PCR primer set, kit and method for rapidly identifying horse mackerel, broadfin catshark and their hybrid

Abstract

The application discloses a PCR primer group, a kit and a method for rapidly identifying horseface fish, broadfin catshark and their hybrid, and belongs to the technical field of molecular biology identification.The PCR primer group comprises a forward primer F and a reverse primer R;the PCR primer group is used for amplification; if the amplification product is a 162-172bp single band, the horseface fish is determined; if the amplification product is a 453-463bp single band, the broadfin catshark is determined; and if the amplification product is a 162-172bp and 453-463bp double band, the hybrid is determined.The application has the characteristics of rapidness, accuracy and high efficiency, makes up for the shortage of morphological identification, and is a reliable germplasm identification method.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology identification technology, specifically involving PCR primer sets, kits, and methods for rapid identification of chub, broadfin chub, and their hybrids. Background Technology

[0002] Mackerel ( Opsariichthysbidens ) and broadfin tuna ( ZaccoPlatpus These are two small fish species commonly found in the upper reaches of rivers and mountain streams. According to the latest classification of bony fishes, they belong to the genus *Opsariichthyinae* within the family Xenocyprididae of the order Cypriniformes. Opsariichthys ) and the genus Lepidoptera ( Zacco The Chinese minnow (Hylocereus undatus) is a small fish species endemic to and widely distributed in East Asia. Due to its tender and delicious flesh and high nutritional value, it has become increasingly popular with consumers in recent years, representing a popular stream-dwelling fish species for tourism in mountainous areas. Rapidly growing market demand has prompted aquaculture farmers and researchers to conduct research on the reproductive biology and artificial breeding techniques of the Chinese minnow, resulting in a sizable regional industry. Both the Chinese minnow and the male broadfin minnow possess vibrant colors and high ornamental value, making them emerging native ornamental fish species. Currently, some aquaculture farmers are conducting research on hybridization and breeding of the Chinese minnow and the broadfin minnow, aiming to cultivate new varieties with better production and aquaculture performance and ornamental advantages.

[0003] The rise of stream-dwelling fish has led to a rapid expansion of market demand for fingerlings of the Chinese sturgeon and the broadfin chub. Simultaneously, overfishing, river pollution, and dam construction have resulted in a sharp decline in the natural resources of the Chinese sturgeon. To conserve its germplasm resources, some provinces and cities have included it in their lists of fish stocking programs. Adult hybrids of the Chinese sturgeon and the broadfin chub exhibit significant morphological differentiation, with some resembling the Chinese sturgeon and others the broadfin chub, making identification difficult. At the fingerling stage, the distinction between the Chinese sturgeon, the broadfin chub, and their hybrids is even more challenging. However, the lack of effective methods for identifying the Chinese sturgeon, the broadfin chub, and their hybrids in stocking programs poses a serious vulnerability in germplasm security. There is also an urgent need for germplasm identification in aquaculture production.

[0004] Therefore, there is an urgent need to develop a technical solution for rapid identification of chub, broadfin chub and their hybrids. Summary of the Invention

[0005] To address the problems existing in the prior art, the present invention aims to design and provide a technical solution for rapidly identifying PCR primer sets, kits, and methods for *Sinocyclocheilus davidii*, *Sinocyclocheilus laevis*, and their hybrids. This invention involves whole-genome sequencing of *Sinocyclocheilus davidii* and *Sinocyclocheilus laevis*, and through bioinformatics techniques such as MISA, batch primer design, and electronic PCR, a batch of universal SSR primers showing significant differences in the length of amplification products between *Sinocyclocheilus davidii* and *Sinocyclocheilus laevis* were screened. Through batch verification with *Sinocyclocheilus davidii*, *Sinocyclocheilus laevis*, and their hybrids, rapid identification of these species has been achieved.

[0006] The present invention specifically adopts the following technical solution: The first aspect of the present invention provides a PCR primer set for rapid identification of chub, broadfin chub and their hybrids. The primer set includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No. 2.

[0007] A second aspect of the present invention provides a kit containing the above-described PCR primer set.

[0008] The third aspect of this invention provides the application of the above-mentioned PCR primer set or the above-mentioned kit in the rapid identification of chub, broadfin chub and their hybrids.

[0009] A fourth aspect of this invention provides a method for rapidly identifying chub, broadfin chub, and their hybrids, comprising the following steps: 1) Extract DNA from chub, broadfin chub, and their hybrids; 2) Using the DNA from step 1) as a template, perform PCR amplification using the above PCR primer set. After PCR amplification, detect the results using agarose gel electrophoresis. 3) If the amplification product is a single band of 162-172bp, it is identified as a chub; if the amplification product is a single band of 453-463bp, it is identified as a broadfin chub; if the amplification product is a double band of 162-172bp and 453-463bp, it is identified as a hybrid.

[0010] Furthermore, the PCR reaction system is as follows: concentration 50 ng·µL -1 0.5 µL of genomic DNA, 10 µL of 2×TaqPCR Mix, concentration 10 µmol·µL -1 0.8 µL each of the forward and reverse primers were added, and ddH2O was added to bring the total volume to 20 µL.

[0011] Furthermore, the PCR reaction conditions are as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; and finally, extension at 72℃ for 5 min.

[0012] This invention develops a rapid PCR primer set for identifying *Sinocyclocheilus davidii*, *Sinocyclocheilus fasciatus*, and their hybrids. Using this primer set and simple PCR amplification, *Sinocyclocheilus davidii*, *Sinocyclocheilus fasciatus*, and their hybrids can be rapidly identified, distinguishing them at the molecular level. This method is rapid, accurate, and efficient, overcoming the limitations of morphological identification and providing a reliable germplasm identification method. Attached Figure Description

[0013] Figure 1 The results are shown in the PCR electrophoresis test results in the example.

[0014] The image shows SSR results for 16 each of the following species: *Hemiberlesia lataniae*, *Hemiberlesia lataniae*, and their hybrids. The band for *Hemiberlesia lataniae* is around 166 bp, the band for *Hemiberlesia lataniae* is around 455 bp, and the hybrids show two bands. Detailed Implementation

[0015] The present invention will be further described below through specific embodiments, but the content of the present invention is not limited thereto.

[0016] Example 1: Genome sequencing of *Sinocyclocheilus roxburghii* and *Sinocyclocheilus fasciatus* Using female individuals of *Siniperca chuatsi* from the Qiantang River system as material, whole-genome sequencing was performed using the Pac Bio sequencing platform in CLR mode, supplemented by Hi-C sequencing chromosome mounting. The final genome of *Siniperca chuatsi* was 818.78 Mb in length, with an N50 value of 25.29 Mb, and 39 pairs of chromosomes were mounted. Using female individuals of *Siniperca chuatsi* collected from Luochuan, Xingtai, Haihe River Basin as material, whole-genome sequencing was performed using the Pac Bio sequencing platform in CLR mode, supplemented by Hi-C sequencing chromosome mounting. The final genome of *Siniperca chuatsi* was 814.87 Mb in length, with an N50 value of 32.32 Mb, and 24 pairs of chromosomes were mounted.

[0017] Example 2: Screening of SSR loci in chub The MISA software (https: / / webblast.ipk-gatersleben.de / misa / ) was used to screen the entire genome of *Gnaphalium affine* for SSRs according to the criteria of at least 8 repeats of dinucleotides, at least 6 repeats of trinucleotides and tetranucleotides, and at least 5 repeats of pentanucleotides and hexanucleotides. Two SSRs with a length less than 100 bp were considered as one SSR. The total number of SSRs in the *Gnaphalium affine* genome was 304,870, with a total SSR sequence length of 800,442 bp, accounting for 0.10% of the total genome length, and a total frequency of 372.35 SSRs per Mb. -1 The total density is 977.61 bp·Mb -1 .

[0018] Example 3: SSR primer design and e-PCR for chub 250 bp sequences were extracted upstream and downstream of each SSR locus. Batch primer design was performed using Primer3 (version: 2.5.0) software. The amplified fragment length was 150–250 bp, the primer size was 18–27 bp (optimal size 20 bp), the primer GC content was 35–45% (optimal 50%), and the TM temperature was 50–65℃ (optimal 57℃). Three primer pairs were designed for each SSR locus. The number of potential binding sites for the designed primers was detected using e-PCR software. Primers were successfully designed for 148,885 SSR loci, of which 117,332 loci had more than one specific primer.

[0019] Example 4: Universal screening of the genome of the broadfin chub using SSR primers from the chub. SSR primers screened from the *Hylocereus buergerianus* genome were used for e-PCR in the *Leptochloa crus-galli* genome. Primers that specifically amplified the *Leptochloa crus-galli* genome and whose amplified fragments also contained SSR sequences were identified. Ultimately, 102,241 pairs of universal SSR primers for both *Hylocereus buergerianus* and *Leptochloa crus-galli* were screened.

[0020] Example 5: Screening for SSR loci to identify *Hemiberlesia lataniae*, *Hemiberlesia lataniae* and their hybrids By comparing the e-PCR products of universal SSR primers for both *Hemiberlesia lataniae* and *Sinocyclocheilus fasciatus*, five primer pairs with amplification product length difference greater than 100 bp were manually screened. First, common primers were synthesized, and initial testing was performed using DNA from one fish each of *Hemiberlesia lataniae*, *Sinocyclocheilus fasciatus*, and a hybrid. The PCR reaction system consisted of genomic DNA (concentration 50 ng·µL). -1 0.5 µL of 2×Taq PCR Mix (Tiangen Biotech (Beijing) Co., Ltd.), 10 µL of forward and reverse primers (concentration 10 µmol·µL) -10.8 µL of each of the following were added, and ddH2O was added to bring the total volume to 20 µL. PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; final extension at 72℃ for 5 min, and storage at 4℃ for later use. 5 µL of the reaction product was examined by 1.5% agarose gel electrophoresis at 120V for 30 min, followed by gel imaging. Initial screening identified one suitable SSR identification site: repeat core (AC) 16, located on chromosome 3 of the Chinese mackerel, with start site 21681033 and stop site 21681064. Forward primer F: GGGTGTTTGACAGTTCACAC (SEQ ID No. 1), reverse primer R: GTCATCATTTCGCTGACCTG (SEQ ID No. 2). The amplified product size in the chub is approximately 166 bp, while the amplified product size in the broadfin chub is approximately 455 bp.

[0021] FAM-labeled fluorescent primers were further synthesized to examine the range of amplification products from multiple individuals. The amplification product type for 30 individuals of *Hemiberlesia lataniae* was 166 bp (162-172 bp); the amplification product type for 30 individuals of *Hemiberlesia lataniae* was 455 bp (453-463 bp).

[0022] Example 6: Accuracy test of identification of chub, broadfin chub and their hybrids Sixteen individuals each of *Hemiberlesia lataniae*, *Sinocyclocheilus fasciatus*, and their hybrids were collected from aquaculture farms. Genomic DNA was extracted from fin rays and standardized to 50 ng·µL. -1 PCR amplification and electrophoresis were performed on DNA samples from 48 tails. The PCR amplification, electrophoresis, and gel imaging conditions were the same as in Example 5. Figure 1 As shown, the amplification products of 16 *Hylocereus buergerianus* were single bands of approximately 166 bp, the amplification products of 16 *Cyprinus laevis* were single bands of approximately 455 bp, and the amplification products of the hybrids were double bands of approximately 166 bp and 455 bp. This locus demonstrates 100% accuracy in identifying *Hylocereus buergerianus*, *Cyprinus laevis*, and their hybrids.

[0023] This invention is not limited to the specific embodiments described above. The embodiments described above are merely for illustrating the use of this invention in detail, and production methods and technical details with equivalent functions are also part of this invention. In fact, those skilled in the art, based on the foregoing description, can find different adjustments according to their own needs, and these adjustments should all be within the scope of the appended claims.

Claims

1. The application of a PCR primer set in the identification of *Sinocyclocheilus davidii*, *Sinocyclocheilus davidii* and their hybrids, wherein the PCR primer set comprises a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.

2.

2. A kit for identifying *Siniperca chuatsi*, *Siniperca fasciatus*, and their hybrids, the kit containing a PCR primer set including a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F being shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer R being shown in SEQ ID No.

2.

3. A method for identifying *Sinocyclocheilus magna*, *Sinocyclocheilus fasciatus*, and their hybrids, characterized in that... Includes the following steps: 1) Extract DNA from chub, broadfin chub, and their hybrids; 2) Using the DNA from step 1) as a template, PCR amplification was performed using the PCR primer set. After PCR amplification, the results were detected by agarose gel electrophoresis. The PCR primer set includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.

2. 3) If the amplification product is a single band of 162-172bp, it is identified as a chub; if the amplification product is a single band of 453-463bp, it is identified as a broadfin chub; if the amplification product is a double band of 162-172bp and 453-463bp, it is identified as a hybrid.

4. The method as described in claim 3, characterized in that... The PCR reaction system was as follows: concentration 50 ng·µL -1 0.5 µL of genomic DNA, 10 µL of 2×Taq PCR Mix, concentration 10 µmol·µL -1 0.8 µL each of the forward and reverse primers were added, and ddH2O was added to bring the total volume to 20 µL.

5. The method as described in claim 3, characterized in that... The PCR reaction conditions were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; and a final extension at 72℃ for 5 min.

Images