Novel-miR-59 and its use in anti-aging therapy

Abstract

The application discloses novel-miR-59 and application thereof in anti-aging treatment. The application provides application of novel-miR-59 as a target point in any one of the following: preparation of a product for treating an aging-related disease; preparation of a product for relieving or improving an aging symptom; and a mature body sequence of the novel-miR-59 is shown as SEQ ID No. 1. The application finds a new role of a miRNA novel-miR-59 in an HGPS aging process, reveals a molecular mechanism of a novel-miR-59 / HMGAs / basic transcription machine axis in mediating HGPS cell aging, provides a new theoretical basis for a pathogenesis of HGPS. Meanwhile, the feasibility of novel-miR-59 as a drug target point in treating HGPS and physiological aging is clarified, and a new epigenetic modification strategy for treating HGPS and physiological aging is provided.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to novel-miR-59 and its application in anti-aging treatment. Background Technology

[0002] There are two different types of aging: one is physiological aging that occurs under normal circumstances; the other is pathological aging caused by disease.

[0003] Hutchinson-Gilford progeria syndrome (HGPS) is the most typical and common type of premature aging syndrome in children. HGPS is a rare but fatal premature aging disease; affected children are usually born normal, age rapidly in childhood, and often die from myocardial infarction or stroke in adolescence, with an average lifespan of only 14.6 years. Currently, although there are many reports on the aging mechanisms of HGPS, its complex aging process remains far from being fully elucidated. Furthermore, the cellular aging pattern in HGPS patients is very similar to that in normal elderly individuals, suggesting that HGPS is similar to an accelerated version of normal physiological aging. Therefore, in-depth exploration of the molecular mechanisms of HGPS aging is not only important for revealing the pathogenesis of HGPS and developing new treatment strategies, but also has significant value for exploring the molecular mechanisms of normal human aging.

[0004] HGPS progeria is primarily caused by a single-point mutation in exon 11 of the LMNA gene (human: G608G; GGC-GGT) (mouse: G609G; GGC-GGT). Although this is a synonymous mutation, it activates a hidden mRNA splicing site in exon 11, resulting in the deletion of the terminal 50 amino acids, forming the progerin protein. Progerin can migrate towards the nuclear membrane and accumulate, ultimately leading to various physiological abnormalities. HGPS cellular senescence is accompanied by changes in various epigenetic modifications, including the abnormal expression of miRNAs. miRNAs are small non-coding RNAs considered important regulators of gene expression, primarily functioning by degrading target mRNAs or inhibiting their translation. However, the role and mechanism of miRNAs in HGPS progeria remain unclear. Summary of the Invention

[0005] The purpose of this invention is to provide a novel miRNA and its application in anti-aging therapy.

[0006] The novel miRNA provided by this invention is specifically novel-miR-59.

[0007] Firstly, the present invention claims protection for the use of novel-miR-59 as a target in any of the following:

[0008] (A1) To prepare products for treating age-related diseases, or to treat age-related diseases;

[0009] (A2) To prepare products that alleviate or improve symptoms of aging, or to alleviate or improve symptoms of aging;

[0010] The mature sequence of novel-miR-59 is shown in SEQ ID No. 1.

[0011] Secondly, the present invention claims protection for the use of substance A in the following (A1) or (A2):

[0012] (A1) To prepare products for treating age-related diseases, or to treat age-related diseases;

[0013] (A2) Prepare products that alleviate or improve symptoms (phenotype) of aging, or alleviate or improve symptoms (phenotype) of aging.

[0014] The substance A is a substance capable of inhibiting the expression of (a1) or (a2) or (a3) ​​as follows:

[0015] (a1) Mature novel-miR-59;

[0016] (a2) Precursor novel-miR-59;

[0017] (a3) encodes the mature novel-miR-59 described in (a1) or the precursor novel-miR-59 described in (a2) DNA molecule.

[0018] The sequence of the mature novel-miR-59 is shown in SEQ ID No. 1.

[0019] Thirdly, the present invention claims the use of substance B in the following (A1) or (A2):

[0020] (A1) To prepare products for treating age-related diseases, or to treat age-related diseases;

[0021] (A2) Prepare products that alleviate or improve symptoms (phenotype) of aging, or alleviate or improve symptoms (phenotype) of aging.

[0022] The substance B is as shown in (b1), (b2), or (b3) below:

[0023] (b1) Nucleic acid molecules encoding HMGAs proteins;

[0024] (b2) An expression cassette, recombinant vector or recombinant cell containing the nucleic acid molecule described in (b1)

[0025] (b3) Substances that promote the expression of HMGAs proteins.

[0026] Fourthly, this invention claims protection for a product.

[0027] The product claimed in this invention contains substance A and / or substance B.

[0028] The substance A is a substance capable of inhibiting the expression of (a1) or (a2) or (a3) ​​as follows:

[0029] (a1) Mature novel-miR-59;

[0030] (a2) Precursor novel-miR-59;

[0031] (a3) encodes the mature novel-miR-59 described in (a1) or the precursor novel-miR-59 described in (a2) DNA molecule.

[0032] The sequence of the mature novel-miR-59 is shown in SEQ ID No. 1.

[0033] The substance B is as shown in (b1), (b2), or (b3) below:

[0034] (b1) Nucleic acid molecules encoding HMGAs proteins;

[0035] (b2) An expression cassette, recombinant vector or recombinant cell containing the nucleic acid molecule described in (b1)

[0036] (b3) Substances that promote the expression of HMGAs proteins.

[0037] The product has the following uses as shown in P1 or P2:

[0038] P1. Treatment of age-related diseases;

[0039] P2. Relieve or improve symptoms of aging (phenotype).

[0040] In the above text, the product may be a medicine.

[0041] Furthermore, the drug is prepared by adding pharmaceutically acceptable excipients to the substance A and / or the substance B.

[0042] Furthermore, the medicine is in the form of tablets, pills, granules, capsules, injections, or oral liquids.

[0043] In the above text, substance A may be the single-stranded RNA shown in SEQ ID No. 4.

[0044] In the above text, the HMGAs proteins may be HMGA1 proteins and / or HMGA2 proteins.

[0045] Further, the amino acid sequence of the HMGA1 protein is shown in SEQ ID No. 5; the amino acid sequence of the HMGA2 protein is shown in SEQ ID No. 6. The sequence of the nucleic acid molecule encoding the HMGA1 protein is shown in SEQ ID No. 8; the sequence of the nucleic acid molecule encoding the HMGA2 protein is shown in SEQ ID No. 9.

[0046] Fifthly, the present invention claims the use of substance C in the following (B1) or (B2):

[0047] (B1) To prepare products that promote the occurrence and / or development of age-related diseases, or to promote the occurrence and / or development of age-related diseases;

[0048] (B2) Prepare products that aggravate aging symptoms (phenotype), or aggravate aging symptoms (phenotype).

[0049] The substance C is any one of the substances shown in (a1)-(a5) below:

[0050] (a1) Mature novel-miR-59;

[0051] (a2) Precursor novel-miR-59;

[0052] (a3) The DNA molecule encoding the mature novel-miR-59 described in (a1) or the precursor novel-miR-59 described in (a2);

[0053] (a4) An expression cassette, recombinant vector, or recombinant cell containing the DNA molecule described in (a3);

[0054] (a5) Substances that promote the expression of mature novel-miR-59.

[0055] The sequence of the mature novel-miR-59 is shown in SEQ ID No. 1;

[0056] Sixthly, the present invention claims the use of substance D in the following (B1) or (B2):

[0057] (B1) To prepare products that promote the occurrence and / or development of age-related diseases, or to promote the occurrence and / or development of age-related diseases;

[0058] (B2) Prepare products that aggravate aging symptoms (phenotype), or aggravate aging symptoms (phenotype).

[0059] The substance D is a substance that can inhibit the expression of HMGAs proteins, such as shRNAs that target HMGA1 and / or HMGA2.

[0060] The product may be a cell model or an animal model, or a substance used to prepare the cell model or the animal model.

[0061] The HMGAs proteins are HMGA1 and / or HMGA2 proteins.

[0062] Further, the amino acid sequence of the HMGA1 protein is shown in SEQ ID No. 5; the amino acid sequence of the HMGA2 protein is shown in SEQ ID No. 6. The sequence of the nucleic acid molecule encoding the HMGA1 protein is shown in SEQ ID No. 8; the sequence of the nucleic acid molecule encoding the HMGA2 protein is shown in SEQ ID No. 9.

[0063] In the above, in (A1) and (B1), the age-related disease may be progeria.

[0064] Furthermore, the progeria mentioned can be Hutchinson-Gilford progeria syndrome (HGPS).

[0065] In the above, in (A2) and (B2), the aging is physiological aging (natural aging due to old age) or premature aging.

[0066] Furthermore, the premature aging is Hutchinson-Guilford premature aging in children (HGPS).

[0067] In the foregoing, the sequence of the precursor novel-miR-59 is shown in SEQ ID No. 2.

[0068] In the foregoing, the sequence of the DNA molecule encoding the mature novel-miR-59 is shown in SEQ ID No. 3.

[0069] In the above text, the relief or improvement of aging symptoms (phenotype) may refer to the relief or improvement of cellular aging symptoms (phenotype) or the relief or improvement of the body's aging symptoms (phenotype).

[0070] In the above text, the aggravated aging symptoms (phenotype) can refer to the aggravated aging symptoms (phenotype) of cells or the aggravated aging symptoms (phenotype) of the body.

[0071] In the above text, cellular senescence can be manifested as an increased proportion of senescence-related SA-β-gal staining positivity, downregulation of cell cycle-related proteins Cyclin A2 and / or lamin B1, and a decreased proportion of Ki67-positive cells, a marker of cell proliferation in the cell nucleus. Organismal senescence can be manifested as hair loss, rickets, shortened lifespan, weight loss, and deterioration of physiological functions (such as decreased athletic ability, subcutaneous fat loss, thinning of the epidermis, thickening of the vascular adventitia, and increased degree of fibrosis in multiple tissues of the heart muscle).

[0072] In this invention, we used miRNA sequencing to screen for a novel miRNA, novel-miR-59, in HGPS cells and Lmna. G609G / G609G The expression of novel-miR-59 was upregulated in multiple tissues of premature aging mice. Subsequently, we inhibited novel-miR-59 in HGPS cells, and the detection of aging biomarkers showed that anti-novel-miR-59 could alleviate the senescent phenotype of HGPS cells. To screen for target genes of novel-miR-59, we combined software prediction and gene function analysis to screen for 7 aging-related genes. Inhibition of novel-miR-59 in HGPS patient cells and detection of the mRNA expression of the 7 potential target genes led us to speculate that HMGA1 and HMGA2 may be target genes of novel-miR-59. Luciferase reporter assays further confirmed that novel-miR-59 directly binds to the 3′UTR of HMGAs, confirming that HMGAs are target genes of novel-miR-59. At the individual level, in HGPS premature aging ICR mice (Lmna... G609G / G609G Eight days after birth, mice were intraperitoneally injected with AAV9 adenovirus carrying the novel-miR-59 antisense sequence (AAV9-mCherry-anti-novel-miR-59). Histological, behavioral, and morphological analyses were used to examine changes in the aging phenotype of prematurely aging mice. We found that inhibiting novel-miR-59 improved the external morphology and increased the body weight of the mice. Furthermore, inhibiting novel-miR-59 partially restored the physiological functions of prematurely aging mice, including increasing epidermal thickness, alleviating subcutaneous fat loss, and reducing the degree of fibrosis in vascular, cardiac, and muscle tissues. Most importantly, inhibiting novel-miR-59 prolonged the lifespan of HGPS prematurely aging mice.

[0073] In summary, this invention discovers the role of a novel miRNA, novel-miR-59, in the aging process of hepatocellular carcinoma (HGPS), reveals the molecular mechanism by which novel-miR-59-HMGAs mediate HGPS cellular senescence, and provides new theoretical evidence for the pathogenesis of HGPS. Furthermore, it clarifies the feasibility of using novel-miR-59 as a drug target for the treatment of HGPS and physiological aging, and proposes a new epigenetic modification strategy for the treatment of HGPS and physiological aging. Attached Figure Description

[0074] Figure 1 To induce senescence in CRL-1474 cells through progerin overexpression. A: Western blot analysis was used to detect the expression of senescence-related markers cyclin A2, Lamin B1, and H3K9me3 6 days after progerin overexpression, with β-actin as an internal control. B: SA-β-gal staining was used to detect and statistically analyze the senescence of CRL-1474 cells. Scale bars = 100 μm, **, P < 0.01. C: Real-time RT-PCR was used to detect the expression of novel-miR-59 in progerin-expressing CRL-1474 cells, **, P < 0.01. D: Real-time RT-PCR was used to detect the expression of novel-miR-59 in HGPS patient cells (HGAFDFN003 p21 and HGAFDFN167p19), *, P < 0.05, ***, P < 0.001.

[0075] Figure 2 Anti-novel-miR-59 can reverse the senescent phenotype of HGPS patient cells. A: SA-β-gal staining was used to detect and statistically analyze the effect of inhibiting novel-miR-59 on the senescence of HGPS patient cells (HGADFN003, passage 22). ***, P<0.001. B: Immunofluorescence was used to detect and statistically analyze the effect of inhibiting novel-miR-59 on the Ki67 positivity rate of HGPS patient cells (HGADFN003, passage 22). ***, P<0.001.

[0076] Figure 3To mitigate the senescence phenotype of CRL-1474 cells overexpressing progerin using Anti-novel-miR-59. A: SA-β-gal staining was used to detect and statistically analyze the effect of inhibiting novel-miR-59 on the senescence of HGPS cells (CRL-1474 cells overexpressing progerin). ***, P<0.001. B: Immunofluorescence was used to detect and statistically analyze the effect of inhibiting novel-miR-59 on the Ki67 positivity rate of HGPS cells. **, P<0.01, ***, P<0.001. C: Western blot was used to detect the effect of inhibiting novel-miR-59 on the expression of senescence-related markers cyclin A2 and lamin B1 in HGPS cells. β-actin was used as an internal control.

[0077] Figure 4 To investigate the upregulation of HMGAs mRNA and protein expression in HGPS patient cells by anti-novel-miR-59. A: Targetscan and miRanda were used to predict the target genes of novel-miR-59. B: Real-time RT-PCR was used to detect the effect of inhibiting novel-miR-59 on the mRNA expression of predicted target genes in HGPS patient cells (HGADFN003, passage 23). *, P<0.05, ***, P<0.001. C: Western blot was used to detect the effect of inhibiting novel-miR-59 on the expression of HMGA1 and HMGA2 in HGPS patient cells (HGADFN003, passage 23), with β-actin as an internal control.

[0078] Figure 5 To investigate the upregulation of HMGAs expression in progerin-overexpressing HGPS cells by Anti-novel-miR-59. A: Western blot analysis was used to detect HMGA1 and HMGA2 protein expression in progerin-overexpressing CRL-1474 cells, with β-actin as an internal control. B: Real-time RT-PCR was used to detect HMGA1 and HMGA2 mRNA expression in progerin-overexpressing CRL-1474 cells. *, P < 0.05, **, P < 0.01.

[0079] Figure 6The study investigated the upregulation of HMGAs protein expression by anti-novel-miR-59 in aged skin fibroblasts. A: Real-time RT-PCR was used to detect novel-miR-59 expression in aged cells. B: Western blot analysis was used to detect HMGA1 and HMGA2 protein expression in aged cells, with β-actin as an internal control. C: Real-time RT-PCR was used to detect HMGA1 and HMGA2 mRNA expression in aged cells. After transfection with anti-novel-miR-59 into 88-year-old fibroblasts, Western blot analysis was used to detect the expression of aging-related markers cyclin A2 and Lamin B1 (D), as well as HMGA1 and HMGA2 protein expression (E), with β-actin as an internal control. F: Real-time RT-PCR was used to detect HMGA1 and HMGA2 mRNA expression in 88-year-old fibroblasts after transfection with anti-novel-miR-59. *, P<0.05, **, P<0.01, ***, P<0.001. The 7y, 88y, and 90y values ​​in the figure correspond to CRL-1474 (7 years old), AG05247 (88 years old), and AG09602 (92 years old), respectively.

[0080] Figure 7 The interaction between novel-miR-59 and HMGAs 3′UTR was investigated. A: Software predicted the interaction sites between novel-miR-59 and HMGAs 3′UTR. B: Dual-luciferase reporter assay was used to detect the targeting relationship between novel-miR-59 and HMGAs, **, P<0.01.

[0081] Figure 8 For Lmna G609G / G609G In premature aging mice, the expression levels of novel-miR-59 and Hmgas were negatively correlated. A: Lmna was constructed using CRISPR-Cas9 gene editing technology. G609G / G609G A premature aging mouse model was used; sequencing results showed a C-to-T mutation at the G609G site. B: Real-time RT-PCR was used to detect Lmna. G609G / G609G Expression of novel-miR-59 in premature aging mice, WT and Lmna G609G / G609G n=3. Real-time RT-PCR was used to detect Lmna. G609G / G609G Expression of Hmga1(C) and Hmga2(D) in premature aging mice (WT and Lmna) G609G / G609G : n=3), *P<0.05, **, P<0.01, ***, P<0.001.

[0082] Figure 9 For LmnaG609G / G609G Treatment regimen of AAV9-mCherry-anti-novel-miR-59 in premature aging mice. In vivo gene therapy regimen. Mice were intraperitoneally injected with 100 μL PBS or AAV9-mCherry-anti-novel-miR-59 8 days after birth. At 30 days post-injection (DPI), in vivo imaging assays were performed to detect the distribution of mCherry signal intensity in the dorsal, ventral, and lateral regions (A). In vivo imaging assays were performed to detect the distribution of mCherry signal intensity in multiple tissues (B).

[0083] Figure 10 To inhibit novel-miR-59 and improve Lmna G609G / G609G External morphology of premature aging mice. Lmna G609G / G609G Eight days after birth, premature aging mice were injected intraperitoneally with AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Morphological changes in the mice were observed after 12 weeks (A: male mice, B: female mice).

[0084] Figure 11 To inhibit the increase of Lmna by novel-miR-59 G609G / G609G Weight of premature aging mice. Lmna G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with either AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Body weight changes were assessed starting at week 4 (A: male body weight change, WT: n=10, anti-Ctrl group: n=9, anti-novel-miR-59 group: n=7; B: female body weight change, WT: n=5, anti-Ctrl and anti-novel-miR-59 groups: n=6 each). C: mouse survival time (WT: n=12, anti-Ctrl and anti-novel-miR-59 groups: n=13 each). *P<0.05, **, P<0.01, ***, P<0.001.

[0085] Figure 12 To inhibit the increase of Lmna by novel-miR-59 G609G / G609G Motor function in premature aging mice. Lmna G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Twelve weeks later, a mining experiment was conducted to measure the distance (in centimeters) of movement within 20 minutes. A: Movement distance of male mice, n=4 per group. B: Movement distance of female mice, n=4 per group. *P<0.05, **, P<0.01.

[0086] Figure 13 To inhibit novel-miR-59 and delay Lmna G609G / G609G Skin aging in premature aging mice. Lmna G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Twelve weeks later, skin tissue was perfused from the mice for H&E staining, and subcutaneous fat width was measured using ImageJ. Each group had n=3 mice; *P<0.05, ***, P<0.001; scale bars=150μm.

[0087] Figure 14 To inhibit the reduction of Lmna by novel-miR-59 G609G / G609G The degree and thickness of adventitia fibrosis in the blood vessels of prematurely aging mice. (Lmna) G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Twelve weeks later, vascular tissue was collected from the perfused mice for Masson staining (arrows pointing to the adventitia), and the adventitia thickness was statistically analyzed using ImageJ. Each group had n=3 mice, ***, P<0.001, scale bars=200μm (top), scale bars=50μm (bottom).

[0088] Figure 15 To inhibit the reduction of Lmna by novel-miR-59 G609G / G609G The degree of fibrosis in the heart and muscle tissue of prematurely aging mice. (Lmna) G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59. Twelve weeks later, heart and muscle tissues were perfused from the mice for Masson staining, and the degree of fibrosis in the heart and muscle tissues was statistically analyzed using ImageJ. Each group had n=3 mice, *P<0.05, and scale bars=50μm. Detailed Implementation

[0089] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0090] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0091] The mature sequence of novel-miR-59 involved in the following embodiments is shown in SEQ ID No. 1, the precursor sequence is shown in SEQ ID No. 2, and the corresponding coding DNA sequence is shown in SEQ ID No. 3.

[0092] Example 1: novel-miR-59 and its application in anti-aging therapy

[0093] I. Experimental Materials

[0094] 1. Reagent kit

[0095] miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit, Tiangen KR211. miRcute Enhanced miRNA Quantitative Real-Time Detection Kit, Tiangen FP411. Plasmid Large-Scale Extraction Kit, Beijing Kangwei Century CW2104. Plasmid Small-Scale Extraction Kit, Tiangen DP103-03. Dual-Luciferase Reporter Gene Detection Kit, Promega E1910. Agarose Gel DNA Recovery Kit, Tiangen DP209-02. TRIzol Plus RNA Purification Kit, Thermo 12183555. Rapid Genotyping Kit, Bimake B40015. Masson Staining Kit, Absin abs9347.

[0096] 2. Antibodies

[0097] Anti-HMGA1 antibody, Cell Signaling Technology #7777. Anti-HMGA2 antibody, Cell Signaling Technology #8179. Anti-β-actin antibody, Sigma A1978. Anti-cyclin A2 antibody, Abcam ab181591. Anti-Ki67 antibody, GeneTex GTX16667. Anti-Lamin B1 antibody, Abcam ab16048. Anti-H3K9me3 antibody, Millipore 07-523. Fluorescent goat anti-rabbit IgG secondary antibody, Invitrogen A11008. Rabbit anti-goat IgG secondary antibody, Zhongshan Jinqiao ZB-2306. Fluorescent goat anti-mouse IgG secondary antibody, Invitrogen A11029. Goat anti-mouse IgG secondary antibody, Zhongshan Jinqiao ZF-0313 (Rhodamine). Goat anti-rabbit IgG secondary antibody, Pierce NC-AP132P-200.

[0098] 3. Plasmids

[0099] The lentiviral expression plasmid pCDH-CMV-3xFlag-progerin was constructed in our laboratory. The specific construction method is as follows: First, the vector pCDH-CMV-3xFlag was constructed. The sequence of 3xFlag (SEQ ID No. 7) was inserted between the XbaI and NotI sites of the vector pCDH-CMV-MCS-EF1-Puro (Shanghai Haijihaoge, CD510B). After sequencing verification, pCDH-CMV-3xFlag was obtained. The progerin gene LMNA (GeneID: 4000, lamin isoform A-delta50) was inserted into the pCDH-CMV-3xFlag vector. After sequencing verification, pCDH-CMV-3xFlag-progerin was obtained. The structural description of pCDH-CMV-3xFlag-progerin is as follows: the progerin gene LMNA (GeneID:4000, lamin isoform A-delta50) is inserted between the BamHI and NotI sites of pCDH-CMV-3xFlag to obtain the recombinant plasmid.

[0100] pGL3-HMGA1-3'-UTR and pGL3-HMGA2-3'-UTR were constructed in our laboratory. The specific construction method is as follows: Primers were designed using human genomic cDNA as a template. PCR was used to amplify the 3'-UTR fragments of HMGA1 or HMGA2 that bind to novel-miR-59 (SEQ ID No. 10 is the 3'-UTR of HMGA1, and SEQ ID No. 11 is the 3'-UTR of HMGA2). These fragments were then ligated into the vector pGL-3.0-control (Lianmai Biotechnology, LM3299). After sequencing verification, pGL3-HMGA1-3'-UTR and pGL3-HMGA2-3'-UTR were obtained. The structure of pGL3-HMGA1-3'-UTR is described as follows: a recombinant plasmid obtained by inserting the 3'-UTR fragment of HMGA1 shown in SEQ ID No. 10 between Xba1 and Fse1 in pGL-3.0-control. The structure of pGL3-HMGA2-3'-UTR is described as follows: a recombinant plasmid obtained by inserting the 3'-UTR fragment of HMGA2 shown in SEQ ID No. 11 between Xba1 and Fse1 in pGL-3.0-control. Primers were then designed using pGL3-HMGA1-3'-UTR or pGL3-HMGA2 3'-UTR as templates, and the mutated 3'-UTR fragment was obtained by a two-step PCR method. After sequencing verification, the plasmids pGL3-HMGA1-3'-UTR-mut and pGL3-HMGA2-3'-UTR-mut were obtained. The structure of pGL3-HMGA1-3'-UTR-mut is described as follows: a mutated 3'-UTR fragment of HMGA1 was inserted between Xba1 and Fse1 in pGL-3.0-control (the mutation site is based on SEQ ID No. 10, as shown in SEQ ID No. 10). Figure 7 The recombinant plasmid obtained after (as shown in Figure A) is described as follows. The structure of pGL3-HMGA2-3'-UTR-mut is as follows: a mutated 3'-UTR fragment of HMGA2 is inserted between Xba1 and Fse1 in pGL-3.0-control (the mutation site is as shown in SEQ ID No. 11). Figure 7 The recombinant plasmid obtained after A)

[0101] The pmR-mCherry-novel-miR-59 was constructed in our laboratory. The specific construction method is as follows: Primers were designed using human genomic cDNA as a template, and the precursor sequence of novel-miR-59 was amplified by PCR. This sequence was then ligated into the vector pmR-mCherry (U-Bio Biotechnology, VT1431). After sequencing verification, pmR-mCherry-novel-miR-59 was obtained. The structural description of pmR-mCherry-novel-miR-59 is as follows: the recombinant plasmid obtained by inserting the precursor sequence of novel-miR-59 (as shown in SEQ ID No. 2, after replacing U with T) between Xhol I and EcoRI in pmR-mCherry.

[0102] 4. Cell lines

[0103] The cell lines used in this invention are: human skin fibroblasts CRL-1474; human embryonic lung fibroblasts IMR90; human embryonic kidney cells HEK293T; human non-small cell lung cancer cell line H1299; and mouse embryonic fibroblast cell line NIH3T3. All of these cell lines were derived from the American Type Culture Collection (ATCC). The HGPS patient fibroblast cell lines HGADFN003 and HGADFN167 used in this invention were derived from the PRF (The Progeria Research Foundation); and the elderly skin fibroblast cell lines AG05247-88y and AG09602-92y were derived from the CCR (Coriell Cell Repository).

[0104] 5. Laboratory animals

[0105] The live animals used in this invention's experiments were genetically edited to obtain Lmna from premature aging mice. G609G / + Provided by Professor Li Zhanjun's laboratory at the College of Veterinary Medicine, Jilin University, the strain is ICR mouse. Heterozygous Lmna G609G / + Mice were mated, and the newborn mice underwent PCR fragment amplification using the Mouse Direct PCR Kit (Bimake 820049) for genotyping identification. The primer sequences were mLmna_fwd:CGAAGGCTTCCTGGCTATTT, mLmna_rev:TGCTGTAGGGCAGAGATGA. The target fragment was recovered and sequenced by Kumei Biotechnology to identify homozygous mouse Lmna. G609G / G609G It is used in in vivo experiments on mice.

[0106] The above Lmna G609G / +Mice were obtained by replacing the Lmna gene (Gene ID: 16905) in the genome of wild-type mice with an ICR background with an allele carrying the c.1827C>T; p.G609G mutation (the C at position 1827 of the sequence shown in GeneBank GeneID: 16905 is mutated to T). The wild-type mice with the ICR background were purchased from Liaoning Changsheng Biotechnology Co., Ltd.

[0107] II. Experimental Methods

[0108] I. Molecular Biology Experimental Methods

[0109] (I) Plasmid Construction (Expression Plasmid)

[0110] For standard methods and specific plasmid construction details, please refer to the relevant content in step one.

[0111] (II) Synthesis of miRNA mimics and inhibitors

[0112] miRNA mimics and inhibitors are shown in Table 1.

[0113] Table 1. miRNA mimics and inhibitors

[0114] novel-miR-59 mimics 5'-CCCUCUCUCUCCCCCCU-3'(SEQ ID No.1) novel-miR-59 inhibitors (antimiRs) 5'-AGGGGGGAGAGAGAGGG-3'(SEQ ID No.4)

[0115] All the miRNA mimics and inhibitors mentioned above are from GenePharma. mimics are double-stranded; antiimiR is single-stranded.

[0116] (iv) Plasmid extraction: Large-scale plasmid extraction: Use a plasmid large-scale extraction kit.

[0117] (v) RNA extraction, reverse transcription, and Real-time RT-PCR

[0118] Conventional methods. The primers used in Q-PCR are shown in Table 2.

[0119] Table 2. Primers used in Q-PCR

[0120]

[0121]

[0122] (vi) Western Blot

[0123] Conventional method.

[0124] (vii) Co-immunoprecipitation (Co-IP)

[0125] 1. Experimental Procedure

[0126] (1) Collect cells. Centrifuge at 4000 rpm for 5 min, remove the supernatant, and collect the precipitate.

[0127] (2) Cell lysis: Add 1 mL of pre-cooled Co-IP lysis buffer to the precipitate and lyse the cells on ice. Lyse the cells for 30 seconds every 2 minutes for a total of 30-40 minutes.

[0128] (3) Centrifuge at 12000 rpm for 12 min, aspirate the supernatant into a new tube, and discard the precipitate. Aspirate 100 μL from the supernatant as input, add 20 μL of loading buffer, and incubate in a metal bath at 100 °C for 8 min.

[0129] (4) Antibody incubation: Add 3-4 μg of antibody to the supernatant and incubate overnight at low speed on a vertical mixer at 4°C.

[0130] (5) On the second day, add 40 μL of A / G magnetic beads and 1 mL of PBS to each tube, and mix rapidly in a vertical mixer for 5 min. Remove the waste liquid. Take out the sample that has been incubated overnight and add it to the tube containing A / G magnetic beads. Mix vertically in a low-speed mixer at room temperature for 1-2 h. Discard the liquid and wash the magnetic beads.

[0131] (6) Sample preparation: Add 100 μL Loading Buffer to each tube, heat in a metal bath at 100℃ for 8 min, and the sample is ready for testing.

[0132] II. Cell Biology Experimental Methods

[0133] (I) Cell Culture

[0134] All human skin fibroblast cell lines used in the experiment, including CRL-1474, IMR90, HEK293T, H1299 (human non-small cell lung cancer), NIH3T3 (mouse embryonic fibroblast), and HGPS patient cell lines, were cultured in DMEM medium with 3.7 g / L NaHCO3, 10% fetal bovine serum (15% fetal bovine serum for HGPS patient cell lines), 1% Pen / Strep, and pH 7.2. HEK-293T, H1299, and NIH3T3 cells were cultured in an incubator at 37°C with 5% CO2. CRL-1474, IMR90, and HGPS patient cells were cultured in an incubator at 37°C with 5% CO2 and 5% O2 (Note: the incubator was purged with 99.99% high-purity nitrogen for 24 hours).

[0135] (II) Transient cell transfection

[0136] This invention uses liposome 2000 or PEI nanomaterial as transfection reagents (PEI is used for transfection of HEK-293T cells, and liposome 2000 is used for transfection of fibroblasts).

[0137] (III) Lentiviral Packaging and Infection

[0138] 1. Lentiviral packaging

[0139] (1) 14-16 hours before transfection, plate the cells in a 10cm cell culture dish.

[0140] (2) Transfection: On the second day, discard the original culture medium 1 hour in advance and replace it with 5 mL of serum-free and antibiotic-free DMEM culture medium.

[0141] (3) Incubation: Add 500 μL of serum-free and antibiotic-free DMEM medium to a centrifuge tube. Add 12 μg of core plasmid, 6.5 μg of packaging plasmid pMDlg / pRRE (Ubibio, VT1449), 3.5 μg of pCMV-VSV-G (Ubibio, VT1442), and 2.5 μg of pRSV-Rev (Ubibio, VT1445). The ratio of total plasmid mass to PEI is 4:1. After adding PEI and letting stand for 15 min, add the plasmid to a culture dish. After 6-8 h, replace the medium with DMEM complete medium and continue culturing. Replace the medium again on the morning of the third day. The virus solution can be collected at 48 h and 72 h after transfection. Filter the virus solution through a 0.45 μm filter and store at 4℃ for later use.

[0142] 2. Virus infects cells

[0143] (1) Inoculate the cells to be infected into a 10cm cell culture dish 18-20 hours in advance.

[0144] (2) On the second day, 5 mL of virus solution was placed in the cells, and 10 μL of 1 μg / mL polybrene was added. The cells were cultured for 8-10 h, and 10 mL of complete culture medium was used to change the medium.

[0145] (iv) Age-related β-galactosidase (SA-β-gal) staining experiment

[0146] conventional methods

[0147] (v) Immunofluorescence (IF)

[0148] conventional methods

[0149] (vi) Dual-luciferase reporter gene assay

[0150] conventional methods

[0151] (vii) miRNA sequencing and analysis

[0152] 1. Material preparation: Prepare normal and progerin-overexpressing CRL-1474 cells.

[0153] 2. RNA sample preparation: Extract RNA from the sample to a concentration ≥1 μg.

[0154] 3. Based on the sequencing platform of BioMed Biotechnology Co., Ltd., libraries were constructed, sequencing was performed, and GO / KEGG enrichment analysis was conducted.

[0155] III. Live Animal Experiments

[0156] (I) Lmna G609G / G609G Genotyping of premature aging mice

[0157] 1. Extraction of mouse genomic DNA

[0158] Approximately seven days after birth, the tails or toes of mice were clipped by about 1 mm. Genomic DNA was then extracted from the mice using a genomic DNA extraction kit.

[0159] 2. Take 2 μL of genomic product and perform PCR.

[0160] PCR primers:

[0161] mLMNA-JD-498-sense:5'-CGAAGGCTTCCTGGCTATTT-3'

[0162] mLMNA-JD-498-antisense:5'-TGCTGTAGGGCAGAGATGA-3'

[0163] 3. Run DNA gel, cut and recover the target band, and send it to Coome sequencing company for sequencing. Compare the results with the mLmna gene sequence to determine the mouse genotype (Note: Use BioEdit software for analysis. When the mutation site is T and a single peak appears, it is homozygous. When a double peak appears, it is heterozygous).

[0164] (II) Acquisition of the AAV9 virus

[0165] The novel-miR-59 antisense oligonucleotide sequence was inserted into the BsmBI site of the AAV9 vector containing mCherry—the GV480 vector from Genechem (for information on the GV480 vector, please refer to the following URL: https: / / www.genechem.com.cn / index / supports / zaiti_info.html?id=115). anti-novel-miR-59 (SEQ ID No. 4) and mCherry were started by the promoters pU6 and pCAG, respectively. The resulting plasmid was named AAV9-mCherry-anti-novel-miR-59.

[0166] Meanwhile, a control was set up to replace anti-novel-miR-59 (SEQ ID No. 4) with a nonsense sequence (CGCTGAGTACTTCGAAATGTC), and the resulting plasmid was named AAV9-mCherry-anti-Ctrl.

[0167] The obtained AAV9-mCherry-anti-novel-miR-59 plasmid and AAV9-mCherry-anti-Ctrl plasmid were introduced into HEK293T cells and packaged into viruses for later use.

[0168] Prepare virus in 100 μL PBS 5 × 10 11 vg is used for injection in mice.

[0169] (III) Mouse in vivo imaging

[0170] premature aging mouse Lmna G609G / G609G Eight days after birth, mice were injected with the AAV9 virus (anti-Ctrl or anti-novel-miR-59) prepared in step (II). Thirty days later, the mice were injected with sodium pentobarbital for anesthesia, their hair was shaved, and their dorsal and ventral sides were photographed using a mouse in vivo imaging system. Subsequently, various tissues were removed from the mice for further imaging.

[0171] (iv) Hematoxylin-eosin staining (H&E)

[0172] The tissue blocks and sections used in this experiment were prepared by Seville Biosciences. After perfusion of mice, tissue samples were taken from the heart, liver, lungs, kidneys, skin, aorta, brain, and muscles of premature aging mice.

[0173] (V) Masson staining

[0174] conventional methods

[0175] (vi) Weight monitoring

[0176] Weight monitoring was started in the fourth week after birth and measured weekly until the mice died (female and male mice were counted separately).

[0177] (vii) Mouse open field test

[0178] Each mouse was tested once. The mouse was placed in an open field and allowed to explore the environment freely. Data was recorded after the mouse adapted to the environment. Each mouse was tested for 20 minutes. Finally, the mouse's movement speed, distance and trajectory were statistically analyzed.

[0179] IV. Statistical Analysis

[0180] Data from each experiment were collected from at least three independent replicates and are expressed as mean ± standard deviation. Two-tailed t-tests were performed using GraphPad Prism software to analyze differences between groups. Mouse survival data were analyzed using the log-rank (Mantel-Cox) test. ns: no significant difference; *: P < 0.05, significant difference; **: P < 0.01; ***: P < 0.001, extremely significant difference.

[0181] III. Experimental Results and Analysis

[0182] (I) novel-miR-59 promotes HGPS cell senescence

[0183] 1. Increased expression of novel-miR-59 in HGPS cells

[0184] Hectic premature aging (HGPS) is a rare but deadly disease. To explore the molecular mechanisms of HGPS aging, we first constructed a lentiviral expression plasmid for progerin (pCDH-CMV-3xFlag-progerin-puro) and overexpressed progerin in CRL-1474 cells to simulate HGPS cellular senescence. The results showed that in CRL-1474 cells overexpressing progerin, the expression of cell cycle-related proteins Cyclin A2 and Lamin B1 was significantly reduced, and the level of the heterochromatin marker H3K9me3 was significantly decreased. Figure 1 (A). Furthermore, after 6 days of progerin overexpression, the proportion of cells positive for senescence-related SA-β-gal staining increased (…). Figure 1 If B), it means the model was successfully built.

[0185] HGPS cell senescence is accompanied by changes in epigenetic modifications, including aberrant miRNA expression. Studying miRNA changes in HGPS is crucial for elucidating the pathogenesis of HGPS and developing novel therapeutic strategies. To investigate the regulatory role of miRNAs in HGPS cell senescence, we performed miRNA sequencing on progerin-overexpressing simulated HGPS cells. The results revealed aberrant expression of multiple miRNAs, with two miRNAs downregulated and 20 miRNAs upregulated. Validation showed that the expression level of novel-miR-59 was significantly upregulated (…). Figure 1 (C). Furthermore, upregulated expression of novel-miR-59 was also detected in HGPS patient cells (HGAFDFN003 and HGAFDFN167). Figure 1 (D). The above experimental results indicate that progerin expression leads to differential expression of miRNAs, with increased expression levels of novel-miR-59, suggesting that this miRNA may play a role in the senescence process of HGPS cells.

[0186] 2. Anti-novel-miR-59 alleviates HGPS cell senescence phenotype

[0187] Does upregulation of novel-miR-59 expression promote HGPS cell senescence? We transfected patient cells with anti-novel-miR-59 and found that, compared to the control group, the proportion of HGPS patient cells with senescence-related SA-β-gal staining was reduced. Figure 2 In A), the proportion of Ki67-positive cells, a marker of cell proliferation in the cell nucleus, was significantly increased. Figure 2 (B) indicates that inhibiting novel-miR-59 has a mitigating effect on the senescence phenotype of HGPS cells.

[0188] To further confirm the role of novel-miR-59 in HGPS cell senescence, we overexpressed progerin in CRL-1474 cells and transfected them with anti-novel-miR-59 to inhibit its function. Compared with the progerin-expressing CRL-1474 cell group, the anti-novel-miR-59 group showed a decreased proportion of senescence-related SA-β-gal staining positivity. Figure 3 In A), the proportion of Ki67-positive cells, a marker of cell proliferation in the cell nucleus, was significantly increased. Figure 3 In addition, the expression of cell cycle-related protein Cyclin A2 and lamin B1 was upregulated (B). Figure 3(C). The above experimental results further demonstrate that inhibiting novel-miR-59 can alleviate the HGPS cell senescence phenotype mimicked by progerin expression.

[0189] (II) novel-miR-59 targets HMGAs genes in HGPS cells

[0190] 1. Anti-novel-miR-59 upregulates the expression of target genes HMGAs in cells of HGPS patients.

[0191] We found that inhibiting novel-miR-59 can alleviate the senescence phenotype of HGPS cells. To explore the molecular targets of novel-miR-59 in the senescence process of HGPS cells, we used Targetscan and miRanda software for joint bioinformatics analysis, predicting 867 target genes of novel-miR-59. Further functional analysis of these genes revealed that 7 of them are related to senescence. Figure 4 (A)

[0192] To further screen for target genes of novel-miR-59, we inhibited novel-miR-59 in HGPS patient cells and examined the mRNA levels of seven potential target genes. Interestingly, we found that the mRNA expression levels of HMGA family proteins HMGA1 and HMGA2 were significantly upregulated. Figure 4 (B). Consistent with this, the expression of HMGA1 and HMGA2 proteins was also upregulated. Figure 4 (C)

[0193] To further determine the regulatory relationship between novel-miR-59 and HMGAs in HGPS cells, we inhibited novel-miR-59 in progerin-overexpressing CRL-1474 cells. Compared with the progerin-expressing CRL-1474 cell group, the expression of HMGA1 and HMGA2 proteins and mRNAs was upregulated in the anti-novel-miR-59 group. Figure 5 (A and B in the middle). These experimental results indicate that novel-miR-59 can simultaneously target HMGA family proteins HMGA1 and HMGA2.

[0194] 2. Anti-novel-miR-59 increases HMGAs expression in healthy aged cells.

[0195] It has been reported that HMGAs cellular senescence is equivalent to an accelerated version of physiological aging. Therefore, does the expression of novel-miR-59 also increase in the cells of healthy elderly individuals, thereby inhibiting HMGAs expression? Detection revealed that, compared to normal cells, the expression of novel-miR-59 was upregulated in the cells of 88-year-old and 92-year-old patients. Figure 6 Similarly, we found that HMGA1 and HMGA2 expression was decreased in aged cells (A). Figure 6 (B and C). Following this, we inhibited novel-miR-59 in cells from 88-year-old elderly individuals and found that the aging markers Cyclin A2 and LaminB1 were upregulated ( Figure 6 The presence of D (indicated by the presence of D) suggests that cellular senescence is alleviated. Furthermore, inhibition of novel-miR-59 can also upregulate HMGAs mRNA and protein expression. Figure 6 (E and F). The above results suggest that inhibiting novel-miR-59 in physiologically senescent cells may alleviate physiological cellular senescence by targeting HMGAs.

[0196] 3. Identification of the targeting relationship between novel-miR-59 and HMGAs

[0197] To further investigate the targeting relationship between novel-miR-59 and HMGAs, we first used software to predict the interaction sites between novel-miR-59 and HMGAs. Figure 7 (A) An expression plasmid pmR-mCherry-novel-miR-59 containing the precursor novel-miR-59 sequence was constructed; plasmids pGL3-HMGA1-3'-UTR and pGL3-HMGA2-3'-UTR containing HMGA1 and HMGA2 3'UTR fragments that interact with novel-miR-59 were also constructed. Furthermore, the interaction sites between HMGAs 3'UTR and novel-miR-59 were mutated, resulting in plasmids pGL3-HMGA1-3'-UTR-mut and pGL3-HMGA2-3'-UTR-mut containing HMGA1 and HMGA2 3'UTR fragments with mutated binding sites, respectively. The purpose of these mutated plasmids was to interfere with the binding of novel-miR-59 to the target gene HMGAs. Next, a dual-fluorescence reporter assay was performed in HEK293 cells. The results showed that novel-miR-59 could inhibit the luciferase activity of HMGA1 and HMGA2 3′UTR, respectively, while novel-miR-59 could not inhibit the luciferase activity of the 3′UTR with mutations in the binding sites of HMGA1 and HMGA2. Figure 7(B). The above experiments demonstrate that novel-miR-59 can exert its effects by binding to the 3′UTR of HMGA1 or HMGA2 and targeting HMGAs.

[0198] (III) Inhibiting novel-miR-59 to alleviate Lmna G609G / G609G premature aging mouse aging phenotype

[0199] 1. Lmna G609G / G609G In premature aging mice, the expression levels of novel-miR-59 and Hmgas were negatively correlated.

[0200] Several drugs targeting miRNAs have entered clinical trials, demonstrating excellent therapeutic potential. Furthermore, based on the above results, we have confirmed that inhibiting novel-miR-59 can alleviate the senescence phenotype of HGPS cells. Therefore, can novel-miR-59 serve as a drug target for treating premature aging of HGPS cells? To clarify the effects of inhibiting novel-miR-59 on Lmna... G609G / G609G The therapeutic effect in premature aging mice: We established Lmna in ICR mice using CRISPR-Cas9 gene editing technology. G609G / G609G Premature aging mouse model ( Figure 8 (A) Real-time RT-PCR was used to detect novel-miR-59 in wild-type mouse Lmna. + / + and premature aging mice Lmna G609G / G609G The expression of Lmna was found to be lower than that of wild mice. G609G / G609G In premature aging mice, the expression of novel-miR-59 was upregulated in the heart, liver, lungs, kidneys, skin, and muscle tissue. Figure 8 (Middle B). Furthermore, the target genes Hmga1 and Hmga2 of novel-miR-59 are in Lmna G609G / G609G The mRNA levels in the heart, liver, lungs, and kidneys of prematurely aging mice were downregulated, indicating a negative correlation between novel-miR-59 and Hmgas. Figure 8 (C and D in the middle).

[0201] 2. AAV9-mCherry-anti-novel-miR-59 in Lmna G609G / G609G Expression in multiple tissues of premature aging mice

[0202] Adeno-associated virus (AAV) vectors possess advantages such as low pathogenicity, weak host immunogenicity, long-term stable expression, and broad cell and tissue specificity, making them a currently known delivery route that does not cause disease or trigger a major immune system response. Among them, the AAV9 adenovirus vector can be expressed in multiple tissues in vivo and is a viral vector tool for gene therapy. Therefore, we constructed an AAV9-mCherry-anti-novel-miR-59 adenovirus plasmid that inhibits novel-miR-59, where anti-novel-miR-59 and mCherry are initiated by U6 and pCAG, respectively. Figure 9 AAV9-mCherry-anti-novel-miR-59 adenovirus (Shanghai Jikai Gene) was obtained after viral packaging and purification. To determine viral expression in mice, we used Lmna... G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with PBS or AAV9-mCherry-anti-novel-miR-59 (viral titer of 5×10⁻⁶). 11 Mice were in vivo imaging experiments were conducted 30 days later to observe the distribution of AAV9-mCherry-anti-novel-miR-59 in different tissues. The results showed that AAV9-mCherry-anti-novel-miR-59 was abundant in the heart, spine, skin, muscle, kidney, and leg bone tissues. Figure 9 (B)

[0203] 3. Inhibiting novel-miR-59 improves Lmna G609G / G609G External morphology of premature aging mice

[0204] We are in Lmna G609G / G609G Eight days after birth, premature aging mice were intraperitoneally injected with either AAV9-mCherry-anti-Ctrl or AAV9-mCherry-anti-novel-miR-59 (5×10⁻⁶). 11 Mice were tested for external morphology after 12 weeks (vg / mouse). Compared with the control group, the treated mice were significantly larger, had less hair loss, and showed reduced rickets, appearing healthier. However, compared with wild-type mice, they were still smaller. Figure 10 (A and B). The above results indicate that inhibiting novel-miR-59 can improve Lmna to some extent. G609G / G609G External morphology of premature aging mice.

[0205] 4. Inhibits the increase of Lmna by novel-miR-59 G609G / G609G Weight loss and extended lifespan in prematurely aging mice

[0206] It has been reported that the body weight of HGPS premature aging mice decreases with age. We monitored the body weight of mice starting at week 4 after birth and found that the treatment group mice had a certain increase in body weight compared to the control group. Figure 11 (A and B) indicate that inhibiting novel-miR-59 can delay Lmna G609G / G609G Weight loss in premature aging mice. More importantly, the median survival rate of premature aging mice in the novel-miR-59 inhibition group increased by approximately 25.5%. Specifically, the median survival rates of premature aging mice in the control and treatment groups were 98 days and 123 days, respectively. Figure 11 In the middle stage (C), the mean survival increased from 99.5 days (standard deviation 9.09) to 123.4 days (standard deviation 10.68). The maximum survival increased from 118 days to 142 days. Based on these results, we conclude that inhibiting novel-miR-59 alleviates weight loss and prolongs survival in premature aging mice, suggesting that novel-miR-59 may be a promising new target for treating HGPS premature aging disease.

[0207] 5. Inhibiting novel-miR-59 improves Lmna G609G / G609G Physiological functions of premature aging mice

[0208] We have found that the lifespan of mice treated with novel-miR-59 is extended to some extent. Specifically, how does inhibiting novel-miR-59 improve the physiological functions of HGPS premature aging mice, thereby extending their lifespan? It has been reported that the motor function of HGPS premature aging mice declines. Could treatment with AAV9-mCherry-anti-novel-miR-59 improve the motor function of these mice? To verify our hypothesis, we tested the motor function of mice 12 weeks after viral injection. Compared with the control group, the treatment group showed a significant increase in movement distance. Figure 12 This indicates that inhibiting novel-miR-59 enhances Lmna G609G / G609G Motor ability of premature aging mice.

[0209] HGPS premature aging mice exhibit physiological defects such as subcutaneous fat loss, thinning of the epidermis, thickening of the vascular adventitia, and increased fibrosis in multiple tissues including the heart and muscles. Among these, subcutaneous fat loss and epidermal thinning are two age-related skin conditions. Therefore, we first investigated this in Lmna... G609G / G609G Twelve weeks after treatment, H&E staining was performed on the skin tissue of premature aging mice. The results showed that the treated mice exhibited reduced subcutaneous fat loss and increased epidermal thickness. Figure 13This indicates that AAV9-mCherry-anti-novel-miR-59 treatment significantly reduced the aging of skin tissue in premature aging mice. Next, we used Masson staining to examine the degree and thickness of adventitia in the blood vessels of HGPS premature aging mice. The results showed that, compared with the control group, the treated mice had a decreased degree of adventitia fibrosis and a thinner adventitia. Figure 14 This indicates that inhibiting novel-miR-59 has a certain salvage effect on vascular tissue degeneration in mice. Furthermore, we observed a certain degree of reduction in cardiac and muscle fibrosis in treated mice. Figure 15 The above results further demonstrate that inhibiting novel-miR-59 can improve physiological function in premature aging mice.

[0210] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. <110> Northeast Normal University <120> novel-miR-59 and its application in anti-aging therapy <130> GNCLN220983 <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> RNA <213> Artificial sequence <400> 1 cccucucucu cuccccccu 19 <210> 2 <211> 109 <212> RNA <213> Artificial sequence <400> 2 agauuuagac gaaggagag agauggcgggg agagccaca fuck fuck fuck 60 cgcuckoo cuckoo cuckoo 109 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 ccctctct ctccccct 19 <210> 4 <211> 19 <212> RNA <213> Artificial sequence <400> 4 Gagggagggagggggggg 19 <210> 5 <211> 107 <212> PRT <213> Artificial Sequence <400> 5 Met Glu Server Lys Serene Gln Ser Leu Ala Lys Ser Gln 1 5 10 15 Glu Lys Asp Gly Thr Glu Lys Arg Gly Arg Gly Arg Pro Arg Lys Gln 20 25 30 Pro Pro Val Ser Pro Gly Thr Ala Leu Val Gly Ser Gln Lys Glu Pro 35 40 45 Ser Glu Val Pro Thr Pro Lys Arg Pro Arg Gly Arg Pro Lys Gly Ser 50 55 60 Lys Asn Lys Gly Ala Ala Lys Thr Arg Lys Thr Thr Thr Thr Pro Gly 65 70 75 80 Arg Lys Pro Arg Gly Arg Pro Lys Lys Leu Glu Lys Glu Glu Glu Glu 85 90 95 Gly Ile Ser Gln Glu Ser Ser Glu Glu Glu Gln 100 105 <210> 6 <211> 109 <212> PRT <213> Artificial sequence <400> 6 Met Ser Ala Arg Gly Glu Gly Ala Gly Gln Pro Ser Thr Ser Ala Gln 1 5 10 15 Gly Gln Pro Ala Ala Pro Ala Pro Gln Lys Arg Gly Arg Gly Arg Pro 20 25 30 Arg Lys Gln Gln Gln Glu Pro Thr Gly Glu Pro Ser Pro Lys Arg Pro 35 40 45 Arg Gly Arg Pro Lys Gly Ser Lys Asn Lys Ser Pro Ser Lys Ala Ala 50 55 60 Gln Lys Lys Ala Glu Ala Thr Gly Glu Lys Arg Pro Arg Gly Arg Pro 65 70 75 80 Arg Lys Trp Pro Gln Gln Val Val Gln Lys Lys Pro Ala Gln Glu Glu 85 90 95 Thr Glu Glu Thr Ser Ser Gln Glu Ser Ala Glu Glu Asp 100 105 <210> 7 <211> 66 <212> DNA <213> Artificial sequence <400> 7 gactacaaag accatgacgg tgattataaa gatcatgaca tcgattacaa ggatgacgat 60 gacaag 66 <210> 8 <211> 324 <212> DNA <213> Artificial sequence <400> 8 atgagtgagt cgagctcgaa gtccagccag cccttggcct ccaagcagga aaaggacggc 60 actgagaagc ggggccgggg caggccgcgc aagcagcctc cggtgagtcc cgggacagcg 120 ctggtaggga gtcagaagga gcccagcgaa gtgccaacac ctaagagacc tcggggccga 180 ccaaagggaa gcaaaaacaa gggtgctgcc aagacccgga aaaccaccac aactccagga 240 aggaaaccaa ggggcagacc caaaaaactg gagaaggagg aagaggaggg catctcgcag 300 gagtcctcgg aggaggagca gtga 324 <210> 9 <211> 330 <212> DNA <213> Artificial sequence <400> 9 atgagcgcac gcggtgaggg cgcggggcag ccgtccactt cagcccagggg acaacctgcc 60 gccccagcgc ctcagaagg aggacgcggc cgccccagga agcagcagca agaccacc 120 ggtgagccct ctcctaagag acccagggga agacccaag gcagcaaaa accagtccc 180 tctaaagcag ctcaaagaa agcagaagcc actgagaaa aacggccaag aggcagacct 240 aggaaatggc cacacaagt tgttcagaag aagcctgctc agggagaac tgagagaca 300 tcctcacaag agtctgccga agaggactag 330 <210> 10 <211> 807 <212> DNA <213> Artificial Sequence <400> 10 cccatgcgtg ccgcctgctc ctcactggag gagcagctc cttctgggac tggacagctt 60 tgctccgctc caccgcccc caccccttcc catcaccacc gccctgcc 120 gccaccccca tcttccacct gtgccctcac caccacacta cacagcacac cagccgctgc 180 agggctccca tgggctgagt ggggagcagt ttcccctgg cctcagttcc cagctccccc 240 cgcccaccca cgcatacaca catgccctcc tggacaaggc taacaccca cttagccgca 300 ccctgcacct gctgcgtccc cactcccttg gtggtgggga cattgctctc tgggcttttg 360 gtttgggggc gccctctctg ctccttcact gttccctctg gcttcccata gtggggcctg 420 ggagggttcc cctggcctta aaaggggccc aagccccatc tcatcctggc acgccctact 480 ccactgccct ggcagcagca ggtgtggcca atggaggggg gtgctggccc ccaggattcc 540 cccagccaaa ctgtctttgt caccacgtgg ggctcacttt tcatccttcc ccaacttccc 600 tagtccccgt actaggttgg acagccccct tcggttacag gaaggcagga ggggtgagtc 660 ccctactccc tcttcactgt ggccacagcc cccttgccct ccgcctggga tctgagtaca 720 tattgtggtg atggagatgc agtcacttat tgtccaggtg aggcccaaga gccctgtggc 780 cgccacctga ggtgggctgg ggctgct 807 <210> 11 <211> 1222 <212> DNA <213> Artificial sequence <400> 11 gggtggggtg gggagaaatc acataacctt aaaaaggact atattaatca ccttctttgt 60 aatcccttca cagtcccagg tttagtgaaa aactgctgta aacacagggg acacagctta 120 180 gataagcaag agtgggcggg tgagaaaaac cgaattgggt ttagtcaatc actgcactgc 240 atgcaaacaa gaaacgtgtc acacttgtga cgtcgggcat tcatatagga agaacgcggt 300 gtgtaacact gtgtacacct caaataccac cccaacccac tccctgtagt gaatcctctg 360 tttagaacac caaagataag gactagatac tactttctct ttttcgtata atcttgtaga 420 cacttacttg atgattttta actttttat tctaaatgag acgaaatgct gatgtatcct 480 ttcattcagc taacaaacta gaaaaggtta tgttcatttt tcaaaaaggg aagtaagcaa 540 acaatattg ccaactcttc tatttatgga tatcacacat atcagcagga gtaataaatt 600 tactcacagc acttgttttc aggacaacac ttcattttca ggaaatctac ttcctacaga 660 gccaaaatgc catttagcaa taaataacac ttgtcagcct cagagcattt aggaaacta 720 gacaagtaaa attatcctct ttgtaattta atgaaaaggt acaacagaat aatgcatgat 780 gaactcacct aattatgagg tgggaggac gaaatctaaa tttcttttgc tatagttata 840 catcaattta aaaagcaaaa aaaaaaagg ggggggcaat ctctctctgt gtctttctct 900 ctctctcttc ctctccctct ctctttcat tgtgtatcag tttccatgaa agacctgaat 960 accacttacc tcaaattaag catatgtgtt acttcaagta atacgttttg acataagatg 1020 gttgaccaag gtgctttct tcggcttgag ttcaccatct cttcattcaa actgcacttt 1080 tagccagaga tgcaatatat ccccactact caatactacc tctgaatgtt acaacgaatt 1140 tacagtctag tacttattac atgctgctat acacaagcaa tgcaagaaaa aaacttactg 1200 ggtaggtgat tctaatcatc tg 1222

Claims

1. The application of substance A in the following (A1) or (A2): (A1) To prepare a drug for treating Hutchinson-Gilford progeria; (A2) To prepare drugs to alleviate or improve Hutchinson-Gilford progeria in children; The substance A can inhibit the function of mature novel-miR-59; The sequence of the mature novel-miR-59 is shown in SEQ ID No. 1; Substance A is the single-stranded RNA shown in SEQ ID No.

4.

2. Application of substance C in the preparation of cell or animal models that promote the occurrence and / or development of Hutchinson-Guilford progeria; The substance C is any one of the substances shown in (a1)-(a4) below: (a1) Mature novel-miR-59, the sequence of which is shown in SEQ ID No.1; (a2) The precursor novel-miR-59, the sequence of which is shown in SEQ ID No. 2; (a3) A DNA molecule encoding the mature novel-miR-59 described in (a1), the sequence of which is shown in SEQ ID No. 3, or a DNA molecule encoding the precursor novel-miR-59 described in (a2); (a4) An expression cassette, recombinant vector, or recombinant cell containing the DNA molecule described in (a3).

Images