described in claim 3, characterized in that, It is a pET carrier.

5. An engineered Escherichia coli strain expressing the mutant described in claim 1.

6. The engineered Escherichia coli strain as described in claim 5, characterized in that, by Escherichia coli BL21 was used as the host cell and pET 28a(+) was used as the expression vector.

7. A method for preparing the sucrose synthase mutant of claim 1, characterized in that, Includes the following steps: (1) The gene described in claim 2 is ligated into an expression vector to obtain a recombinant expression vector. (2) The recombinant expression vector was transferred into the host, and the host was cultured to express the sucrose synthase mutant. (3) The sucrose synthase mutant was isolated and purified from the host culture medium.

8. A method for preparing uridine diphosphate-glucose, characterized in that, The reaction was carried out using the mutant described in claim 1 as a catalyst and uridine diphosphate and sucrose as substrates.

9. The method as described in claim 8, characterized in that, The reaction should be carried out at 50-55℃ and pH 6.0-6.5 for at least 2 hours.

10. The use of the mutant of claim 1, or the gene of claim 2, or the expression vector of claim 3 or 4, or the engineered Escherichia coli of claim 5 or 6 in the preparation of uridine diphosphate-glucose.

Images