An indel marker co-segregated with melon gummy stem blight resistance gene Gsb-2 and application thereof

Abstract

The application discloses an InDel molecular marker co-segregated with a melon gummy stem and leaf blight resistance gene Gsb-2, which is a nucleotide sequence fragment shown in SEQ ID NO:1. By constructing an F2 population, using a BSA method combined with whole genome resequencing, a melon gummy stem and leaf blight resistance trait is subjected to gene location, an InDel molecular marker is designed and developed at a site with polymorphism between two parents, and finally, a molecular marker co-segregated with the melon gummy stem and leaf blight resistance gene Gsb-2 is excavated, and a fragment amplified is co-segregated with the disease resistance trait. The molecular marker provided by the application can effectively and quickly distinguish melon gummy stem and leaf blight resistance and susceptibility single plants, improves the accuracy of melon gummy stem and leaf blight resistance phenotype identification, and can be used as an effective means for melon gummy stem and leaf blight resistance breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically involving an InDel molecular marker co-segregated with the melon vine blight resistance gene Gsb-2 and its application. Background Technology

[0002] Muskmelon (Cucumis melo L.) is an annual vine-like herbaceous plant belonging to the genus Cucumis in the family Cucurbitaceae. It is an important horticultural economic crop in my country and is widely cultivated worldwide. According to statistics from the Food and Agriculture Organization of the United Nations (FAOSTAT) database, from 2016 to 2020, the muskmelon planting area in my country increased from 35.13 × 10⁻⁶. 4 hm 2 Increased to 38.78×10 4 hm 2 China accounts for 36.29% of the global melon planting area. In 2020, my country's melon production reached 13.865 million tons, accounting for 48.7% of the global total.

[0003] Gummy stem blight (GSB) is one of the major fungal diseases affecting melons, widely occurring in both open-field and greenhouse cultivation, and its severity is increasing with the expansion of greenhouse cultivation areas. Gummy stem blight primarily affects the main vine, lateral vines, petioles, and leaves of melons. In the early stages of leaf infection, yellowish-brown "V"-shaped lesions appear on the leaf margins with indistinct concentric rings, eventually leading to the death of the entire leaf. At the base of the stem, the initial infection presents as elliptical, sunken lesions, which later gradually dry out and shrink, turning the epidermis grayish-white and prone to cracking. In severe cases, the entire plant wilts and dies due to water loss. Gummy stem blight seriously impacts the yield and quality of melons, limiting the development of the melon industry.

[0004] Anthracnose is a soil-borne fungal disease caused by *Didymella bryoniae*, a species of cucurbit fungus. The pathogen causing anthracnose in melons is *Stagonosporopsis cucurbitacearum*. The pathogen thrives in environments with temperatures of 20-28℃ and humidity of 50-90%, making it particularly prevalent in spring and autumn, and in greenhouses. In greenhouse-grown melons, the incidence rate can reach 60-80%. After completing one round of infection on the host plant, the anthracnose typically exists as mycelium, conidiophores, and ascothecia in host plant debris, seeds, and soil. Under suitable environmental conditions, it can continue to produce conidia, damaging the next crop. Anthracnose conidia can also be spread to other plants via wind, rain, and irrigation water, leading to reinfection and ultimately causing the disease to spread and worsen in the field. Applying chemical agents is currently the main method for controlling melon vine blight, but it is costly, causes significant environmental pollution, and can induce the emergence of new fungal strains. The extensive use of fungicides not only causes enormous pollution to the ecological environment but also accelerates the mutation of pathogens, leading to drug resistance. Understanding the resistance mechanism of melon vine blight, identifying resistance genes, and using these genes to breed resistant varieties is the safest, most economical, and most environmentally friendly measure for controlling melon vine blight.

[0005] With the continuous development of sequencing technology and molecular biology, molecular marker technology has advanced rapidly. Traditional breeding methods for transferring disease resistance traits are inefficient and have long breeding cycles. However, marker-assisted selection (MAG) breeding technology can overcome the limitations of traditional methods, significantly improving breeding efficiency and greatly reducing breeding costs. The precise mapping of melon vine blight resistance genes using molecular markers is of great significance for breeding high-quality disease-resistant melon varieties and accelerating the process of breeding vine blight-resistant varieties. Summary of the Invention

[0006] To address the problems of unstable phenotypic identification and time-consuming and labor-intensive selection of resistant materials in melon anthracnose resistance breeding, this invention provides a method for identifying the phenotypic resistance phenotype in melon anthracnose. In existing research, the resistant material 'PI157082' carries the dominant anthracnose resistance gene Gsb-2, but this gene has not yet been cloned and no InDel molecular marker co-segregating with it has been developed. The marker screened in this invention can effectively distinguish the anthracnose resistance of lines in segregating populations, providing a genetic tool for molecular breeding of melon anthracnose resistance and assisting in selection breeding.

[0007] One of the objectives of this invention is to provide an InDel molecular marker co-segregated with the melon vine blight resistance gene Gsb-2, named Gsb-2_InDel, whose nucleotide sequence is shown in SEQ ID NO.1, totaling 254 bp.

[0008] Specifically, the InDel molecular marker provided by this invention co-segregates with the melon vine blight resistance gene Gsb-2, which is located in the range of 2.73Mb-2.85Mb on chromosome 10.

[0009] A second objective of this invention is to provide primers capable of amplifying the InDel molecular marker, comprising an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3. These primers can be used for the breeding of melon vine blight resistant varieties.

[0010] A third objective of this invention is to provide the application of the InDel molecular marker and its primers in the identification of melon vine blight resistance phenotypes and variety breeding.

[0011] The fourth objective of this invention is to provide a kit for identifying the resistance phenotype of melon vine blight, the kit containing the aforementioned primers.

[0012] The fifth objective of this invention is to provide a method for identifying the resistance phenotype of melon vine blight and for variety breeding, the method comprising the following steps:

[0013] (1) Extract genomic DNA from the sample to be tested;

[0014] (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification with the primers described above;

[0015] (3) The amplification products obtained in step (2) are subjected to gel electrophoresis to identify the resistance of melon vine blight based on the band size.

[0016] The PCR amplification system consisted of 1 μL of upstream and downstream primers (10 μmol / L), 1 μL of DNA template (50-150 ng / μL), 4 μL of 2×TaqMasterMix (DyePlus), and ddH2O to a final volume of 10 μL.

[0017] The PCR reaction program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 34 cycles, 72℃ extension for 10 min, and storage at 4℃.

[0018] Specifically, the banding patterns of the PCR amplification products are recorded, and the resistance to melon vine blight is determined based on the fragment size. The determination principles are as follows:

[0019] (1) The molecular marker primers amplified bands with significantly different sizes in resistant and susceptible parents;

[0020] (2) When the molecular marker is amplified in the population, if a specific band of the same size as the resistant parent appears, that is, a fragment of 254 bp is amplified, then the strain is resistant to disease.

[0021] (3) When the molecular marker is amplified in the population, if only a specific band of the same size as the susceptible parent appears, that is, only a fragment of 237 bp is amplified, then the strain is susceptible.

[0022] The beneficial effects of this invention are:

[0023] 1. This invention addresses the current lack of molecular markers for melon anthracnose resistance. Our research team previously used the wild anthracnose-resistant resource 'PI157082' as the male parent and the susceptible variety 'Payzawat' as the female parent to obtain F1 cells. These F1 cells were then self-crossed to obtain multiple F2 populations. Using BSA combined with whole-genome resequencing, the anthracnose resistance gene Gsb-2 was located. Based on the parental resequencing data within the located region, a molecular marker co-segregating with anthracnose resistance was identified. This marker effectively distinguishes anthracnose resistance in the F2 populations. Furthermore, this is the first InDel marker co-segregating with the anthracnose resistance gene Gsb-2 both domestically and internationally.

[0024] 2. The molecular markers and their specific primers co-separated from the disease resistance gene obtained in this invention can be used for genotyping of melon materials to determine whether the materials have resistance to vine blight. The identification results are accurate and reliable, and can be used for early screening of melon vine blight resistant varieties, shortening the breeding cycle and improving breeding efficiency.

[0025] 3. PCR amplification results can be detected by polyacrylamide gel electrophoresis. The detection is convenient, rapid, accurate, simple and easy to perform, and can be carried out at high throughput without being affected by environmental factors. Attached Figure Description

[0026] Figure 1 These are the PCR amplification results of the molecular marker Gsb-2_InDel in the F2 population; where 1 represents the susceptible parent 'Payzawat', 2 represents the resistant parent 'PI157082' for melon vine blight, 3 represents an F1 generation single plant, and the following are F2 generation single plants. If the band is consistent with the resistant parent or the F1 generation single plant, it is resistant; if the band is consistent with the susceptible parent, it is susceptible.

[0027] Figure 2 The results show the PCR amplification of the molecular marker Gsb-2_InDel in susceptible and resistant single plants and the fragment size; where the marker is DL2000, 1 is the susceptible parent, 2 is the resistant parent, and 3 is the F1 generation single plant.

[0028] Figure 3This is a sequence alignment diagram showing the insertion mutation in the resistant parent 'PI157082' compared to the susceptible parent 'Payzawat'. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. All experimental operations involved in the embodiments are conventional techniques in the art. For parts not specifically described herein, those skilled in the art can refer to various commonly used reference books, scientific and technological literature, or relevant instructions and manuals for implementation. In this study, the susceptible parent 'Paywazat' is a local variety collected from Xinjiang, and the resistant parent 'PI157082' is a germplasm resource introduced from abroad and is currently preserved at the College of Horticulture and Forestry, Huazhong Agricultural University.

[0030] Example 1: InDel molecular marker co-isolated with the melon vine blight resistance gene Gsb-2

[0031] This embodiment provides an InDel molecular marker co-isolated with the melon vine blight resistance gene. The InDel molecular marker is Gsb-2_InDel, and the nucleotide sequence of the primer of this molecular marker is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0032] Forward primer: 5'-TAATGGGTTGCTTGCTCGAG-3' (SEQ ID NO.2)

[0033] Reverse primer: 5'-ATTTCACTCACCTCACCCGT-3' (SEQ ID NO.3)

[0034] The primer design method is as follows: Based on the candidate regions located by QTL-seq, InDel sites with insertion or deletion fragments greater than 5 bp in the initial localization region were selected. The tview command in Samtools software was used to check whether there were significant sequence differences at this site in the two parents (the resistant parent was the wild melon species PI157082, and the susceptible parent was the Xinjiang local variety Payzawat) and their offspring. The faidx command in Samtools software was used to extract the base sequence containing 200 bp before and after the InDel site from the reference genome. Primers were designed using the Primer3 online website (https: / / primer3.ut.ee / ), with primer lengths of 20-24 bp and PCR product sizes of 150-300 bp. m The value is between 52-57℃.

[0035] In this study, at the location of the InDel, the resistant parent underwent a 17bp base insertion mutation compared to the susceptible parent. Figure 3 .

[0036] InDel marker sequence of resistant parent:

[0037] >PI157082

[0038] TAATGGGTTGCTTGCTCGAGCTTATTTTCGACTTTTCTTGTACTATTTTCTTGAGATA

[0039] AATAAGTTAGTTTGGAGCATAATGAAGACGTGAGTATAATGAAGATGTTAAGAATG

[0040] TGTCATTATTCTACATGGGATGTTCCATAACAGCTACTAACATCTTGACTAATAATCA

[0041] CTAAATGTAATGATCATTTAAGACCTTGTTAGTCGACTATAATAACCAACTTAGAGC

[0042] TCCAAACGGGTGAGGTGAGTGAAAT

[0043] InDel marker sequence of infected parent:

[0044] Payzawat

[0045] TAATGGGTTGCTTGCTCGAGCTTATTTTCGACTTTTCTTGTACTATTTTCTTGAGATA

[0046] AATAAGTTAGTTTGGAGTATAATGAAGATGTTAAGAATGTGTCATTATTCTACATGG

[0047] GATGTTCCATAACAGCTACTAACATCTTGACTAATAATCACTAAATGTAATGATCATT

[0048] TAAGACCTTGTTAGTCGACTATAATAACCAACTTAGAGCTCCAAACGGGTGAGGTG

[0049] AGTGAAAT

[0050] Example 2: Screening of melon germplasm resources resistant to vine blight using InDel molecular markers co-segregated with Gsb-2.

[0051] The molecular marker Gsb-2_InDel from Example 1 was used to screen for melon germplasm resources resistant to anthracnose. The specific implementation method is as follows:

[0052] I. PCR amplification and electrophoresis detection

[0053] (1) Genomic DNA was extracted from the sample to be tested using the CTAB method;

[0054] (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the molecular marker-specific primers in Example 1. PCR amplification system: 1 μL upstream and downstream primers (10 μmol / L), 1 μL DNA template (50-150 ng / μL), 4 μL 2×TaqMasterMix (DyePlus), and ddH2O to a final volume of 10 μL. The PCR reaction program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 34 cycles, followed by a 10 min extension at 72℃, and storage at 4℃.

[0055] (3) The amplification products obtained in (2) were detected by electrophoresis using an 8% polyacrylamide gel at a voltage of 200V, a current of 200mA, a power of 36W, and an electrophoresis time of 80min. Finally, the gel was stained with silver using a 2% AgNO3 solution. The 8% polyacrylamide gel was prepared as follows: 24mL of 30% Acr-Bis (acrylamide-methylenebisacrylamide), 16mL of 5×TBE, 800μL of 10% APS (ammonium persulfate), and 64μL of TEMED coagulant, and then diluted to 80mL with ultrapure water.

[0056] II. F2 Group Construction

[0057] Payzawat, a local Xinjiang variety, was selected as the susceptible material. It is vigorous, produces large, high-quality fruit, but is susceptible to anthracnose. The wild melon variety 'PI157082', resistant to anthracnose, was selected. This variety produces small, sour, and astringent fruit with low edible value, but carries the dominant Gsb-2 gene for anthracnose resistance. In the early stages of the experiment, 'Payzawat' was used as the female parent and 'PI157082' as the male parent to obtain the F1 generation. The F1 generation was then self-crossed to obtain multiple F2 populations.

[0058] III. Validation of co-segregation between F2 population and InDel molecular marker

[0059] To verify the co-segregation relationship between the developed InDel molecular marker Gsb-2InDel and the melon vine blight resistance gene, population analysis was performed on the marker using the constructed F2 population. Figure 1 and Figure 2 The results showed that all phenotypes of disease-resistant lines in this population were consistent with those of the disease-resistant parents or F1 generation individual plants, i.e., a 254 bp fragment was present. All phenotypes of disease-susceptible lines were consistent with those of the disease-susceptible parents, i.e., only a 237 bp fragment was present. This population was the F2 population. This result indicates that the molecular marker is a co-dominant marker, capable of distinguishing between disease-resistant and disease-susceptible materials, and co-segregates with the melon anthracnose resistance gene Gsb-2. The molecular marker obtained by this invention can be applied to the auxiliary screening of resistant and susceptible individual plants in melon seedlings, overcoming the shortcomings of conventional disease resistance breeding, simplifying phenotypic identification methods, laying the foundation for molecular marker-assisted breeding of anthracnose resistance, and further accelerating the process of breeding anthracnose-resistant varieties.

Claims

1. A gene for resistance to melon vine blight Gsb-2 Co-separated InDel molecular markers, characterized by: The InDel molecular marker is the nucleotide sequence fragment shown in SEQ ID NO: 1, totaling 254 bp; the nucleotide sequence fragment shown in SEQ ID NO: 1 is associated with the vine blight resistance gene. Gsb-2 Co-separation.

2. A primer for amplifying the InDel molecular marker of claim 1, characterized in that: The primer consists of an upstream primer and a downstream primer, whose nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. The application of the InDel molecular marker as described in claim 1 in the identification of resistance phenotypes for melon vine blight, characterized in that: At the location of the InDel, the resistant parent underwent a 17 bp base insertion mutation relative to the susceptible parent. When this molecular marker is amplified in the population, if a specific band of the same size as the resistant parent appears, i.e., a fragment of 254 bp is amplified, then the melon plant phenotype is resistant; if only a specific band of the same size as the susceptible parent appears, i.e., only a fragment of 237 bp is amplified, then the melon plant phenotype is susceptible.

4. The application of the primers according to claim 2 in the identification of resistance phenotypes for melon vine blight, characterized in that: The genomic DNA of the sample to be tested was amplified by PCR using the primers, and the amplification products were detected by gel electrophoresis. If a specific band of the same size as the resistant parent appeared, that is, a fragment of 254 bp was amplified, then the melon plant phenotype was resistant; if only a specific band of the same size as the susceptible parent appeared, that is, only a fragment of 237 bp was amplified, then the melon plant phenotype was susceptible.

5. A kit for identifying resistance phenotypes in melon vine blight, the kit containing the primers as described in claim 2.

6. A method for identifying resistance phenotypes to melon vine blight, characterized in that... Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primers described in claim 2; (3) Perform gel electrophoresis on the amplification products obtained in step (2) to identify the resistance of melon vine blight according to the band size. If a specific band of the same size as the resistant parent appears, that is, a fragment of 254 bp is amplified, then the melon plant phenotype is resistant; if only a specific band of the same size as the susceptible parent appears, that is, only a fragment of 237 bp is amplified, then the melon plant phenotype is susceptible.

7. The method for identifying melon vine blight resistance phenotype as described in claim 6, characterized in that, The PCR amplification system consisted of: 1 µL of 10 μmol / L upstream and downstream primers, 1 µL of 50-150 ng / μL DNA template, and 2× Taq Add 4 μL of MasterMix and bring the total volume to 10 μL with ddH2O.

8. The method for identifying melon vine blight resistance phenotype as described in claim 6, characterized in that, The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 34 cycles, 72℃ extension for 10 min, and then stored at 4℃.

Images