Pyruvate kinase mutants and uses thereof

Abstract

This invention discloses a pyruvate kinase mutant and its applications. Mutating the 101st amino acid of pyruvate kinase in Bacillus microorganisms from threonine (T) to lysine (K), arginine (R), or proline (P) increases adenosine production, with the most significant effect observed after threonine to lysine mutation. The pyruvate kinase mutant strain pyk... T101K Compared to the original strain A1, adenosine production increased from 1.3 g / L to a maximum of 2.1 g / L; the pyruvate kinase mutant strain pyk... T101R Compared with the starting strain A1, the optimal increase in inosine yield was 1.1 g / L, up from 0.6 g / L. This invention provides an effective method for large-scale nucleoside production and has broad application prospects.

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering technology, specifically relating to pyruvate kinase mutants and their applications. Background Technology

[0002] Nucleosides are a general term for a class of glycosides. They are components of nucleic acids and nucleotides. Nucleosides are formed by the condensation of D-ribose or D2-deoxyribose with pyrimidine or purine bases. Nucleosides are generally colorless crystals, insoluble in common organic solvents, readily soluble in hot water, and have a melting point of 160–240℃. Nucleosides formed from D-ribose are called ribonucleosides and participate in the composition of RNA; nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides and participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleosides, guanine ribonucleosides, cytosine ribonucleosides, thymine ribonucleosides, and uracil ribonucleosides, which are abbreviated as adenosine (A), guanine (G), cytosine (C), thymine (T), and uridine (U), respectively.

[0003] Guanosine and inosine have wide applications in the food and pharmaceutical industries. In the food sector, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as flavor enhancers, widely applied in condiments such as chicken bouillon and soy sauce. In the pharmaceutical sector, guanosine and inosine serve as intermediates for various antiviral drugs, such as acyclic guanosine, triazole nucleoside, and guanosine triphosphate sodium, all of which require guanosine as a raw material for synthesis. Inosine is an important precursor of inosine monophosphate, which in turn serves as a precursor for the synthesis of adenosine monophosphate (AMP) and guanosine monophosphate (GMP). It is suitable for treating various causes of leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, and can also be used to treat central retinitis and optic nerve atrophy.

[0004] Currently, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens, and Bacillus pumilus. In the selection and modification of growth strains, high-yielding nucleosides are selectively bred using ultraviolet mutagenesis and diethyl sulfate mutagenesis; or, based on a thorough understanding of the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are analyzed, and metabolic engineering is used to purposefully modify the strains to obtain high-yielding nucleosides with superior traits. However, the fermentation performance of current nucleoside strains remains relatively poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. Summary of the Invention

[0005] The purpose of this invention is to provide a pyruvate kinase mutant and its application.

[0006] Another objective of this invention is to provide a nucleoside-producing strain, its construction method, and its application.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a pyruvate kinase mutant, said mutant comprising a mutation in the 101st amino acid of pyruvate kinase from T to K, R or P.

[0008] In this invention, the reference sequence number of pyruvate kinase on NCBI is NP_390796.1.

[0009] In a second aspect, the present invention provides a nucleic acid molecule encoding the pyruvate kinase mutant.

[0010] Thirdly, the present invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.

[0011] Fourthly, the present invention provides any of the following applications of the nucleic acid molecule or biological materials containing the nucleic acid molecule:

[0012] (1) Used for the fermentation production of nucleosides;

[0013] (2) Used to increase the fermentation yield of nucleosides;

[0014] (3) Used to construct genetically engineered bacteria that produce nucleosides.

[0015] Fifthly, the present invention provides a method for constructing a nucleoside-producing strain, which uses genetic engineering to introduce mutations into the genome of a microorganism capable of nucleoside production, so that the pyruvate kinase it encodes contains T101K, T101R or T101P mutation sites.

[0016] The microorganism in question is a species of Bacillus.

[0017] Preferably, the microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, etc., more preferably Bacillus subtilis A1, strain A1 can be found in CN201910599510.8.

[0018] In a sixth aspect, the present invention provides a nucleoside-producing strain constructed according to the method.

[0019] In a seventh aspect, the present invention provides the application of the strain in nucleoside fermentation production or in increasing nucleoside fermentation yield.

[0020] Eighthly, the present invention provides a method for producing nucleosides, the method comprising the following steps:

[0021] a) Cultivate the nucleoside-producing strain to obtain a culture of the strain;

[0022] b) Collect the resulting nucleosides from the culture obtained in step a).

[0023] The nucleosides include adenosine, inosine, guanosine, and other nucleosides or their corresponding nucleoside derivatives, such as hypoxanthine, inosine, guanine, guanylic acid, riboflavin, diacetylguanylic acid, etc.

[0024] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0025] Mutating the 101st amino acid of pyruvate kinase in Bacillus microorganisms from threonine (T) to lysine (K), arginine (R), or proline (P) all increased adenosine production, with the most significant effect observed after threonine (T) was mutated to lysine (K). The pyruvate kinase mutant strain pyk... T101K Compared to the original strain A1, adenosine production increased from 1.3 g / L to a maximum of 2.1 g / L; the pyruvate kinase mutant strain pyk... T101R Compared with the starting strain A1, the optimal increase in inosine yield was 1.1 g / L, up from 0.6 g / L. This invention provides an effective method for large-scale nucleoside production and has broad application prospects. Detailed Implementation

[0026] The present invention aims to provide a method for producing purine nucleosides using microorganisms, and a novel microorganism capable of producing purine nucleosides with high efficiency.

[0027] Research has found that modifying the pyruvate kinase (encoded by the pyk gene) of Bacillus subtilis or Bacillus amyloliquefaciens enables microorganisms to produce adenosine and inosine efficiently, and has successfully created a new microorganism capable of producing nucleosides efficiently, thus completing this invention.

[0028] The present invention adopts the following technical solution:

[0029] This invention provides a Bacillus subtilis strain in which the 101st amino acid of the pyruvate kinase encoded by the pyk gene is mutated from threonine (T) to an amino acid other than threonine, preferably lysine (K), arginine (R), or proline (P), to obtain pyruvate kinase mutants T101K, T101R, and T101P, respectively. The amino acid sequences of the pyruvate kinase mutants T101K, T101R, and T101P are shown in SEQ ID NO:2, 4, and 6, respectively, and their nucleic acid sequences are shown in SEQ ID NO:1, 3, and 5, respectively.

[0030] The pyk gene encodes pyruvate kinase, which catalyzes the conversion of phosphoenolpyruvate (PEP) to pyruvate (PYR). This process involves the consumption of one molecule of ADP and the generation of one molecule of ATP. This invention modifies the pyk gene to mutate pyruvate kinase, enhancing the nucleoside production capacity of the microorganism compared to the unmodified strain, ultimately increasing the production of adenosine and inosine.

[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0032] The primers used in the following examples are shown in Table 1:

[0033] Table 1

[0034] Primer name Primer sequences (5′-3′) <![CDATA[pyk T101K -UP-1F]]> GGTTCTCCGAGTGCTGCTGAC <![CDATA[pyk T101K -UP-1R]]> CATATGTCACTGAAATTTTATCTGTTGTTCCTACAACCTCGTCCA <![CDATA[pyk T101K -DN-2F]]> TGGACGAGGTTGTAGGAACAACAGATAAAATTTCAGTGACATATG <![CDATA[pyk T101K -DN-2R]]> ACAGGTTTGCCCAGCGCGTTG <![CDATA[pyk T101R -UP-1R]]> CATATGTCACTGAAATTTTATCTCTTGTTCCTACAACCTCGTCCA <![CDATA[pyk T101R -DN-2F]]> TGGACGAGGTTGTAGGAACAAGAGATAAAATTTCAGTGACATATG <![CDATA[pyk T101P -UP-1R]]> CATATGTCACTGAAATTTTATCTGGTGTTCCTACAACCTCGTCCA <![CDATA[pyk T101P -DN-2F]]> TGGACGAGGTTGTAGGAACACCAGATAAAATTTCAGTGACATATG

[0035] Example 1: Construction of pyruvate kinase mutant strain pyk T101K

[0036] Using the genome of strain B. subtilis A1 (hereinafter referred to as A1) as a template, primer pyk was used. T101K -UP-1F / pyk T101K -UP-1R and pyk T101K -DN-2F / pyk T101K -DN-2R, two fragments were amplified using Phusion ultrafidelity polymerase (New England BioLabs). Primers pyk were used. T101K -UP-1F / pyk T101K-DN-2R fuses two fragments to obtain a recombinant fragment. The recombinant fragment is then assembled with the pKSU plasmid (the pKSU plasmid was kindly provided by Professor Wang Shufang of Nankai University; see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production[J], Applied Microbiology and Biotechnology, 2014, 98(21):8963-8973. Zhang W, Gao W, Feng J, et al DOI:10.1007 / s00253-014-5824-2), transformed, and other operations to obtain the recombinant plasmid pKSU-pyk. T101K Transformed into *B. subtilis* A1 strain, transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30°C. The transformed strains were inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. These primary recombinants were then inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, yielding pyk... T101K The point mutant strain was named B. subtilis A1-pyk. T101K hereinafter referred to as pyk T101K .

[0037] Example 2: Construction of pyruvate kinase mutant strain pyk T101R

[0038] Using the genome of strain B. subtilis A1 as a template, primer pyk was used. T101K -UP-1F / pyk T101R -UP-1R and pyk T101R -DN-2F / pyk T101K -DN-2R, two fragments were amplified using Phusion ultrafidelity polymerase (New England BioLabs). Primers pyk were used. T101K -UP-1F / pyk T101K -DN-2R fuses two fragments to obtain a recombinant fragment. After assembling the recombinant fragment with the pKSU plasmid and performing transformation, the recombinant plasmid pKSU-pyk is obtained. T101RTransformed into *B. subtilis* A1 strain, transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30°C. The transformed strains were inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. These primary recombinants were then inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, yielding pyk... T101R The point mutant strain was named B. subtilis A1-pyk. T101R hereinafter referred to as pyk T101R .

[0039] Example 3: Construction of pyruvate kinase mutant strain pyk T101P

[0040] Using the genome of strain B. subtilis A1 as a template, primer pyk was used. T101K -UP-1F / pyk T101P -UP-1R and pyk T101P -DN-2F / pyk T101K -DN-2R, two fragments were amplified using Phusion ultrafidelity polymerase (New England BioLabs). Primers pyk were used. T101K -UP-1F / pyk T101K -DN-2R fuses two fragments to obtain a recombinant fragment. After assembling the recombinant fragment with the pKSU plasmid and performing transformation, the recombinant plasmid pKSU-pyk is obtained. T101P Transformed into *B. subtilis* A1 strain, transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30°C. The transformed strains were inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. These primary recombinants were then inoculated into 5 mL LB liquid medium and cultured at 42°C, 200 rpm for 12 h, followed by one generation. The transformed strains were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, yielding pyk... T101P The point mutant strain was named B. subtilis A1-pyk. T101P hereinafter referred to as pyk T101P .

[0041] Example 4: Comparison of Nucleoside Production Capacity of Engineered Bacteria

[0042] 1. Culture medium:

[0043] (1) Seed culture medium formula (g / L): glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0~7.2. Sterilization conditions: sterilize at 121℃ for 20min.

[0044] (2) Fermentation medium formula (g / L): glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0~7.2. Sterilization conditions: sterilize at 121℃ for 20 min.

[0045] 2. Cultivation Methods

[0046] (1) Streak the strain in three zones on LB plates and incubate overnight at 37°C;

[0047] (2) Pick a single colony and inoculate it into 30 mL of seed culture medium. Incubate at 110 rpm and 36 °C for 7–8 h.

[0048] (3) Transfer 10% of the inoculum to 30 mL of fermentation medium, shake at 120 rpm, and incubate at 36 °C for 36 h.

[0049] 3. Detection and Results

[0050] The nucleosides in the fermentation broth were detected using high performance liquid chromatography (HPLC), and the results are shown in Table 2.

[0051] Table 2. Evaluation results of the yield capacity of engineered bacteria in shake-flask fermentation (mean of three replicates)

[0052] strains Adenosine production (g / L) Inosine production (g / L) A1 1.3 0.6 <![CDATA[pyk T101K ]]> 2.1* 1.0* <![CDATA[pyk T101R ]]> 1.9* 1.1* <![CDATA[pyk T101P ]]> 1.6* 0.8*

[0053] Note: * indicates a significant difference compared to the starting strain (P < 0.01).

[0054] The experimental results above show that the pyruvate kinase mutant pyk T101K pyk T101R and pyk T101P It has a positive effect on increasing the production of adenosine and inosine, with adenosine production increasing from 1.3 g / L to 2.1 g / L and inosine production increasing from 0.6 g / L to 1.1 g / L.

[0055] Mutating the 101st amino acid of pyruvate kinase by replacing threonine (T) with lysine (K), arginine (R), or proline (P) all increased adenosine production, with the most significant effect observed after threonine (T) was replaced with lysine (K). The pyruvate kinase mutant strain pyk... T101K Compared to the original strain A1, adenosine production increased from 1.3 g / L to a maximum of 2.1 g / L; the pyruvate kinase mutant strain pyk...T101R Compared with the starting strain A1, the best result was an increase in inosine production from 0.6 g / L to 1.1 g / L.

[0056] The pyruvate kinase mutant and the pyruvate kinase mutant strain provided by this invention have a significant promoting effect on the production of target products adenosine and inosine. This pyruvate kinase mutant and its recombinant microorganism provide a reference for the construction of production strains that produce adenosine, inosine, and derivatives using these as precursors.

[0057] The construction of the strain of the present invention is not limited in terms of the order of steps. Anyone skilled in the art who achieves the purpose of the present invention by following the disclosure of the present invention is within the protection scope of the present invention.

[0058] The strain code in this invention is pyk T101K pyk T101R and pyk T101P The terms "pyk" are used for ease of description and should not be construed as limiting the invention. The method described above constructs a pyk gene containing Bacillus subtilis pyruvate kinase mutant pyk. T101K pyk T101R and pyk T101P The uses of engineered bacteria include, but are not limited to, adenosine and inosine.

[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> Pyruvate kinase mutants and their applications <130> KHP221110903.9 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1758 <212> DNA <213> Artificial Sequence <400> 1 atgagaaaaa ctaaaattgt ttgtaccatc ggtccggcaa gtgaaagtat tgaaatgctt 60 acgaaattaa tggagtcagg atgaacgtg gctcgattaa acttttctca cggatttt 120 gaggagcacg gtgcaagaat taaaataatc cgcgaagcaa gtaaaaaact tggcagaac 180 gttggaattc tgctgatac aaaaggtcct gaaatccgca cacatacaat ggaaaacggc 240 ggtattgagc tgaacagg caaagctc attatttca tggaggt tgtaggaca 300 aaagataaaa ttcagtgac atatgaaggt ttagtccatg acgttgaaca aggttcaacg 360 attctgttag atgacggcct tatcggctt gaggtacttg atgtagatgc cgctaaacgc 420 gaatcaaa aaagtatt aaacaacgga acactcaaa aaaaaagg tgttaacgta 480 ccgggcgtaa gtgtcaatct tccggggatt actgaaaagg atgcgcgaga catcgttttc 540 ggtattgagc aaggagtaga cttcatcgca ccatctttca ttcgacgttc tacggatgtg 600 ctcgaaatcc gtgagcttct tgagagcac aacgctcagg atattcaat catccctaaa 660 atcgaaaacc aagagggggt tgacaacatc gatgcgattc tcgaagtgtc tgacggctta 720 atggttgcac gcggagactt aggtgtggaa attccagctg aagagtgcc gcttgtgcaa 780 aaagaactga tcaaaaaatg caacgcgctg ggcaaacctg ttattacagc gacacaaatg 840 cttgacagca tgcagcgcaa cccgcgtccg actcgtgcgg aagcaagtga cgttgcaaac 900 gcgatcttcg acggaacaga tgcgatcatg ctttctggtg aaactgctgc cggaagttac 960 ccggttgaag cagttcaaac aatgcataac atcgcgtccc gttctgaaga agcattaaat 1020 tataaagaaa ttctctcaaa acgcagagac caagtgggca tgacaattac agacgcaatt 1080 ggacaatctg tcgcacatac ggcgattaac ctgaatgctg ctgcgatcgt aacgccgaca 1140 gaaagcggcc atacagcacg tatgattgca aaataccgtc cgcaggctcc gattgttgcg 1200 gttactgtaa atgactctat ttccagaaag cttgccctcg tatctggcgt attcgcggaa 1260 agcggccaaa atgcgagctc aacagatgag atgcttgagg atgctgtcca aaaatcattg 1320 aacagcggaa ttgtaaaaca cggcgatctt atcgttatta cagctggcac tgtcggtgag 1380 tccggcacta cgaacttaat gaaggttcat actgtcggcg atatcatcgc taaaggccaa 1440 ggcattggac gcaaatcagc ttacggtccg gttgtcgttg cacaaaatgc aaaagaagct 1500 gagcaaaaaa tgactgacgg tgcggtactt gttaccaaaa gcactgaccg tgatatgatt 1560 gcatcccttg aaaaagcgtc tgctcttatt acagaagaag gcggtttgac tagccatgct 1620 gcggtagtcg gattaagcct tggcatcccg gttatcgtgg gtctggaaaa tgcgacatct 1680 attttgacag atggccagga tattacagtt gacgcttcca gaggcgcagt ctatcaaggc 1740 cgtgcgagcg ttctttaa 1758 <210> 2 <211> 585 <212> PRT <213> Artificial Sequence <400> 2 Met Arg Lys Thr Lys Ile Val Cys Thr Ile Gly Pro Ala Ser Glu Ser 1 5 10 15 Ile Glu Met Leu Thr Lys Leu Met Glu Ser Gly Met Asn Val Ala Arg 20 25 30 Leu Asn Phe Ser His Gly Asp Phe Glu Glu His Gly Ala Arg Ile Lys 35 40 45 Asn Ile Arg Glu Ala Ser Lys Lys Leu Gly Lys Asn Val Gly Ile Leu 50 55 60 Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr His Thr Met Glu Asn Gly 65 70 75 80 Gly Ile Glu Leu Glu Thr Gly Lys Glu Leu Ile Ile Ser Met Asp Glu 85 90 95 Val Val Gly Thr Lys Asp Lys Ile Ser Val Thr Tyr Glu Gly Leu Val 100 105 110 His Asp Val Glu Gln Gly Ser Thr Ile Leu Leu Asp Asp Gly Leu Ile 115 120 125 Gly Leu Glu Val Leu Asp Val Asp Ala Ala Lys Arg Glu Ile Lys Thr 130 135 140 Lys Val Leu Asn Asn Gly Thr Leu Lys Asn Lys Lys Gly Val Asn Val 145 150 155 160 Pro Gly Val Ser Val Asn Leu Pro Gly Ile Thr Glu Lys Asp Ala Arg 165 170 175 Asp Ile Val Phe Gly Ile Glu Gln Gly Val Asp Phe Ile Ala Pro Ser 180 185 190 Phe Ile Arg Arg Ser Thr Asp Val Leu Glu Ile Arg Glu Leu Leu Glu 195 200 205 Glu His Asn Ala Gln Asp Ile Gln Ile Ile Pro Lys Ile Glu Asn Gln 210 215 220 Glu Gly Val Asp Asn Ile Asp Ala Ile Leu Glu Val Ser Asp Gly Leu 225 230 235 240 Met Val Ala Arg Gly Asp Leu Gly Val Glu Ile Pro Ala Glu Glu Val 245 250 255 Pro Leu Val Gln Lys Glu Leu Ile Lys Lys Cys Asn Ala Leu Gly Lys 260 265 270 Pro Val Ile Thr Ala Thr Gln Met Leu Asp Ser Met Gln Arg Asn Pro 275 280 285 Arg Pro Thr Arg Ala Glu Ala Ser Asp Val Ala Asn Ala Ile Phe Asp 290 295 300 Gly Thr Asp Ala Ile Met Leu Ser Gly Glu Thr Ala Ala Gly Ser Tyr 305 310 315 320 Pro Val Glu Ala Val Gln Thr Met His Asn Ile Ala Ser Arg Ser Glu 325 330 335 Glu Ala Leu Asn Tyr Lys Glu Ile Leu Ser Lys Arg Arg Asp Gln Val 340 345 350 Gly Met Thr Ile Thr Asp Ala Ile Gly Gln Ser Val Ala His Thr Ala 355 360 365 Ile Asn Leu Asn Ala Ala Ala Ile Val Thr Pro Thr Glu Ser Gly His 370 375 380 Thr Ala Arg Met Ile Ala Lys Tyr Arg Pro Gln Ala Pro Ile Val Ala 385 390 395 400 Val Thr Val Asn Asp Ser Ile Ser Arg Lys Leu Ala Leu Val Ser Gly 405 410 415 Val Phe Ala Glu Ser Gly Gln Asn Ala Ser Ser Thr Asp Glu Met Leu 420 425 430 Glu Asp Ala Val Gln Lys Ser Leu Asn Ser Gly Ile Val Lys His Gly 435 440 445 Asp Leu Ile Val Ile Thr Ala Gly Thr Val Gly Glu Ser Gly Thr Thr 450 455 460 Asn Leu Met Lys Val His Thr Val Gly Asp Ile Ile Ala Lys Gly Gln 465 470 475 480 Gly Ile Gly Arg Lys Ser Ala Tyr Gly Pro Val Val Val Ala Gln Asn 485 490 495 Ala Lys Glu Ala Glu Gln Lys Met Thr Asp Gly Ala Val Leu Val Thr 500 505 510 Lys Ser Thr Asp Arg Asp Met Ile Ala Ser Leu Glu Lys Ala Ser Ala 515 520 525 Leu Ile Thr Glu Glu Gly Gly Leu Thr Ser His Ala Ala Val Val Gly 530 535 540 Leu Ser Leu Gly Ile Pro Val Ile Val Gly Leu Glu Asn Ala Thr Ser 545 550 555 560 Ile Leu Thr Asp Gly Gln Asp Ile Thr Val Asp Ala Ser Arg Gly Ala 565 570 575 Val Tyr Gln Gly Arg Ala Ser Val Leu 580 585 <210> 3 <211> 1758 <212> DNA <213> Artificial Sequence <400> 3 atgagaaaaa ctaaaattgt ttgtaccatc ggtccggcaa gtgaaagtat tgaaatgctt 60 acgaaattaa tggagtcagg aatgaacgtg gctcgattaa acttttctca cggagatttt 120 gaggagcacg gtgcaagaat taaaaatatc cgcgaagcaa gtaaaaaact tggcaagaac 180 gttggaattc tgcttgatac aaaaggtcct gaaatccgca cacatacaat ggaaaacggc 240 ggtattgagc ttgaaacagg caaagagctc attatttcaa tggacgaggt tgtaggaaca 300 agagataaaa tttcagtgac atatgaaggt ttagtccatg acgttgaaca aggttcaacg 360 attctgttag atgacggcct tatcggtctt gaggtacttg atgtagatgc cgctaaacgc 420 gaaatcaaaa caaaagtatt aaacaacgga acactcaaaa ataaaaaagg tgttaacgta 480 ccgggcgtaa gtgtcaatct tccggggatt actgaaaagg atgcgcgaga catcgttttc 540 ggtattgagc aaggagtaga cttcatcgca ccatctttca ttcgacgttc tacggatgtg 600 ctcgaaatcc gtgagcttct tgaagagcac aacgctcagg atattcaaat catccctaaa 660 atcgaaaacc aagagggcgt tgacaacacatc gatgcgattc tcgaagtgtc tgacggctta 720 atggttgcac gcggagaactt aggtgtggaa attccagctg aagaagtgcc gcttgtgcaa 780 aaaactga tcaaaaaatg caacgcgctg ggcaaacctg ttattacagc gacacaatg 840 cttgacagca tgcagcgcaa cccgcgtccg actcgtgcgg aagcaagtga cgttgcaaac 900 gcgatcttcg aggaagaga tgcgatcatg ctttctggtg aaactgctgc cggaagttac 960 1020 tataaagaaa ttctctcaaa acgcagagac caagtgggca tgacaattac agacgcaatt 1080 ggacaatctg tcgcacatac ggcgattaac ctgaatgctg ctgcgatcgt aacgccgaca 1140 gaaagcggcc atacagcacg tatgattgca aaataccgtc cgcaggctcc gattgttgcg 1200 gttactgtaa atgactctat ttccagaaag cttgccctcg tatctggcgt attcgcggaa 1260 agcggccaaa atgcgagctc aacagatgag atgcttgagg atgctgtcca aaaatcattg 1320 aacagcggaa ttgtaaaaca cggcgatctt atcgttatta cagctggcac tgtcggtgag 1380 tccggcacta cgaacttaat gaaggttcat actgtcggcg atatcatcgc taaaggccaa 1440 ggcattggac gcaaatcagc ttacggtccg gttgtcgttg cacaaaatgc aaaagaagct 1500 gagcaaaaaa tgactgacgg tgcggtactt gttaccaaaa gcactgaccg tgatatgatt 1560 gcatcccttg aaaaagcgtc tgctcttatt acagaagaag gcggtttgac tagccatgct 1620 gcggtagtcg gattaagcct tggcatcccg gttatcgtgg gtctggaaaa tgcgacatct 1680 attttgacag atggccagga tattacagtt gacgcttcca gaggcgcagt ctatcaaggc 1740 cgtgcgagcg ttctttaa 1758 <210> 4 <211> 585 <212> PRT <213> Artificial Sequence <400> 4 Met Arg Lys Thr Lys Ile Val Cys Thr Ile Gly Pro Ala Ser Glu Ser 1 5 10 15 Ile Glu Met Leu Thr Lys Leu Met Glu Ser Gly Met Asn Val Ala Arg 20 25 30 Leu Asn Phe Ser His Gly Asp Phe Glu Glu His Gly Ala Arg Ile Lys 35 40 45 Asn Ile Arg Glu Ala Ser Lys Lys Leu Gly Lys Asn Val Gly Ile Leu 50 55 60 Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr His Thr Met Glu Asn Gly 65 70 75 80 Gly Ile Glu Leu Glu Thr Gly Lys Glu Leu Ile Ile Ser Met Asp Glu 85 90 95 Val Val Gly Thr Arg Asp Lys Ile Ser Val Thr Tyr Glu Gly Leu Val 100 105 110 His Asp Val Glu Gln Gly Ser Thr Ile Leu Leu Asp Asp Gly Leu Ile 115 120 125 Gly Leu Glu Val Leu Asp Val Asp Ala Ala Lys Arg Glu Ile Lys Thr 130 135 140 Lys Val Leu Asn Asn Gly Thr Leu Lys Asn Lys Lys Gly Val Asn Val 145 150 155 160 Pro Gly Val Ser Val Asn Leu Pro Gly Ile Thr Glu Lys Asp Ala Arg 165 170 175 Asp Ile Val Phe Gly Ile Glu Gln Gly Val Asp Phe Ile Ala Pro Ser 180 185 190 Phe Ile Arg Arg Ser Thr Asp Val Leu Glu Ile Arg Glu Leu Leu Glu 195 200 205 Glu His Asn Ala Gln Asp Ile Gln Ile Ile Pro Lys Ile Glu Asn Gln 210 215 220 Glu Gly Val Asp Asn Ile Asp Ala Ile Leu Glu Val Ser Asp Gly Leu 225 230 235 240 Met Val Ala Arg Gly Asp Leu Gly Val Glu Ile Pro Ala Glu Glu Val 245 250 255 Pro Leu Val Gln Lys Glu Leu Ile Lys Lys Cys Asn Ala Leu Gly Lys 260 265 270 Pro Val Ile Thr Ala Thr Gln Met Leu Asp Ser Met Gln Arg Asn Pro 275 280 285 Arg Pro Thr Arg Ala Glu Ala Ser Asp Val Ala Asn Ala Ile Phe Asp 290 295 300 Gly Thr Asp Ala Ile Met Leu Ser Gly Glu Thr Ala Ala Gly Ser Tyr 305 310 315 320 Pro Val Glu Ala Val Gln Thr Met His Asn Ile Ala Ser Arg Ser Glu 325 330 335 Glu Ala Leu Asn Tyr Lys Glu Ile Leu Ser Lys Arg Arg Asp Gln Val 340 345 350 Gly Met Thr Ile Thr Asp Ala Ile Gly Gln Ser Val Ala His Thr Ala 355 360 365 Ile Asn Leu Asn Ala Ala Ala Ile Val Thr Pro Thr Glu Ser Gly His 370 375 380 Thr Ala Arg Met Ile Ala Lys Tyr Arg Pro Gln Ala Pro Ile Val Ala 385 390 395 400 Val Thr Val Asn Asp Ser Ile Ser Arg Lys Leu Ala Leu Val Ser Gly 405 410 415 Val Phe Ala Glu Ser Gly Gln Asn Ala Ser Ser Thr Asp Glu Met Leu 420 425 430 Glu Asp Ala Val Gln Lys Ser Leu Asn Ser Gly Ile Val Lys His Gly 435 440 445 Asp Leu Ile Val Ile Thr Ala Gly Thr Val Gly Glu Ser Gly Thr Thr 450 455 460 Asn Leu Met Lys Val His Thr Val Gly Asp Ile Ile Ala Lys Gly Gln 465 470 475 480 Gly Ile Gly Arg Lys Ser Ala Tyr Gly Pro Val Val Val Ala Gln Asn 485 490 495 Ala Lys Glu Ala Glu Gln Lys Met Thr Asp Gly Ala Val Leu Val Thr 500 505 510 Lys Ser Thr Asp Arg Asp Met Ile Ala Ser Leu Glu Lys Ala Ser Ala 515 520 525 Leu Ile Thr Glu Glu Gly Gly Leu Thr Ser His Ala Ala Val Val Gly 530 535 540 Leu Ser Leu Gly Ile Pro Val Ile Val Gly Leu Glu Asn Ala Thr Ser 545 550 555 560 Ile Leu Thr Asp Gly Gln Asp Ile Thr Val Asp Ala Ser Arg Gly Ala 565 570 575 Val Tyr Gln Gly Arg Ala Ser Val Leu 580 585 <210> 5 <211> 1758 <212> DNA <213> Artificial Sequence <400> 5 atgagaaaaa ctaaaattgt ttgtaccatc ggtccggcaa gtgaaagtat tgaaatgctt 60 acgaaattaa tggagtcagg aatgaacgtg gctcgattaa acttttctca cggagatttt 120 gaggagcacg gtgcaagaat taaaaatatc cgcgaagcaa gtaaaaaact tggcaagaac 180 gttggaattc tgcttgatac aaaaggtcct gaaatccgca cacatacaat ggaaaacggc 240 ggtattgagc ttgaaacagg caaagagctc attatttcaa tggacgaggt tgtaggaaca 300 ccagataaaa tttcagtgac atatgaaggt ttagtccatg acgttgaaca aggttcaacg 360 attctgttag atgacggcct tatcggtctt gaggtacttg atgtagatgc cgctaaacgc 420 gaaatcaaaa caaaagtatt aaacaacgga acactcaaaa ataaaaaagg tgttaacgta 480 ccgggcgtaa gtgtcaatct tccggggatt actgaaaagg atgcgcgaga catcgttttc 540 ggtattgagc aaggagtaga cttcatcgca ccatctttca ttcgacgttc tacggatgtg 600 ctcgaaatcc gtgagcttct tgaagagcac aacgctcagg atattcaaat catccctaaa 660 atcgaaaacc aagagggcgt tgacaacatc gatgcgattc tcgaagtgtc tgacggctta 720 atggttgcac gcggagactt aggtgtggaa attccagctg aagaagtgcc gcttgtgcaa 780 aaagaactga tcaaaaaatg caacgcgctg ggcaaacctg ttattacagc gacacaaatg 840 cttgacagca tgcagcgcaa cccgcgtccg actcgtgcgg aagcaagtga cgttgcaaac 900 gcgatcttcg acggaacaga tgcgatcatg ctttctggtg aaactgctgc cggaagttac 960 ccggttgaag cagttcaaac aatgcataac atcgcgtccc gttctgaaga agcattaaat 1020 tataaagaaa ttctctcaaa acgcagagac caagtgggca tgacaattac agacgcaatt 1080 ggacaatctg tcgcacatac ggcgattaac ctgaatgctg ctgcgatcgt aacgccgaca 1140 gaaagcggcc atacagcacg tatgattgca aaataccgtc cgcaggctcc gattgttgcg 1200 gttactgtaa atgactctat ttccagaaag cttgccctcg tatctggcgt attcgcggaa 1260 agcggccaaa atgcgagctc aacagatgag atgcttgagg atgctgtcca aaaatcattg 1320 aacagcggaa ttgtaaaaca cggcgatctt atcgttatta cagctggcac tgtcggtgag 1380 tccggcacta cgaacttaat gaaggttcat actgtcggcg atatcatcgc taaaggccaa 1440 ggcattggac gcaaatcagc ttacggtccg gttgtcgttg cacaaaatgc aaaagaagct 1500 gagcaaaaaa tgactgacgg tgcggtactt gttaccaaaa gcactgaccg tgatatgatt 1560 gcatcccttg aaaaagcgtc tgctcttatt acagaagaag gcggtttgac tagccatgct 1620 gcggtagtcg gattaagcct tggcatcccg gttatcgtgg gtctggaaaa tgcgacatct 1680 attttgacag atggccagga tattacagtt gacgcttcca gaggcgcagt ctatcaaggc 1740 cgtgcgagcg ttctttaa 1758 <210> 6 <211> 585 <212> PRT <213> Artificial Sequence <400> 6 Met Arg Lys Thr Lys Ile Val Cys Thr Ile Gly Pro Ala Ser Glu Ser 1 5 10 15 Ile Glu Met Leu Thr Lys Leu Met Glu Ser Gly Met Asn Val Ala Arg 20 25 30 Leu Asn Phe Ser His Gly Asp Phe Glu Glu His Gly Ala Arg Ile Lys 35 40 45 Asn Ile Arg Glu Ala Ser Lys Lys Leu Gly Lys Asn Val Gly Ile Leu 50 55 60 Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr His Thr Met Glu Asn Gly 65 70 75 80 Gly Ile Glu Leu Glu Thr Gly Lys Glu Leu Ile Ile Ser Met Asp Glu 85 90 95 Val Val Gly Thr Pro Asp Lys Ile Ser Val Thr Tyr Glu Gly Leu Val 100 105 110 His Asp Val Glu Gln Gly Ser Thr Ile Leu Leu Asp Asp Gly Leu Ile 115 120 125 Gly Leu Glu Val Leu Asp Val Asp Ala Ala Lys Arg Glu Ile Lys Thr 130 135 140 Lys Val Leu Asn Asn Gly Thr Leu Lys Asn Lys Lys Gly Val Asn Val 145 150 155 160 Pro Gly Val Ser Val Asn Leu Pro Gly Ile Thr Glu Lys Asp Ala Arg 165 170 175 Asp Ile Val Phe Gly Ile Glu Gln Gly Val Asp Phe Ile Ala Pro Ser 180 185 190 Phe Ile Arg Arg Ser Thr Asp Val Leu Glu Ile Arg Glu Leu Leu Glu 195 200 205 Glu His Asn Ala Gln Asp Ile Gln Ile Ile Pro Lys Ile Glu Asn Gln 210 215 220 Glu Gly Val Asp Asn Ile Asp Ala Ile Leu Glu Val Ser Asp Gly Leu 225 230 235 240 Met Val Ala Arg Gly Asp Leu Gly Val Glu Ile Pro Ala Glu Glu Val 245 250 255 Pro Leu Val Gln Lys Glu Leu Ile Lys Lys Cys Asn Ala Leu Gly Lys 260 265 270 Pro Val Ile Thr Ala Thr Gln Met Leu Asp Ser Met Gln Arg Asn Pro 275 280 285 Arg Pro Thr Arg Ala Glu Ala Ser Asp Val Ala Asn Ala Ile Phe Asp 290 295 300 Gly Thr Asp Ala Ile Met Leu Ser Gly Glu Thr Ala Ala Gly Ser Tyr 305 310 315 320 Pro Val Glu Ala Val Gln Thr Met His Asn Ile Ala Ser Arg Ser Glu 325 330 335 Glu Ala Leu Asn Tyr Lys Glu Ile Leu Ser Lys Arg Arg Asp Gln Val 340 345 350 Gly Met Thr Ile Thr Asp Ala Ile Gly Gln Ser Val Ala His Thr Ala 355 360 365 Ile Asn Leu Asn Ala Ala Ala Ile Val Thr Pro Thr Glu Ser Gly His 370 375 380 Thr Ala Arg Met Ile Ala Lys Tyr Arg Pro Gln Ala Pro Ile Val Ala 385 390 395 400 Val Thr Val Asn Asp Ser Ile Ser Arg Lys Leu Ala Leu Val Ser Gly 405 410 415 Val Phe Ala Glu Ser Gly Gln Asn Ala Ser Ser Thr Asp Glu Met Leu 420 425 430 Glu Asp Ala Val Gln Lys Ser Leu Asn Ser Gly Ile Val Lys His Gly 435 440 445 Asp Leu Ile Val Ile Thr Ala Gly Thr Val Gly Glu Ser Gly Thr Thr 450 455 460 Asn Leu Met Lys Val His Thr Val Gly Asp Ile Ile Ala Lys Gly Gln 465 470 475 480 Gly Ile Gly Arg Lys Ser Ala Tyr Gly Pro Val Val Val Ala Gln Asn 485 490 495 Ala Lys Glu Ala Glu Gln Lys Met Thr Asp Gly Ala Val Leu Val Thr 500 505 510 Lys Ser Thr Asp Arg Asp Met Ile Ala Ser Leu Glu Lys Ala Ser Ala 515 520 525 Leu Ile Thr Glu Glu Gly Gly Leu Thr Ser His Ala Ala Val Val Gly 530 535 540 Leu Ser Leu Gly Ile Pro Val Ile Val Gly Leu Glu Asn Ala Thr Ser 545 550 555 560 Ile Leu Thr Asp Gly Gln Asp Ile Thr Val Asp Ala Ser Arg Gly Ala 565 570 575 Val Tyr Gln Gly Arg Ala Ser Val Leu 580 585

Claims

1. An engineered bacterium containing a nucleic acid molecule encoding a pyruvate kinase mutant, characterized in that, The starting strain of the engineered bacteria is Bacillus subtilis (B. subtilis). Bacillus subtilis A1; The amino acid sequences of the mutants are shown in SEQ ID NO:2, 4 or 6, respectively.

2. Any of the following applications of the engineered bacteria described in claim 1: (1) Used for the fermentation production of nucleosides; (2) Used to increase the fermentation yield of nucleosides; The nucleosides are adenosine and / or inosine.

3. A method for constructing a nucleoside-producing strain, characterized in that, Using genetic engineering techniques, mutations are introduced into the genome of microorganisms capable of nucleoside production, so that the pyruvate kinase they encode contains T101K, T101R, or T101P mutation sites; wherein the amino acid sequences of the pyruvate kinases containing T101K, T101R, or T101P mutation sites are shown as SEQ ID NO:2, 4, or 6, respectively. The microorganism is Bacillus subtilis (B. subtilis) Bacillus subtilis A1; The nucleosides are adenosine and / or inosine.

4. A method for producing nucleosides, characterized in that, The method includes the following steps: a) Cultivate the engineered bacteria according to claim 1 to obtain a culture of the strain; b) Collect the resulting nucleosides from the culture obtained in step a); The nucleosides are adenosine and / or inosine.