Glycosyltransferase ppugt4 for rhizoma paridis saponin biosynthesis

CN116790543BActive Publication Date: 2026-08-07KUNMING INST OF BOTANY CHINESE ACAD OF SCI
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
KUNMING INST OF BOTANY CHINESE ACAD OF SCI
Filing Date
2022-03-15
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

中国专利申请202110109409.7公开了薯蓣皂苷元/偏诺皂苷元-3-O-β-D-葡萄糖基转移酶PpUGT73E5及其在重楼皂苷合成中的应用,该酶属于UGT73家族,对底物薯蓣皂苷元和偏诺皂苷元的Km值分别为53.69±9.37和73.43±8.16μM,表明其对底物的亲和力不高

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116790543B_ABST
    Figure CN116790543B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of natural product biosynthesis, and particularly relates to a glycosyltransferase for Paris saponin biosynthesis, a coding gene thereof and application. The glycosyltransferase PpUGT4 of the application provides an efficient biosynthesis method for Paris saponin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of natural product biosynthesis technology, specifically relating to glycosyltransferases for the biosynthesis of Paris polyphylla saponins, their encoding genes, and their applications. Background Technology

[0002] Paris polyphylla is a general term for plants in the genus Paris of the family Melanthiaceae. There are 27 species worldwide, 21 of which are found in my country, 18 of which are endemic to my country, with the most concentrated distribution in the Yunnan-Guizhou Plateau and Sichuan region. Paris polyphylla has significant medicinal value and a long history of use in my country. The dried rhizomes of *P. polyphylla Smith* var. *yunnanensis* (Franch.) Hand.-Mazz. and *P. polyphylla Smith* var. *chinensis* (Franch.) Hara are listed in the *Pharmacopoeia of the People's Republic of China*, possessing functions of clearing heat and detoxifying, reducing swelling and relieving pain, cooling the liver and calming convulsions. They are mainly used to treat boils, carbuncles, sore throat, snake and insect bites, traumatic injuries, and infantile convulsions. Modern pharmacological studies have shown that Paris polyphylla has hemostatic, antitumor, antibacterial, analgesic, and anti-early pregnancy activities.

[0003] Paris saponins are the main active components of Paris polyphylla. The total content of saponins I, II, and VII is the standard for quality evaluation of Paris polyphylla as stipulated in the Chinese Pharmacopoeia. Paris saponins possess a wide range of pharmacological activities, including hemostasis, uterine contraction, antitumor, antibacterial, anti-ischemic, and immunomodulatory effects. However, the complex structure of Paris saponins makes chemical synthesis difficult, and direct isolation and purification from Paris polyphylla is challenging. Furthermore, the scarcity of Paris polyphylla resources severely restricts the development and application of this type of natural product.

[0004] Glycosylation modification is a key step in the biosynthesis of Paris polyphylla saponins, which depends on glycosyltransferase catalysis and has a significant impact on the bioactivity, bioavailability, and water solubility of Paris polyphylla saponins. Chinese patent application 202110109409.7 discloses the diosgenin / pinospinin-3-O-β-D-glucosyltransferase PpUGT73E5 and its application in the synthesis of Paris polyphylla saponins. This enzyme belongs to the UGT73 family, and its Km values ​​for the substrates diosgenin and pinospinin are 53.69±9.37 and 73.43±8.16 μM, respectively, indicating that it has low affinity for the substrates. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a glycosyltransferase for the biosynthesis of Paris polyphylla saponins, its encoding gene and application, wherein the glycosyltransferase for the biosynthesis of Paris polyphylla saponins of the present invention has high affinity for the substrate.

[0006] This invention provides glycosyltransferases for the biosynthesis of Paris polyphylla saponins, including one or more of the glycosyltransferases in 1) to 6):

[0007] 1) The amino acid sequence is PpUGT1 as shown in SEQ ID NO.1;

[0008] 2) The amino acid sequence is PpUGT2 as shown in SEQ ID NO.2;

[0009] 3) The amino acid sequence is PpUGT3 as shown in SEQ ID NO.3;

[0010] 4) The amino acid sequence is PpUGT4 as shown in SEQ ID NO.4;

[0011] 5) The amino acid sequence is PpUGT5 as shown in SEQ ID NO.5;

[0012] 6) Derivative proteins with the same function but with the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 substituted and / or deleted and / or added one or more amino acid residues.

[0013] The present invention also provides the encoding gene of the glycosyltransferase described in the above scheme, including one or more of the encoding genes in 1) to 6):

[0014] 1) The gene encoding PpUGT1 with a nucleotide sequence as shown in SEQ ID NO.6;

[0015] 2) The gene encoding PpUGT2 with a nucleotide sequence as shown in SEQ ID NO.7;

[0016] 3) The gene encoding PpUGT3 with a nucleotide sequence as shown in SEQ ID NO.8;

[0017] 4) The gene encoding PpUGT4 with a nucleotide sequence as shown in SEQ ID NO.9;

[0018] 5) The gene encoding PpUGT5 with a nucleotide sequence as shown in SEQ ID NO.10;

[0019] 6) Nucleotide sequences that express the same functional protein by substituting and / or deleting and / or adding one or more nucleotides to the nucleotide sequences shown in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0020] The present invention also provides recombinant vectors, expression cassettes, or recombinant bacteria containing the coding genes described in the above scheme.

[0021] The present invention also provides the application of the glycosyltransferase described in the above-described scheme, or the encoding gene, or the recombinant vector, expression cassette, or recombinant bacteria in the preparation of transgenic plants containing glycosyltransferase.

[0022] The present invention also provides the application of the glycosyltransferase described in the above scheme, or the encoding gene, or the recombinant vector, expression cassette, or recombinant bacteria in the synthesis of Paris polyphylla saponins.

[0023] Preferably, the Paris saponins include one or more of the following: diosgenin, pennosapogenin-3-O-β-D-glucopyranoside, Paris saponin V, Paris saponin VI, diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside, and trikamsteroside B, as shown in Formulas I to VI.

[0024]

[0025] Preferably, when the glycosyltransferase is PpUGT1 and / or PpUGT2, the Paris polyphylla saponin is desorcinol and phenospermin-3-O-β-D-glucopyranoside.

[0026] Preferably, when the glycosyltransferase is PpUGT3, the Paris saponin is Paris saponin V and / or Paris saponin VI.

[0027] Preferably, when the glycosyltransferase is PpUGT4 and / or PpUGT5, the Paris polyphylla saponin is diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and / or trikamsteroside B.

[0028] Preferably, PpUGT1 and PpUGT2 are used as substrates to synthesize diosgenin; PpUGT1 and PpUGT2 are used as substrates to synthesize pennosapogenin-3-O-β-D-glucopyranoside.

[0029] The PpUGT3 was used as a substrate to synthesize Paris polyphylla saponin V; the PpUGT3 was used as a substrate to synthesize Paris polyphylla saponin VI.

[0030] PpUGT4 and PpUGT5 respectively synthesize diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside using Paris saponin V as a substrate; PpUGT4 and PpUGT5 respectively synthesize trikamsteroside B using Paris saponin VI as a substrate.

[0031] This invention provides glycosyltransferases for the biosynthesis of Paris polyphylla saponins, comprising one or more of the glycosyltransferases in 1) to 6): 1) PpUGT1 with the amino acid sequence shown in SEQ ID NO.1; 2) PpUGT2 with the amino acid sequence shown in SEQ ID NO.2; 3) PpUGT3 with the amino acid sequence shown in SEQ ID NO.3; 4) PpUGT4 with the amino acid sequence shown in SEQ ID NO.4; 5) PpUGT5 with the amino acid sequence shown in SEQ ID NO.5; 6) derivative proteins with the same function but substituted and / or deleted and / or added amino acid residues of the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5. The glycosyltransferases PpUGT1 and PpUGT2 of the present invention synthesize diosgenin using diosgenin as a substrate; PpUGT1 and PpUGT2 synthesize penosgenin-3-O-β-D-glucopyranoside using penosgenin as a substrate; PpUGT3 synthesizes Paris polyphylla saponin V using diosgenin as a substrate; PpUGT3 synthesizes Paris polyphylla saponin VI using penosgenin-3-O-β-D-glucopyranoside as a substrate; PpUGT4 and PpUGT5 synthesize diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranoside-(1-6)]-β-D-glucopyranoside using Paris polyphylla saponin V as a substrate; and PpUGT4 and PpUGT5 synthesize trikamsteroside B using Paris polyphylla saponin VI as a substrate. The glycosyltransferases of this invention exhibit good affinity for their substrates. PpUGT1 and PpUGT2 show Km values ​​of 20.1 and 16.1 μM, respectively, when using diosgenin as a substrate; while PpUGT4 and PpUGT5 show Km values ​​of 32.5 and 22.1 μM, respectively, when using Paris polyphylla VI as a substrate. These glycosyltransferases provide an efficient biosynthetic method for Paris polyphylla saponins and lay the foundation for the artificial synthesis of Paris polyphylla saponins and the construction of novel Paris polyphylla saponin derivatives. Attached Figure Description

[0032] Figure 1PCR agarose gel electrophoresis images of the glycosyltransferases PpUGT1 and PpUGT2 for the synthesis of diosgenin and phenosyl-3-O-β-D-glucopyranoside, PpUGT3 for the synthesis of Paris polyphylla saponin V and Paris polyphylla saponin VI, and PpUGT4 and PpUGT5 for the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B, where lane M is the DL2000 DNA marker, and lanes 1, 2, 3, 4 and 5 are the target bands (1668, 1773, 1455, 1398, 1404 bp).

[0033] Figure 2 This is a schematic diagram of the E. coli expression plasmid structure for expressing the glycosyltransferase PpUGT1 of synthetic desmoside and phenospermin-3-O-β-D-glucopyranoside in Example 2.

[0034] Figure 3 This is a schematic diagram of the E. coli expression plasmid structure for expressing the glycosyltransferase PpUGT2 of synthetic desorcinol and phenorinosapogenin-3-O-β-D-glucopyranoside in Example 2.

[0035] Figure 4 This is a schematic diagram of the E. coli expression plasmid structure for expressing the glycosyltransferase PpUGT3 of Paris polyphylla saponin V and Paris polyphylla saponin VI in Example 2;

[0036] Figure 5 This is a schematic diagram of the E. coli expression plasmid structure for expressing the glycosyltransferase PpUGT4 of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranose and trikamsteroside B in Example 2.

[0037] Figure 6 This is a schematic diagram of the E. coli expression plasmid structure for expressing the glycosyltransferase PpUGT5 of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranose and trikamsteroside B in Example 2.

[0038] Figure 7The images show the HPLC chromatograms of the enzyme-catalyzed reaction products in Example 4. A represents the HPLC chromatograms of the enzyme-active products of PpUGT1 and PpUGT2, using diosgenin (1) and pennosapogenin (2) as substrates and UDP-glucose as the sugar donor, respectively. B represents the catalytic reaction of PpUGT1 and PpUGT2. C represents the HPLC chromatograms of the enzyme-active products of PpUGT3, using desmosiderin (3) and pennosapogenin-3-O-β-D-glucopyranoside (4) as substrates and UDP-rhamnose as the sugar donor, respectively. D represents the catalytic reaction of PpUGT3. E represents the HPLC chromatograms of the enzyme-active products of PpUGT4 and PpUGT5, using Paris polyphylla saponin V (5) and Paris polyphylla saponin VI (6) as substrates and UDP-glucose as the sugar donor, respectively. F represents the catalytic reaction of PpUGT4 and PpUGT5.

[0039] Figure 8 A is the function obtained from the Lineweaver–Burk plot in Example 5 for calculating the Km value; B and C are the functions obtained from the Lineweaver–Burk plot when PpUGT1 and PpUGT2 use diosgenin as the substrate, respectively; C and D are the functions obtained from the Lineweaver–Burk plot when PpUGT4 and PpUGT5 use Paris polyphylla VI as the substrate, respectively. Detailed Implementation

[0040] This invention provides glycosyltransferases for the biosynthesis of Paris polyphylla saponins, comprising one or more of the glycosyltransferases in 1) to 6):

[0041] 1) The amino acid sequence is PpUGT1 as shown in SEQ ID NO.1;

[0042] 2) The amino acid sequence is PpUGT2 as shown in SEQ ID NO.2;

[0043] 3) The amino acid sequence is PpUGT3 as shown in SEQ ID NO.3;

[0044] 4) The amino acid sequence is PpUGT4 as shown in SEQ ID NO.4;

[0045] 5) The amino acid sequence is PpUGT5 as shown in SEQ ID NO.5;

[0046] 6) Derivative proteins with the same function but with the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 substituted and / or deleted and / or added one or more amino acid residues.

[0047] In this invention, PpUGT1 to PpUGT5 are composed of 555, 590, 484, 465, and 467 amino acids, respectively, with predicted molecular weights of 61.5, 64.8, 52.1, 52.7, and 52.5 kDa. PpUGT1 to PpUGT5 were analyzed and compared using BLASTX in NCBI. The results showed that PpUGT1 is similar to the sterol 3-β-glucose transferase UGT80A2-like isoform of jujube (Phoenix dactylifera) at the amino acid level. The homology of X1 (XP_038974355.1) was 84.44%. The amino acid sequence of PpUGT2 showed 82.9% homology with XP_038974355.1. The amino acid sequence of PpUGT3 showed 73.05% homology with the hyoscyamine glucotransferase of *Phoenix dactylifera* (XM_039127341.1). PpUGT4 and PpUGT5 showed 53.8% and 54.11% homology, respectively, with the UDP-glucose transferase 91C1-like isoform X3 (XP_009408288.1) of *Musa acuminata* subsp. *malaccensis* at the amino acid level. Furthermore, through Target... The P software predicts that PpUGT1, PpUGT3, PpUGT4, and PpUGT5 are proteins without transport peptides, while PpUGT2 is a protein containing a 38-amino acid transport peptide.

[0048] The glycosyltransferases PpUGT1 and PpUGT2 provided by this invention can efficiently catalyze the synthesis of diosgenin and phenosgenin-3-O-β-D-glucopyranoside from diosgenin and phenosgenin, respectively; PpUGT3 can efficiently catalyze the synthesis of Paris polyphylla saponins V and VI from diosgenin and phenosgenin-3-O-β-D-glucopyranoside, respectively; and glycosyltransferases PpUGT4 and PpUGT5 can efficiently catalyze the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B from Paris polyphylla saponins V and VI, respectively. Diosgenin and pimonosapogenin-3-O-β-D-glucopyranoside are key intermediate compounds in the biosynthesis pathway of Paris polyphylla saponins; Paris polyphylla saponin V and Paris polyphylla saponin VI are important Paris polyphylla saponins and also key intermediate compounds in the biosynthesis of Paris polyphylla saponins I, II, III or VII and H; diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B are trace components of Paris polyphylla plants. This invention provides an efficient biosynthetic method for diosgenin, phenobarbitin-3-O-β-D-glucopyranoside, Paris saponin V, Paris saponin VI, diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside, and trikamsteroside B, and lays the foundation for the artificial synthesis of Paris saponins and the construction of new Paris saponin derivatives.

[0049] The present invention also provides the encoding gene of the glycosyltransferase described in the above scheme, including one or more of the encoding genes in 1) to 6):

[0050] 1) The gene encoding PpUGT1 with a nucleotide sequence as shown in SEQ ID NO.6;

[0051] 2) The gene encoding PpUGT2 with a nucleotide sequence as shown in SEQ ID NO.7;

[0052] 3) The gene encoding PpUGT3 with a nucleotide sequence as shown in SEQ ID NO.8;

[0053] 4) The gene encoding PpUGT4 with a nucleotide sequence as shown in SEQ ID NO.9;

[0054] 5) The gene encoding PpUGT5 with a nucleotide sequence as shown in SEQ ID NO.10;

[0055] 6) Nucleotide sequences that are substituted and / or deleted and / or added with one or more nucleotides according to the nucleotide sequences shown in SEQ ID NO.6, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 and express the same functional protein.

[0056] In this invention, the open reading frames of the genes encoded by SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10 are 1668, 1773, 1455, 1398, and 1404 bp, respectively. The discovery of the genes encoding PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 enriches the diversity of glycosyltransferase-encoding genes.

[0057] The present invention does not have any particular limitation on the method for obtaining the cDNA sequences of the coding genes of PpUGT1, PpUGT2, PpUGT3, PpUGT4 and PpUGT5; conventional cDNA acquisition methods in the art can be used.

[0058] This invention starts with the plant *Pairs polyphylla* Smith var. *yunnanensis* (Franch.) Hand.-Mazz., belonging to the family Pairsaceae, and clones and functionally identifies the encoding genes of five glycosyltransferases PpUGT1–PpUGT5 in the biosynthetic pathway of saponins from *Pairs polyphylla*.

[0059] The present invention also provides recombinant vectors, expression cassettes, or recombinant bacteria containing the coding genes described in the above scheme.

[0060] The present invention does not specifically limit the base carrier of the recombinant vector, but in the embodiments of the present invention, the base carrier of the recombinant vector is preferably pCold TF.

[0061] In this invention, the original strain of the recombinant bacteria is preferably *Escherichia coli*, *Saccharomyces cerevisiae*, or *Agrobacterium*. This invention does not specifically limit the species of *E. coli*, *Saccharomyces cerevisiae*, or *Agrobacterium*; in this invention, the *E. coli* strain is preferably Rosetta (DE3) or *E. coli* BL21 (DE3). This invention does not specifically limit the method for constructing the recombinant vector and the transformation method; conventional methods in the art can be used. In the specific implementation of this invention, the coding gene is ligated to a prokaryotic expression vector to construct a recombinant plasmid capable of expression in *E. coli*, and then the recombinant plasmid is transformed into *E. coli* to construct the recombinant bacteria.

[0062] In this invention, when the recombinant bacteria is recombinant Escherichia coli or recombinant Saccharomyces cerevisiae, the recombinant Escherichia coli or recombinant Saccharomyces cerevisiae is fermented to obtain a fermentation broth containing recombinant bacteria containing glycosyltransferase.

[0063] The present invention also provides the application of the glycosyltransferase described in the above-described scheme, or the encoding gene, or the recombinant vector, expression cassette, or recombinant bacteria in the preparation of transgenic plants containing glycosyltransferase.

[0064] In this invention, the genetically modified plant preferably includes genetically modified tobacco.

[0065] In this invention, when the recombinant bacteria is recombinant Agrobacterium, the recombinant Agrobacterium is transfected into Tobacco Benzoenta for transient expression to obtain fresh tobacco leaves containing glycosyltransferase.

[0066] The present invention also provides the application of the glycosyltransferase described in the above scheme, or the encoding gene, or the recombinant vector, expression cassette, or recombinant bacteria in the synthesis of Paris polyphylla saponins.

[0067] In this invention, the Paris saponins include one or more of the following chemical structures: diosgenin, phenosperminin-3-O-β-D-glucopyranoside, Paris saponin V, Paris saponin VI, diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside, and trikamsteroside B.

[0068]

[0069] In this invention, when the glycosyltransferase is PpUGT1 and / or PpUGT2, the Paris polyphylla saponin is desorcinol and / or phenobarbitone-3-O-β-D-glucopyranoside.

[0070] In this invention, when the glycosyltransferase is PpUGT3, the Paris saponin is Paris saponin V and / or Paris saponin VI.

[0071] In this invention, when the glycosyltransferase is PpUGT4 and / or PpUGT5, the Paris saponin is diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and / or trikamsteroside B.

[0072] In this invention, PpUGT1 and PpUGT2 independently synthesize diosgenin and pennosapogenin-3-O-β-D-glucopyranoside using diosgenin and pennosapogenin as substrates, respectively; PpUGT3 synthesizes Paris polyphylla saponin V and Paris polyphylla saponin VI using diosgenin and pennosapogenin-3-O-β-D-glucopyranoside as substrates, respectively; and PpUGT4 and PpUGT5 independently synthesize diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B using Paris polyphylla saponin V and Paris polyphylla saponin VI as substrates, respectively.

[0073] In this invention, the glycosyltransferases PpUGT1 and PpUGT2, and their encoding genes, for the synthesis of diosgenin and pennosapogenin-3-O-β-D-glucopyranoside catalyze the synthesis of diosgenin and pennosapogenin-3-O-β-D-glucopyranoside from diosgenin and pennosapogenin. The glycosyltransferase PpUGT3, and its encoding gene, for the synthesis of trikamsteroside V and Paris polyphylla saponin VI, catalyze the synthesis of Paris polyphylla saponin V and Paris polyphylla saponin VI from diosgenin and pennosapogenin-3-O-β-D-glucopyranoside, respectively. The synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside... The glycosyltransferases PpUGT4 and PpUGT5 of B and their encoding genes catalyze the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B from Paris saponin V and Paris saponin VI, respectively.

[0074] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0075] Unless otherwise specified, the following embodiments are all conventional methods.

[0076] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0077] Example 1

[0078] Acquisition and bioinformatics analysis of cDNA sequences encoding the genes for the synthesis of diosgenin and diosgenin-3-O-β-D-glucopyranoside (PpUGT1 and PpUGT2), the synthesis of Paris polyphylla saponin V and Paris polyphylla saponin VI (PpUGT3), and the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B:

[0079] RNA was obtained from Paris polyphylla according to the Molecular Cloning Handbook and analyzed using SMART. TM In the RACE cDNA Amplification Kit, 5'-CDS primer and SMART II™ A oligonucleotide were used for reverse transcription to synthesize cDNA, which was then amplified by PCR using gene-specific primers to obtain the full-length cDNA sequences encoding the genes PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5.

[0080] PpUGT1 F atgcctgaagaggtgaata SEQ ID NO.11 PpUGT1 R tcacgaacaaccaaagcatctccgt SEQ ID NO.12 PpUGT2 F atggcggagagcggcagtggag SEQ ID NO.13 PpUGT2 R tcaggagcagcccatgtacttc SEQ ID NO.14 PpUGT3 F atgggctccgacgatcgtcaacctc SEQ ID NO.15 PpUGT3 R tcagtctttcgattcctttctggat SEQ ID NO.16 PpUGT4 F atgggagaagacaatggaagccttcatgt SEQ ID NO.17 PpUGT4 R ttacattttcaaaggctgaggtttctgc SEQ ID NO.18 PpUGT5 F atggaagaaggcaatgaaagccttc SEQ ID NO.19 PpUGT5 R ttacagcttcagaggttgtggcgtc SEQ ID NO.20

[0081] Analysis revealed that the open reading frames (ORFs) encoding the genes PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 are 1668 bp (SEQ ID NO.6), 1773 bp (SEQ ID NO.7), 1455 bp (SEQ ID NO.8), 1398 bp (SEQ ID NO.9), and 1404 bp (SEQ ID NO.10), respectively, encoding 555 amino acids (SEQ ID NO.1), 590 amino acids (SEQ ID NO.2), 484 amino acids (SEQ ID NO.3), 465 amino acids (SEQ ID NO.4), and 467 amino acids (SEQ ID NO.5), respectively, with predicted molecular weights of 61.5, 64.8, 52.1, 52.7, and 52.5 kDa, respectively. PpUGT3, PpUGT4, and PpUGT5 contain a 44-amino acid plant secondary product glycosyltransferases (PSPG) box, while the PSPG boxes of PpUGT1 and PpUGT2 contain 16 amino acids. Homology searches of the encoding genes of PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 were performed using BLASTX in NCBI. The amino acid sequences of PpUGT1 and PpUGT2 are similar to the sterol 3-β-glucosyltransferase UGT80A2-like isoform of the date palm (Phoenix dactylifera). X1 (XP_038974355.1) showed 84.44% and 82.9% homology, respectively. The amino acid sequence of PpUGT3 showed 73.05% homology with the dinoflagellate glucosyltransferase / XM_039127341.1. The sequences of PpUGT4 and PpUGT5 showed 53.8% and 54.11% homology, respectively, with the UDP-glucosyltransferase 91C1-like isoform X3 (XP_009408288.1) of Musa acuminata subsp. malaccensis. Furthermore, Target P software predicted that PpUGT1, PpUGT3, PpUGT4, and PpUGT5 are proteins without transport peptides, while PpUGT2 is a protein containing a 38-amino acid transport peptide.

[0082] Example 2

[0083] Glycosyltransferases PpUGT1 and PpUGT2 for the synthesis of diosgenin and pennosapogenin-3-O-β-D-glucopyranoside, glycosyltransferase PpUGT3 for the synthesis of Paris polyphylla saponin V and Paris polyphylla saponin VI, and glycosyltransferases PpUGT4 and PpUGT5 for the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B were constructed into expression vectors.

[0084] Using the PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 gene cDNAs synthesized in Example 1 as templates, the cDNAs were: PpUGT1F: 5'-aaggtaggcatatggagctcatgcctgaagaggtgaataattct-3' (SEQ ID NO. 21) and PpUGT1R: 5'-tatctagactgcaggtcgactcacgaacaaccaaagcatctccgt-3' (SEQ ID NO. 22), PpUGT2F: 5'-aaggtaggcatatggagctcatggcggagagcggcagtggagcag-3' (SEQ ID NO. 23) and PpUGT2R: 5'-tatctagactgcaggtcgactcaggagcagcccatgtacttc-3' (SEQ ID NO. 23). NO.24), PpUGT3F: 5'-aaggtaggcatatggagctcatgggctccgacgatcgtcaacctc-3' (SEQ ID NO.25) and PpUGT3R: 5'-tatctagactgcaggtcgactcagtctttcgattcctttctggat-3' (SEQ ID NO.26), PpUGT4F: 5'-aaggtaggcatatggagctcatgggagaagacaatggaagccttc-3' (SEQ ID NO.27) and PpUGT4R: 5'-tatctagactgcaggtcgacttacattttcaaaggctgaggtttc-3' (SEQ ID NO.28), PpUGT5F:5'-aaggtaggcatatggagctcatggaagaaggcaatgaaagccttc-3' (SEQ ID Using primer pair NO.29 and PpUGT5R:5'-tatctagactgcaggtcgacttacagcttcagaggttgtggcgtc-3' (SEQ ID NO.30), PCR amplification was performed using the high-fidelity enzyme PrimeSTAR HS DNA Polymerase in a 50 μL volume.

[0085] The PCR amplification reaction system is as follows:

[0086] dNTP Mixture (2.5mM each) 4μL Primer F 1μL Primer R 1μL Template cDNA 0.5μL PrimeSTAR HS DNA Polymerase 0.5μL Deionized water 33μL

[0087] The PCR amplification reaction program was as follows: 98℃ for 10 seconds, 60℃ for 15 seconds, 72℃ for 2 minutes, for 35 cycles. After the program was completed, the product was recovered and purified.

[0088] The pCold TF vector was double-digested with restriction endonucleases KpnI and SalI, reacted at 37℃ for 3 h, and the band size was detected by 1% agarose gel electrophoresis. The product was then recovered and purified. The purified PCR product was ligated into the pCold TF vector, i.e., the cDNA encoding the PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 genes was cloned into the pCold TF expression vector containing an N-terminal HIS tag, constructing the recombinant vectors pCold TF / PpUGT1, pCold TF / PpUGT2, pCold TF / PpUGT3, pCold TF / PpUGT4, and pCold TF / PpUGT5. Their structural diagrams are shown below. Figures 2-6 As shown. The recombinant vectors pColdTF / PpUGT1, pColdTF / PpUGT2, pColdTF / PpUGT3, pColdTF / PpUGT4, and pColdTF / PpUGT5 were transformed into Escherichia coli DH5α, plated on LB agar plates supplemented with ampicillin (Amp: 100 μg / mL) for screening, and incubated overnight at 37°C until single colonies grew. Single colonies were picked for PCR and enzyme digestion verification, and positive clones were selected for DNA sequencing verification.

[0089] Example 3

[0090] Inducible expression and solubility analysis of recombinant proteins of glycosyltransferases PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5:

[0091] Plasmids pCold TF / PpUGT1, pCold TF / PpUGT2, pCold TF / PpUGT3, pCold TF / PpUGT4, and pCold TF / PpUGT5 were extracted from recombinant strains with correct sequencing. These plasmids were transformed into *E. coli* expression strain BL21(DE3). Screening was performed using LB agar plates supplemented with ampicillin (Amp: 100 μg / mL). Single colonies were randomly selected for colony PCR verification. Verified single colonies were inoculated into 6 mL of LB liquid medium containing ampicillin resistance and incubated overnight at 37°C with shaking. The activated bacteria were then inoculated at a 1:100 ratio into 50 mL of LB liquid medium and incubated at 37°C with shaking until OD (out of control) was reached. 600The value was approximately 0.5. 5 mL of bacterial culture was used as a control, and the remainder was added to 45 μL of 0.3 mM IPTG. The mixture was induced overnight at 16°C. Prepare the relevant protein purification buffers. Centrifuge the low-temperature induced bacterial culture at 4°C, 12000 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells in 7 mL of Buffer 1 (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 5 mM DTT, 10 mM imidazole). Sonicate the bacterial cells on ice for 20 min. Reserve 100 μL as a control. Centrifuge the remaining samples at 4°C, 12000 rpm for 10 min, transfer the supernatant, and add 500 μL of Ni-NTA agarose (purchased from Qiagen). Incubate at 4°C for 1 h. Add the protein solution containing Ni-NTA agarose to a polypropylene column (purchased from Qiagen). Administer 6 mL of Buffer 1, 6 mL of Buffer 2 (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 5 mM DTT, 20 mM imidazole), and 3 mL of Buffer 3 (20 mM Tris-HCl) to each column. The protein was eluted sequentially using a solution of pH 8.0, 500 mM NaCl, 5 mM DTT, and 250 mM imidazole, with the eluent collected simultaneously. The eluent in buffer 3 was the purified protein. An equal volume of glycerol was added, and the mixture was mixed and stored at -80°C. Protein solubility and size were analyzed by 10% SDS-PAGE following the relevant procedures. The results showed that the recombinant proteins PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5 were well soluble, with protein sizes ranging from 95 kDa to 140 kDa.

[0092] Example 4

[0093] In vitro enzyme activity assays and product analysis of glycosyltransferases PpUGT1, PpUGT2, PpUGT3, PpUGT4, and PpUGT5:

[0094] Reaction solution: 50 mM Tris-HCl (pH 8.0), 100 μM sugar donor, 100 μM substrate, 300 μL crude enzyme, and deionized water to a final volume of 400 μL. The reaction solution was mixed thoroughly and allowed to stand at 30°C for 6 h. The reaction was terminated by adding an equal volume of methanol. The mixture was dried under vacuum, dissolved in 100 μL of methanol, and centrifuged at 12000 rpm for 20 min. The reaction solution was analyzed by HPLC. Figure 7 .

[0095] The substrates of PpUGT1 and PpUGT2 are diosgenin and phenobarbitin, with UDP-glucose as the sugar donor; the substrates of PpUGT3 are desmosiderin and phenobarbitin-3-O-β-D-glucopyranoside, with UDP-rhamnose as the sugar donor; the substrates of PpUGT4 and PpUGT5 are Paris polyphylla saponin V and Paris polyphylla saponin VI, with UDP-glucose as the sugar donor. UDP-glucose and UDP-rhamnose were purchased from Guangzhou Angfei Biotechnology Co., Ltd.; diosgenin (CAS 512-04-9) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; desmoside (CAS 14144-06-0) and Paris polyphylla saponin V (CAS 19057-67-1) were purchased from Chengdu Mansite Biotechnology Co., Ltd.; Paris polyphylla saponin VI (CAS 55916-51-3) was purchased from Chengdu Zhibiao Chemical Pure Biotechnology Co., Ltd.; phenobarbitin (CAS 507-89-1) and phenobarbitin-3-O-β-D-glucopyranoside (CAS 37341-36-9) were obtained from our laboratory.

[0096] HPLC chromatographic conditions 1: Aglient 1260 system, Aglient SDB-C18 column (4μm, 4.6×250mm), CH3CN-H2O mobile phase (0-18min: 44%-86%, 18-22min: 86%-100%, 22-32min: 100%, v / v), column temperature 37℃, injection volume 20μL, flow rate 1mL / min, detection wavelength 195nm.

[0097] Depend on Figure 7 As shown in A and B, compared with the control group, PpUGT1 and PpUGT2 both synthesized a specific product when using diosgenin and pennosiderin as substrates. Comparison with the standards diosgenin and pennosiderin-3-O-β-D-glucopyranoside, respectively, revealed that the retention times of the specific product peaks were consistent with those of the standards, indicating that the products were diosgenin and pennosiderin-3-O-β-D-glucopyranoside, respectively. Figure 7 As shown in C and D, compared with the control group, PpUGT3 synthesized a specific product when using desmosiderin and pennosapogenin-3-O-β-D-glucopyranoside as substrates. Comparison with the standards Paris polyphylla saponin V and Paris polyphylla saponin VI revealed that the retention times of the specific product peaks were consistent with those of the standards, indicating that the products were Paris polyphylla saponin V and Paris polyphylla saponin VI, respectively. Figure 7As can be seen from E and F, compared with the control group, PpUGT4 and PpUGT5 synthesized a specific product when using Paris polyphylla saponin V and Paris polyphylla saponin VI as substrates. When compared with the standard diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B, respectively, the retention time of the specific product peak was consistent with that of the standard, indicating that the product is diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside and trikamsteroside B, respectively.

[0098] Example 5

[0099] Analysis of enzyme kinetic parameters of glycosyltransferases PpUGT1, PpUGT2, PpUGT4, and PpUGT5:

[0100] Escherichia coli expression strains BL21(DE3) containing pCold TF / PpUGT1, pCold TF / PpUGT2, pCold TF / PpUGT4, and pCold TF / PpUGT5 were incubated overnight at 37°C with shaking in 6 mL of LB broth supplemented with ampicillin (Amp: 100 μg / mL). The activated bacteria were then inoculated at a 1:100 ratio into 50 mL of LB broth and incubated at 37°C with shaking until OD (open-circuit retrieval). 600The value is approximately 0.5. Add 50 μL of 0.3 M IPTG and induce overnight at 16 °C. Prepare the relevant protein purification buffers. The low-temperature induced bacterial culture was centrifuged at 4°C, 12000 rpm for 10 min, the supernatant was discarded, and the precipitate was resuspended in 7 mL of buffer 1 (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 5 mM DTT, 10 mM imidazole). The bacterial cells were then sonicated on ice for 10 min. 100 μL was reserved as a control. The remaining samples were centrifuged at 4°C, 12000 rpm for 10 min, the supernatant was transferred, and 500 μL of Ni-NTA agarose (purchased from Qiagen) was added. The mixture was incubated at 4°C for 1 h. The protein solution containing Ni-NTA agarose was added to a polypropylene column (purchased from Qiagen), and then purified with 6 mL of buffer 1, 6 L of buffer 2 (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole), and 3 mL of buffer 3 (320 mM Tris-HCl pH 8.0, 500 mM DTT, 10 mM imidazole), respectively. Elute sequentially with NaCl and 250mM imidazole, and collect the eluent at the same time. The eluent in buffer 3 is the purified protein. Add an equal volume of glycerol, mix well, and store at -20℃.

[0101] Determination of enzyme kinetic parameters of PpUGT1 and PpUGT2:

[0102] Reaction solution: 50 mM Tris-HCl (pH 8.0), 100 μM UDP-glucose, 100 μg of purified protein, diosgenin concentration gradients of 0, 20, 40, 60, 80, and 100 μM, with deionized water to a final volume of 300 μL. The reaction solution was mixed thoroughly and allowed to stand at 37 °C for 45 min. The reaction was terminated by adding an equal volume of methanol. The mixture was dried under vacuum, dissolved in 100 μL of methanol, and centrifuged at 12000 rpm for 20 min. The obtained sample was used for HPLC analysis.

[0103] HPLC chromatographic conditions 2: Aglient 1260 system, Aglient SDB-C18 column (4μm, 4.6×250mm), CH3CN-H2O mobile phase (0-15min: 55%-100%, 15-27min: 100%, 22-32min: 100%, v / v), column temperature 37℃, injection volume 20μL, flow rate 1mL / min, detection wavelength 195nm.

[0104] Determination of enzyme kinetic parameters of PpUGT4 and PpUGT5:

[0105] Reaction solution: 50 mM Tris-HCl (pH 8.0), 100 μM UDP-glucose, 100 μg of purified protein, and concentration gradients of Paris polyphylla saponin VI at 0, 20, 40, 60, 80, and 100 μM, with deionized water added to a final volume of 300 μL. The reaction solution was mixed thoroughly and allowed to stand at 37°C for 25 min. The reaction was terminated by adding an equal volume of methanol. The mixture was dried under vacuum, dissolved in 100 μL of methanol, and centrifuged at 12000 rpm for 20 min. The obtained sample was used for HPLC analysis.

[0106] HPLC chromatographic conditions 3: Aglient 1260 system, Aglient SDB-C18 column (4μm, 4.6×250mm), CH3CN-H2O mobile phase (0-15min: 30%-75%, 15-16min: 75%-95%, 16-21min: 95%, v / v), column temperature 37℃, injection volume 20μL, flow rate 1mL / min, detection wavelength 195nm.

[0107] A standard curve was prepared using Paris polyphylla saponin VI under HPLC chromatographic conditions 3. The concentration gradients of Paris polyphylla saponin VI were 0, 5, 10, 15, 20, and 25 nmol. The peak area as a function of concentration was obtained as y = 538.12x + 38.989 (R²). 2 =0.9999), calculate the content of reaction products using the function. Obtained using Lineweaver–Burk plot. Figure 8 ,according to Figure 8 The intercepts of the function on the x and y axes are used to calculate the Km value.

[0108] Depend on Figure 8 A and B calculated the Km values ​​of PpUGT1 and PpUGT2 with diosgenin as substrate to be 20.1 and 16.1 μM, respectively; C and D calculated the Km values ​​of PpUGT4 and PpUGT5 with Paris polyphylla saponin VI as substrate to be 32.5 and 22.1 μM, respectively.

[0109] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

[0110] sequence list

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

Claims

1. A glycosyltransferase for the biosynthesis of Paris polyphylla saponins, which is a glycosyltransferase of PpUGT4 with the amino acid sequence shown in SEQ ID NO.

4.

2. The gene encoding the glycosyltransferase of claim 1 is the gene encoding PpUGT4, whose nucleotide sequence is shown in SEQ ID NO.

9.

3. A recombinant vector, expression cassette, or recombinant bacterium containing the encoding gene of claim 2.

4. The use of the glycosyltransferase of claim 1, the encoding gene of claim 2, or the recombinant vector, expression cassette, or recombinant bacteria of claim 3 in the preparation of transgenic plants containing glycosyltransferase.

5. The application of the glycosyltransferase of claim 1, the encoding gene of claim 2, or the recombinant vector, expression cassette, or recombinant bacteria of claim 3 in the synthesis of diosgenin-3-O-α-L-rhamnopyranose-(1-2)-[β-D-glucopyranose-(1-6)]-β-D-glucopyranoside using UDP-glucose as the sugar donor and Paris polyphylla saponin V as the sugar acceptor, and in the synthesis of trikamsteroside B using UDP-glucose as the sugar donor and Paris polyphylla saponin VI as the sugar acceptor, in the synthesis of trikamsteroside B using UDP-glucose as the sugar donor and Paris polyphylla saponin VI as the sugar acceptor. Mode Mode .

Citation Information

Patent Citations

  • Glycosyl transferase PpUGT73E5 and application thereof in synthesis of polyphyllin

    CN114807075A

  • Novel glyphosate N-acetyltransferase (GAT) genes

    CN102212534A

  • Preparation method of monomeric substances in Chinese Trillium tschonoskii Maxim. and rhizoma paridis medicinal materials and application of monomeric substances to preparation of medicine for treating Alzheimer disease

    CN106138627A