A specific antibody targeting a PD-1 splice isoform

Abstract

The present application relates to a kind of specific antibodies of targeting PD-1 cleavage subtype, belong to molecular biology technical field.The present application provides antibody 2E5 and 13D4 capable of being specifically combined with PD-1 cleavage subtype PD-1 ^ 28, wherein the amino acid sequence of the variable region of the heavy chain of 2E5 is as shown in SEQ ID NO:11;The amino acid sequence of the variable region of the light chain of 2E5 is as shown in SEQ ID NO:12;The amino acid sequence of the variable region of the heavy chain of 13D4 is as shown in SEQ ID NO:13;The amino acid sequence of the variable region of the light chain of 13D4 is as shown in SEQ ID NO:14.The 2E5 antibody and 13D4 antibody of the present application are not combined with PD-1, but specifically combined with PD-1 ^ 28, and the 2E5 antibody and 13D4 antibody obtained by purification have good affinity to PD-1 ^ 28.

Description

Technical Field

[0001] This invention relates to a specific antibody targeting PD-1 cleavage subtypes, belonging to the field of molecular biology technology. Background Technology

[0002] Immune checkpoint therapy (ICT) is a treatment method that uses a series of pathways, such as co-inhibition or co-stimulatory signals, to regulate T cell activity and kill tumor cells. In recent years, ICT has been approved by the FDA for first-line treatment of some cancers, bringing new hope to cancer treatment (Chan et al., Immune Checkpoint Inhibitors: Basics and Challenges[J]. Current Medicinal Chemistry, 2017)(Peck-Radosavljevic S M. Immunotherapy for advanced hepatocellular carcinoma: a focus on special subgroups[J]. Gut: Journal of the British Society of Gastroenterology, 2021, 70(1).). Immune checkpoint inhibitors targeting CTLA-4, PD-1, and PD-L1 are widely used in clinical practice.

[0003] Programmed death molecule 1 (PD-1) is a type I transmembrane glycoprotein and an important negative regulator in the immune response. Under normal conditions, PD-1 inhibits the function of T lymphocytes by binding to its ligands PD-L1 and PD-L2, thereby suppressing the autoimmune response. Tumor cells express both PD-1 and its ligand PD-L1. The binding of PD-1 on the surface of T cells to PD-L1 on tumor cells can prevent the immune killing effect of T cells on tumor cells, thus leading to immune tolerance and promoting the immune escape of tumor cells (L. Zitvogel et al., Targeting PD-1 / PD-L1 interactions for cancer immunotherapy. OncoImmunology 1, 1223–1225, 2012)(Freeman GJ. et al., Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J Exp Med 1927:1027-1034, 2000).

[0004] The direct function of PD-1 / PD-L1 immune checkpoint inhibitors is to eliminate the inhibitory signal between T cells and tumor cells, namely the binding of PD-1 and PD-L1. Immune checkpoint inhibitors, such as anti-PD-1 and anti-PD-L1 antibodies, have been used to treat a variety of human tumors, including melanoma, renal cell carcinoma, NSCLC, and Hodgkin's lymphoma. Studies have shown that despite the widespread use of PD-L1 as a favorable biomarker, the response rate of patients to anti-PD-1 / PD-L1 drugs is still only about 20% to 40%. Most patients do not respond to PD-1 / PD-L1 monoclonal antibody therapy, experience hyperprogression, or develop drug resistance (Wang X. et al., Tumor cell-intrinsic PD-1 receptor is a tumor suppressor and mediates resistance to PD-1 blockade therapy[J]. Proceedings of the National Academy of Sciences 117(12): 201921445, 2020)(Lei Q et al., Resistance Mechanisms of Anti-PD1 / PDL1 Therapy in Solid Tumors[J]. Frontiers in Cell and Developmental Biology, 2020, 8)(Sun JY et al., Resistance to PD-1 / PD-L1 blockade cancer immunotherapy: mechanisms, predictive factors, and future perspectives[J]. Biomarker Research, 2020, 8(1)).

[0005] Different types of tumors exhibit differences in cancer type and tumor heterogeneity. For example, PD-1 expression in tumor cells such as melanoma, liver cancer, and bladder cancer promotes tumor progression, while PD-1 expression in tumors such as non-small cell lung cancer and colon cancer shows anti-tumor effects (J. Schachter et al., Pembrolizumab versus ipilimumab for advanced melanoma: Finaloverall survival analysis of KEYNOTE-006. J. Clin. Oncol. 34(suppl. 15), 9504, 2016)(SM Ansell et al., PD-1 blockade with nivolumab in relapsed or refractory Hodgkin's lymphoma. N. Engl. J. Med. 372, 311–319, 2015)(SF Kammerer-Jacquet et al., Targeting the PD-1 / PD-L1 pathway in renal cell carcinoma. Int. J. Mol. Sci. 20, E1692(2019))(NARizvi et al., Activity and safety of Nivolumab, an anti-PD-1 immune checkpoint inhibitor for patients with advanced, refractory squamous non-small-cell lung cancer (CheckMate 063): Aphase 2, single-arm trial. Lancet Oncol. 16, 257–265 (2015). PD-1 molecular heterogeneity may be due to transcriptomic variations resulting from alternative splicing, leading to different PD-1 splice isoforms that perform different functions.Previous studies have shown that PD-1 splice variants include PD-1Dex2, PD-1Dex3, PD-1Dex2,3, PD-1Dex2,3,4 and Δ42PD-1 (Nielsen, C. et al., Alternative splice variants of the human PD-1 gene. Cell Immunol 235:109–116 (2005))(Zhou, J. et al., Potentiating Functional Antigen-specific CD8+T Cell Immunity by a Novel PD1 Isoform-based Fusion DNA Vaccine. Molecular Therapy 21.7:1445-1455 (2013)). In rheumatoid arthritis, PD-1 and PD-1Dex3 antagonize synovial T cell activation (Wan, B. et al., Aberrant regulation of synovial T cell activation by soluble costimulatory molecules in rheumatoid arthritis. Journal of Immunology 177:8844–8850 (2006)). Hepatocellular carcinoma (HCC) contains an alternative splice subtype of PD-1, Δ42PD-1. Unlike PD-1, Δ42PD-1 does not exert its biological function through interaction with PD-L1 / L2. Monoclonal antibodies targeting PD-1 and Δ42PD-1 cannot recognize each other, thus the efficacy of PD-1 antibodies in treating Δ42PD-1-mediated cancers is very limited (Tan Z. et al., Isoformic PD-1-mediated immunosuppression underlies resistance to PD-1 blockade in hepatocellular carcinoma patients. Gut. Nov 30:gutjnl-2022-327133(2022)). Therefore, in-depth research on PD-1 splice subtypes may be very helpful in understanding the resistance mechanisms of PD-1 / PD-L1 therapy. Developing specific PD-1 antibodies targeting different PD-1 splice subtypes could further improve the efficacy of PD-1 antibodies. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides an antibody that specifically binds to a PD-1 cleavage isotype. The antibody comprises a heavy chain variable region and a light chain variable region. The PD-1 cleavage isotype is PD-1^28, and the amino acid sequence of PD-1^28 is shown in SEQ ID NO: 23. The amino acid sequence of the heavy chain variable region comprises HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3. The amino acid sequence of the light chain variable region comprises LCDR1, LCDR2 as shown in SEQ ID NO: 4, and LCDR3 as shown in SEQ ID NO: 5. The amino acid sequence of LCDR2 is RMS; or...

[0007] The amino acid sequence of the heavy chain variable region includes HCDR1 as shown in SEQ ID NO: 6, HCDR2 as shown in SEQ ID NO: 7, and HCDR3 as shown in SEQ ID NO: 8, and the amino acid sequence of the light chain variable region includes LCDR1, LCDR2 as shown in SEQ ID NO: 9, and LCDR3 as shown in SEQ ID NO: 10, wherein the amino acid sequence of LCDR2 is YTS.

[0008] In one embodiment of the present invention, the amino acid sequence of the heavy chain variable region is SEQ ID NO: 11 or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 11; or,

[0009] The amino acid sequence of the heavy chain variable region is SEQ ID NO: 13 or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 13.

[0010] In one embodiment of the present invention, the amino acid sequence of the light chain variable region is SEQ ID NO: 12 or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 12; or,

[0011] The amino acid sequence of the light chain variable region is SEQ ID NO: 14 or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 14.

[0012] The present invention also provides a biomaterial, said biomaterial being any one of (a) to (g) below:

[0013] (a) A nucleic acid molecule encoding the heavy chain variable region of the aforementioned antibody;

[0014] (b) Nucleic acid molecules encoding the light chain variable region of the aforementioned antibodies;

[0015] (c) An expression cassette containing one or more of the nucleic acid molecules described in (a) to (b);

[0016] (d) A recombinant vector containing one or more of the nucleic acid molecules described in (a) to (b), or a recombinant vector containing the expression cassette described in (c);

[0017] (e) A recombinant host cell containing one or more combinations of the nucleic acid molecules described in (a) to (b), or a recombinant host cell containing the expression cassette described in (c), or a recombinant host cell containing the recombinant vector described in (d).

[0018] In one embodiment of the present invention, the nucleic acid molecule encoding the heavy chain variable region of the above-mentioned antibody has a nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 15; or,

[0019] Its nucleotide sequence is SEQ ID NO: 17 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 17.

[0020] In one embodiment of the present invention, the nucleic acid molecule encoding the aforementioned heavy chain variable region has a nucleotide sequence that is SEQ ID NO: 19 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 19; or,

[0021] Its nucleotide sequence is SEQ ID NO: 21 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 21.

[0022] In one embodiment of the present invention, the nucleic acid molecule encoding the aforementioned light chain variable region has a nucleotide sequence that is SEQ ID NO: 16 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 16; or,

[0023] Its nucleotide sequence is SEQ ID NO: 18 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 18.

[0024] In one embodiment of the present invention, the nucleic acid molecule encoding the aforementioned light chain variable region has a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 20; or,

[0025] Its nucleotide sequence is SEQ ID NO: 22 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 22.

[0026] The present invention also provides for the use of the above-described antibody and / or the above-described biological material in any one of (a) to (d):

[0027] (a) Application in the detection of PD-1 protein containing PD-1^28 or in the preparation of products for the detection of PD-1 protein containing PD-1^28;

[0028] (b) Application in the preparation of products for binding PD-1 protein containing PD-1^28;

[0029] (c) Use in mediating the specific recognition of a drug on tumors expressing PD-1 antigen containing PD-1^28 or in the preparation of a product that mediates the specific recognition of a drug on tumors expressing PD-1 antigen containing PD-1^28;

[0030] (d) Use in in vivo imaging of PD-1 protein containing PD-1^28 or in the preparation of products for in vivo imaging of PD-1 protein containing PD-1^28.

[0031] The present invention also provides a method for preparing the above-mentioned antibody, the method comprising: constructing a recombinant expression vector containing the above-mentioned nucleic acid molecule; introducing the recombinant expression vector into a host cell to obtain a recombinant cell expressing the antibody; culturing the recombinant cell and obtaining the antibody by separation and purification.

[0032] The technical solution of this invention has the following advantages:

[0033] This invention provides antibodies 2E5 and 13D4 that specifically bind to the PD-1 cleavage subtype PD-1^28. The antibodies comprise heavy chain variable regions and light chain variable regions. The amino acid sequence of the heavy chain variable region of 2E5 is shown in SEQ ID NO: 11, containing HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3. The amino acid sequence of the light chain variable region of 2E5 is shown in SEQ ID NO: 12, containing LCDR1, LCDR2(RMS) as shown in SEQ ID NO: 4, and LCDR3 as shown in SEQ ID NO: 5. The amino acid sequence of the heavy chain variable region of 13D4 is shown in SEQ ID NO: 13, containing HCDR1 as shown in SEQ ID NO: 6, HCDR2 as shown in SEQ ID NO: 7, and HCDR3 as shown in SEQ ID NO: 8. The amino acid sequence of the light chain variable region of 13D4 is shown in SEQ ID NO: 14, containing LCDR1, LCDR2(YTS) as shown in SEQ ID NO: 9, and LCDR3 as shown in SEQ ID NO: 11. The LCDR3 shown in NO:10. Western blotting analysis showed that neither 2E5 nor 13D4 binds to PD-1, but specifically binds to PD-1^28. Enzyme-linked immunosorbent assay (ELISA) analysis showed that the purified 2E5 chimeric antibody and 13D4 chimeric antibody have good affinity for PD-1^28, and the affinity of the 2E5 antibody is superior to that of the 13D4 antibody. Attached Figure Description

[0034] Figure 1 Characterization results of PD-1^28.

[0035] Figure 2 : ΔPD-1^28HisTrap HP chromatography column purification diagram.

[0036] Figure 3 : ΔPD-1^28 purification diagram using Surpdex200 molecular sieve (lanes 1 and 2 represent the reduced and non-reduced states of ΔPD-1^28, respectively).

[0037] Figure 4 : Graph of Protein G chromatography purification of 2E5 mouse antibody.

[0038] Figure 5 Image of Protein A chromatographic column purification of 2E5 chimeric antibody.

[0039] Figure 6 : Graph of purification of 13D4 mouse antibody Protein G column.

[0040] Figure 7: Graph of purification of 13D4 chimeric antibody Protein A by chromatography column.

[0041] Figure 8 Image of 2E5 mouse antibody purified by Surpdex200 molecular sieve (lanes 1 and 2 are the reduced and unreduced states of 2E5 mouse antibody, respectively).

[0042] Figure 9 Image of 2E5 chimeric antibody purified by Surpdex200 molecular sieve (lanes 1 and 2 represent the reduced and unreduced states of the 2E5 chimeric antibody, respectively).

[0043] Figure 10 Image of 13D4 murine antibody purified by Surpdex200 molecular sieve (lanes 1 and 2 represent the reduced and unreduced states of 13D4 murine antibody, respectively).

[0044] Figure 11 Image of 13D4 chimeric antibody purified by Surpdex200 molecular sieve (lanes 1 and 2 represent the reduced and unreduced states of the 13D4 chimeric antibody, respectively).

[0045] Figure 12 : Specific binding diagram of 2E5 and 13D4 antibodies to ΔPD-1^28.

[0046] Figure 13 Affinity assay of 2E5 and 13D4 antibodies for ΔPD-1^28. Detailed Implementation

[0047] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.

[0048] For any experimental steps or conditions not specified in the following examples, the procedures or conditions described in the literature in this field can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0049] Experimental Example 1: A PD-1 shear subtype

[0050] This embodiment provides a PD-1 shear subtype, which is obtained through the following steps:

[0051] Step 1: Amplify PDCD1 in peripheral blood mononuclear cells (purchased from Shanghai Junxing Biotechnology Co., Ltd.) from healthy individuals. At a concentration of 10... 7Add Trizol Reagent (Takara-RNAiso Plus, 9109) to each mL of cell lysate at a ratio of 10 cells / mL. Mix thoroughly by inverting 10 times. Incubate at room temperature (25°C) for 15 min to obtain cell lysate. Add 200 μL of chloroform to each mL of cell lysate. Mix thoroughly by inverting 10 times. Incubate at room temperature (25°C) for 5 min, then on ice for 5 min. Centrifuge at 12000 rpm for 15 min at 4°C to obtain layered cell lysate. Take the aqueous phase of the layered cell lysate, add an equal volume of isopropanol, mix thoroughly by inverting 10 times. Incubate at room temperature (25°C) for 5 min, then on ice for 5 min. Centrifuge at 12000 rpm for 15 min at 4°C. Discard the supernatant, add 1 mL of 75% ethanol prepared with DEPC water, mix well, centrifuge at 7500 rpm for 5 min at 4°C, discard the supernatant, air dry at room temperature (25°C), and add 50 μL of chloroform. After dissolving the DEPC in water and measuring the RNA concentration using a Nanodrop 2000, the RNA was placed on ice for later use. Genomic DNA removal and reverse transcription were performed on the ice-placed RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A) to obtain cDNA samples, which were then stored at -20°C.

[0052] Step 2: Using cDNA as a template, amplify the PDCD1 gene using the forward primer shown in SEQ ID NO: 24 (AACTGGTACCGCATGAGCCC) and the reverse primer shown in SEQ ID NO: 25 (TCCAGCTCCCCATAGTCCACAG) (PDCD1 gene information obtained from NCBI).

[0053] When PDCD1 is amplified from peripheral blood mononuclear cells of healthy individuals, it will be as follows: Figure 1 The amplification product shown in A was ligated into the T vector and sequenced. One clone was found to retain the first 28 bp of the second intron in the second and third exons of PDCD1. This clone was named PD-1^28 (amino acid sequence as shown in SEQ ID NO: 23, nucleotide sequence as shown in SEQ ID NO: 33). Sequence alignment is as follows: Figure 1 B, sequencing peak diagram as shown Figure 1 C. Based on the sequencing results, a schematic diagram of the nucleic acid sequence of this splicing subtype was obtained. Figure 1 D) and protein sequence diagram ( Figure 1 E), based on protein sequence pattern diagrams ( Figure 1E) It is known that PD-1^28 has 107 amino acids that are different from PD-1 at the carboxyl terminus (C-terminus), which is the unique amino acid sequence of PD-1^28. This unique amino acid sequence is named ΔPD-1^28 (SEQ ID NO: 31).

[0054] Example 1: Obtaining nucleic acid molecules encoding antibodies that specifically bind to the PD-1 cleavage subtype PD-1^28

[0055] This embodiment provides the acquisition of nucleic acid molecules encoding antibodies that specifically bind to the PD-1^28 cleavage subtype, including the following steps:

[0056] Step 1: Construct the nucleotide sequence (SEQ ID NO: 32) corresponding to the PD-1^28-specific amino acid sequence ΔPD-1^28 into the pET-21a vector (ALMI Bio, LM-1197) to obtain a truncated PD-1^28 (ΔPD-1^28) expression vector (ΔPD-1^28 is tagged with MBP to enhance ΔPD-1^28 expression);

[0057] Step 2: The obtained ΔPD-1^28 expression vector monoclonal strain was cultured in LB medium containing ampicillin (final concentration 0.1 mg / L) (37℃, 180 rpm shaking culture). When the OD value reached 0.6, IPTG (final concentration 1 mmol / L) was added, and the culture was incubated at 37℃, 180 rpm shaking culture for 4 h to obtain the culture medium. The culture medium was centrifuged (6500 rpm, 10 min), the cell pellet was collected, and dissolved in PBS. The cells were then sonicated, purified by HisTrap HP chromatography column (GE, 17524801) and Superdex 200 molecular sieve (GE, 28-9893-35). The purification diagram of the HisTrap HP chromatography column is shown in the figure. Figure 2 As shown, the Superdex200 purification graph is as follows: Figure 3 As shown; ΔPD-1^28 was induced by immunizing Balb / c mice with specific antibodies by GenScript, and after cell fusion, screening, and identification, 13D4 and 2E5 hybridoma cells were delivered.

[0058] Step 3: Following the method in Step 1 of Experiment Example 1, total RNA was extracted from 13D4 and 2E5 hybridoma cells using the Trizol method;

[0059] Step 4: Using the RNA obtained in Step 3, synthesize the first strand of cDNA with a universal reverse transcription kit (Taq enzyme-free M-MLV type, Solarbio, Cat. No. RP1105) and the primers required for heavy chain amplification as shown in SEQ ID NO: 26 (ACAGGGATCCAGAGTTCC) or the primers required for light chain amplification as shown in SEQ ID NO: 27 (GCACCTCCAGATGTTAACTG), to obtain a reverse transcription product containing cDNA; using the reaction system described in Table 1, incubate at 37℃ for 15 min and then at 70℃ for 10 min to obtain a product containing dG-tailed cDNA, and store on ice for later use;

[0060] Table 1. PCR reaction system

[0061]

[0062] Step 5: Using the reaction system described in Table 2, after reacting at 94℃ for 5 min, start cycling (1 min at 94℃, 1 min at 63℃, 1 min at 72℃). After 33 cycles, react at 72℃ for 10 min and at 4℃ for 5 min to obtain PCR products. Among them, the primer sequence for IgH-2 is the heavy chain amplification primer shown in SEQ ID NO: 28 (CAGTGGATAGACAGATGGGGGTGTCGTTTTGGC), the primer sequence for IgK-2 is the light chain amplification primer shown in SEQ ID NO: 29 (GATGGTGGGAAGATGGATAC), and the nucleotide sequence of primer 3 is the primer shown in SEQ ID NO: 30 (CCCCCCCCCCCCCCC).

[0063] Table 2. PCR reaction system

[0064] <![CDATA[ddH2O]]> 28μL 5×Trans Start@pfu Buffer 10μL pfu DNA Polymerase 1μL Primer 2 (IgK-2 / IgH-2) 1μL Primer 3 1μL Products containing dG-tailed cDNA 5μL 2.5m dNTPs 4μL total 50μL

[0065] Step 6: Identify the PCR products by 1.5% agarose gel electrophoresis. Cut the specific band at approximately 500 bp from the gel and recover the target fragment using an agarose DNA rapid purification kit. Ligate the fragment into the pClone007 vector and transform it into competent E. coli Top10 cells. The ligation reaction system is shown in Table 3. Ligate at 25℃ for 5 min. Add 600 μL of medium to the transformed competent E. coli Top10 cells and incubate at 37℃ for 1 h in a shaker. Then, plate the cells onto LB agar plates containing ampicillin and incubate at 37℃ for 12 h. Pick at least 10 single colonies and perform PCR verification using specific primers.

[0066] Table 3. Connection Reaction System

[0067] pClone007 Blunt Simple Vector 1μL Gel recovery target fragment 5 μL (10–50 ng) 10×Top mix 1μL Water 3μL

[0068] Step 7: Select clones that are double-positive by PCR verification and have them sequenced by Qingke Company;

[0069] Step 8: Align the sequenced sequences with known sequences in NCBI's GenBank to determine the coding sequences of the leader peptide and the variable region.

[0070] The nucleotide sequence of the nucleic acid molecule encoding the heavy chain variable region of 2E5 is shown in SEQ ID NO: 15; the nucleotide sequence of the nucleic acid molecule encoding the light chain variable region of 2E5 is shown in SEQ ID NO: 16; the nucleotide sequence of the nucleic acid molecule encoding the heavy chain variable region of 13D4 is shown in SEQ ID NO: 17; and the nucleotide sequence of the nucleic acid molecule encoding the light chain variable region of 13D4 is shown in SEQ ID NO: 18.

[0071] Homologous recombination technology was used to optimize the nucleotide sequences of the above-mentioned nucleic acid molecules according to the codon preference of human antibodies, resulting in codon-optimized nucleic acid molecules. Specifically, the nucleotide sequence of the heavy chain variable region of the codon-optimized nucleic acid molecule encoding 2E5 is shown in SEQ ID NO: 19, and the nucleotide sequence of the light chain variable region of the codon-optimized nucleic acid molecule encoding 2E5 is shown in SEQ ID NO: 20; the nucleotide sequence of the heavy chain variable region of the codon-optimized nucleic acid molecule encoding 13D4 is shown in SEQ ID NO: 21, and the nucleotide sequence of the light chain variable region of the codon-optimized nucleic acid molecule encoding 13D4 is shown in SEQ ID NO: 22.

[0072] Example 2: Antibody specifically binding to PD-1^28 cleavage subtype

[0073] This embodiment provides an antibody that specifically binds to the PD-1 cleavage subtype PD-1^28. The nucleotide molecule described in Example 1 encodes the antibody. The CDR region and FR region of the variable region are distinguished using NCBI IgBlast.

[0074] The amino acid sequence of the heavy chain variable region of 2E5 is shown in SEQ ID NO: 11, consisting of HCDR1 as shown in SEQ ID NO: 1 (GVNIKDTY), HCDR2 as shown in SEQ ID NO: 2 (IDPANGNT), and HCDR3 as shown in SEQ ID NO: 3 (WITTSFAY); the amino acid sequence of the light chain variable region of 2E5 is shown in SEQ ID NO: 12, consisting of LCDR1 and LCDR2 as shown in SEQ ID NO: 4 (KSLLHSNGNTY), and LCDR3 as shown in SEQ ID NO: 5 (MQHLEYPLT), wherein the amino acid sequence of LCDR2 is RMS;

[0075] The amino acid sequence of the heavy chain variable region of 13D4 is shown in SEQ ID NO: 13, consisting of HCDR1 as shown in SEQ ID NO: 6 (GYTFTEYT), HCDR2 as shown in SEQ ID NO: 7 (INPNNGDN), and HCDR3 as shown in SEQ ID NO: 8 (ARDGHYDEDMAMDY); the amino acid sequence of the light chain variable region of 13D4 is shown in SEQ ID NO: 14, consisting of LCDR1 and LCDR2 as shown in SEQ ID NO: 9 (QDISNY), and LCDR3 as shown in SEQ ID NO: 10 (QQFSKLPFT), wherein the amino acid sequence of LCDR2 is YTS.

[0076] Experimental Example 2: Methods for Antibody Expression and Purification

[0077] This experimental example provides a method for antibody expression and purification. The nucleotide sequence of the heavy chain variable region of the codon-optimized nucleic acid molecule encoding 2E5 or 13D4 from Example 1 is inserted into the expression plasmid pCAGGS (Aidi Gene, VT1076) of the human-mouse chimeric antibody gene using EcoRI and KpnI to obtain a complete chimeric heavy chain sequence expression vector. Similarly, the nucleotide sequence of the light chain variable region of the codon-optimized nucleic acid molecule encoding 2E5 or 13D4 from Example 1 is inserted into the expression plasmid pCAGGS of the human-mouse chimeric antibody gene using EcoRI and KpnI to obtain a complete chimeric light chain sequence expression vector.

[0078] 293F cells (purchased from the Cell Bank of the Chinese Academy of Sciences) were passaged in SMM 293-TII medium (Sino Biological, M293TII). 300 mL of cells were used to achieve a cell density of 1×10⁻⁶ cells / mL. 6293F cells per mL were added to a conical shake flask and cultured at 37°C and 5% CO2 for 24 h for transfection; 900 μg of [unspecified ingredient] was added to the [unspecified ingredient]. PEI (Yeasen, 40816ES03) was added to 7.5 mL of 150 mM NaCl, vortexed to mix, and incubated at room temperature (25℃) for 5 min to obtain the PEI solution. 300 μg of plasmids expressing 2E5 or 13D4 chimeric antibodies (the mass ratio of the chimeric antibody heavy chain sequence expression plasmid to the light chain sequence expression plasmid was 1:1) was added to 7.5 mL of 150 mM NaCl, vortexed to mix, and the resulting plasmid solution was obtained. The PEI solution was slowly added dropwise to the plasmid solution at a rate of 2 drops / second, and the mixture was inverted 10 times to mix thoroughly. After incubation at room temperature (25℃) for 15 min, 293F cell culture medium was added, and the cells were cultured at 37℃ and 5% CO2 for 5 days. The 293F cell culture medium co-incubated with the plasmids was collected and purified. SMS 293-SUPI Expression Medium Supplement (Sino) was added at 24 h and 72 h of culture, respectively. Biological (SMS 293-SUPI). 13D4 and 2E5 hybridoma cells were cultured, and the supernatant was collected. The obtained chimeric antibody expression supernatant and hybridoma supernatant were used for purification. The antibody was purified using a HisTrap protein A / G HP column and a Superdex 200 molecular sieve. The purification process is as follows:

[0079] Add 300 mL of chimeric antibody expression supernatant or hybridoma supernatant to a centrifuge tube and centrifuge at 4 °C and 6500 rpm for 30 min. Collect the supernatant and filter it through a 0.22 μM microporous membrane to remove cellular impurities. Purify the chimeric antibody expression supernatant using a pretreated HisTrapprotein A HP column (GE, 17040301) and the hybridoma supernatant using a pretreated Protein G column (GE, 17040401) (pretreatment conditions: wash with 3 column volumes of ddH2O, then equilibrate with 5 column volumes of PBS buffer). Pass the centrifuged and filtered chimeric antibody expression supernatant or hybridoma supernatant through the column at a flow rate of 2 mL / min, wash with PBS buffer, and collect in 5 mL centrifuge tubes (generally containing contaminating proteins). After UV leveling, use 100 mM... The target protein was eluted with glycine (BioFroxx, 1275GR500) at pH 2.7, and collected in 5 mL centrifuge tubes. 400 μL / tube of 100 mM Tris (Soleil, T8060) neutralization buffer at pH 9 was added beforehand. The purification results are as follows: Figures 4-7 As shown.

[0080] After eluting the target protein with glycine obtained from concentration using a 30KD ultrafiltration tube (Millipore, UFC 903096), further purification was performed using a Superdex 200 molecular sieve (GE, 28-9893-35). The target protein was collected, and 20 μL of the target protein was added to a 5× protein loading solution with or without DTT for sample preparation. SDS-PAGE was used to determine the molecular weight and purity of the target protein. The purification results are as follows: Figures 8-11 As shown.

[0081] Experimental Example 3: Specific binding of purified 2E5 and 13D4 antibodies to ΔPD-1^28

[0082] This experimental example uses the protein purified by HisTrap protein A / G HP column and Superdex 200 molecular sieve obtained in Experiment 2 as the test sample. Western blotting was used to detect the binding of purified 2E5 and 13D4 antibodies to ΔPD-1^28 and PD-1, including the following steps:

[0083] Step 1: Equal amounts of Con (laboratory-expressed pike protein-c His as a control), PD1 (Sinochem, 10377-H08H), and ΔPD-1^28 were loaded for SDS-PAGE separation and transfer to a membrane. The entire process was carried out in an ice-water mixture. 5% skim milk powder was used for blocking at room temperature (25℃) for 2 hours. Anti-His-tag mAb-HRP-DirecT (MBL, D291-7), 2E5, and 13D4 mouse or chimeric antibodies were added and incubated at 4℃ for 12 hours. The membrane was washed three times with TBST for 10 minutes each time. HRP Goat Anti-Human IgG (H+L) (ABclonal, AS002) or HRP Goat Anti-Mouse IgG (H+L) was added and incubated at room temperature (25℃) for 1 hour. The membrane was washed three times with TBST for 10 minutes each time. Finally, the membrane was placed in a chemiluminescence imaging system for exposure.

[0084] Depend on Figure 12 It can be seen that the 2E5 mouse antibody, 2E5 chimeric antibody, 13D4 mouse antibody, and 13D4 chimeric antibody do not bind to the negative control and PD-1, but specifically bind to ΔPD-1^28. This indicates that the variable region sequence of the PD-1^28 mouse monoclonal antibody was amplified, and the 2E5, 13D4 mouse antibodies and chimeric antibodies have the ability to specifically bind to ΔPD-1^28.

[0085] Experimental Example 4: Affinity detection of 2E5 and 13D4 for ΔPD-1^28

[0086] This example provides the affinity detection of 2E5 and 13D4 for ΔPD-1^28 using enzyme-linked immunosorbent assay (ELISA). ΔPD-1^28 was added at 100 ng / well to a 96-well plate and coated at 4°C for 16 h. After coating, the plate was washed with 1% PBST (150 μL / well, 2 min / wash, 3 times). 1% BSA prepared with PBST was added at 100 μL / well, and the plate was blocked at 37°C for 1 h. The plate was then washed with 1% PBST (150 μL / well, 2 min / wash, 3 times). The protein purified using a HisTrap protein A / G HP column and Superdex 200 molecular sieve, as well as the 2E5 chimeric antibody (2E5Chimeric) and the 2E5 murine antibody (2E5) obtained in Experiment 2 were diluted with PBS buffer. Mouse antibody (13D4) was initially diluted 6.25 μg / mL, with 18 serial dilutions of 2-fold, as the experimental group. 1% BSA prepared with PBST was used as the blank control. Chimeric 13D4 antibody and mouse 13D4 antibody (13D4 Mouse) were initially diluted 400 μg / mL, with 18 serial dilutions of 2-fold. 100 μL / well of the blank control and experimental group were added to each well of a 96-well plate and incubated at 37°C for 1 h. The plates were then washed with 1% PBST (150 μL / well, 2 min / wash, 5 washes) to obtain ΔPD-1^28 coated with the primary antibody. HRP Goat Anti-Human IgG (H+L) (ABclonal, AS002) was added as a secondary antibody at the site where the chimeric antibody was added as the primary antibody, and HRP Goat Anti-Mouse antibody was added as a secondary antibody at the site where the mouse antibody was added as the primary antibody. IgG(H+L) (Bio-Easy, BE0102) was added as a secondary antibody. The secondary antibody and TBST were mixed at a ratio of 1:8000, and 100 μL / well was added to each well of a 96-well plate. For the blank control, 100 μL / well of HRP Goat Anti-Human IgG(H+L) or HRP Goat Anti-Mouse IgG(H+L) (3 replicates each) was added to each well. The plate was incubated at 37°C for 1 h, then washed with 1% PBST (150 μL / well, 2 min / wash, 5 washes). 100 μL / well of TMB chromogenic buffer (Beyotime, PO209-500 ml) was added, and after 5 min of development, 50 μL / well of stop buffer (Beyotime, C1058-500 ml) was added. The OD450 value was measured using a microplate reader. Affinity test results are shown in Table 4 and [Table data would be inserted here]. Figure 13 .

[0087] From Table 4 and Figure 13It can be seen that compared with the 13D4 mouse antibody, the affinity of the 13D4 chimeric antibody is significantly reduced (EC50 of 13D4 Mouse is 5.316 μg / mL, i.e., 35.44 nM; EC50 of 13D4 Chimeric is 423.45 μg / mL, i.e., 2.82 uM). This may be because the FR region affects the affinity, or the sequence affecting affinity after modification is not in the FR region but in the constant region. Although the constant region of the antibody does not participate in antigen complementation binding, it is still extremely important for the spatial structure of the antibody. The affinity of the 2E5 chimeric antibody is almost unchanged compared with the mouse chimeric antibody, maintaining a high affinity (EC50 of 2E5 Mouse is 0.023 μg / mL, i.e., 0.153 nM; EC50 of 2E5 Chimeric is 0.038 μg / mL, i.e., 0.253 nM). In summary, the affinity of the 2E5 antibody is superior to that of the 13D4 antibody.

[0088] Table 4. Statistical Analysis Results of ELISA Affinity Test

[0089] EC50 (μg / mL) 0.023 0.038 5.316 423.45

[0090] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. An antibody that specifically binds to a PD-1 cleavage subtype, characterized in that, The PD-1 cleavage isotype is PD-1^28, and the amino acid sequence of PD-1^28 is shown in SEQ ID NO: 23; the antibody comprises a heavy chain variable region and a light chain variable region, and the antibody is named 13D4 or 2E5; the amino acid sequences of HCDR1, HCDR2, and HCDR3 in the heavy chain variable region of antibody 2E5 are shown in SEQ ID NO: 1-SEQ ID NO: 3, respectively, and the amino acid sequences of LCDR1 and LCDR3 in the light chain variable region of antibody 2E5 are shown in SEQ ID NO: 4-SEQ ID NO: 5, respectively, and the amino acid sequence of LCDR2 in the light chain variable region of antibody 2E5 is RMS; The amino acid sequences of HCDR1-HCDR3 in the heavy chain variable region of antibody 13D4 are shown in SEQ ID NO: 6-SEQ ID NO: 8, respectively, and the amino acid sequences of LCDR1 and LCDR3 in the light chain variable region of antibody 13D4 are shown in SEQ ID NO: 9-SEQ ID NO: 10, respectively. The amino acid sequence of LCDR2 in the light chain variable region of antibody 13D4 is YTS.

2. The antibody as described in claim 1, characterized in that, The amino acid sequence of the heavy chain variable region of antibody 2E5 is an amino acid sequence that has at least 80% identity with SEQ ID NO: 11 and has the same function; the amino acid sequence of the heavy chain variable region of antibody 13D4 is an amino acid sequence that has at least 80% identity with SEQ ID NO: 13 and has the same function.

3. The antibody as described in claim 1 or 2, characterized in that, The amino acid sequence of the light chain variable region of antibody 2E5 is an amino acid sequence that has at least 80% identity with SEQ ID NO: 12 and has the same function; the amino acid sequence of the light chain variable region of antibody 13D4 is an amino acid sequence that has at least 80% identity with SEQ ID NO: 14 and has the same function.

4. A biomaterial, characterized in that, The biological material is any one of (a) to (d) below: (a) A nucleic acid encoding the antibody of any one of claims 1 to 3, the nucleic acid comprising a nucleic acid molecule encoding the heavy chain variable region of the antibody of any one of claims 1 to 3 and a nucleic acid molecule encoding the light chain variable region of the antibody of any one of claims 1 to 3; (b) An expression cassette containing the nucleic acid described in (a); (c) A recombinant vector containing the nucleic acid described in (a), or a recombinant vector containing the expression cassette described in (b); (d) A recombinant host cell containing the nucleic acid described in (a), or a recombinant host cell containing the expression cassette described in (b), or a recombinant host cell containing the recombinant vector described in (c).

5. The biomaterial as described in claim 4, characterized in that, The nucleotide sequence of the nucleic acid molecule encoding the heavy chain variable region of antibody 2E5 is a nucleotide sequence that has at least 80% identity with SEQ ID NO: 15 and has the same function, or a nucleotide sequence that has at least 80% identity with SEQ ID NO: 19 and has the same function. The nucleotide sequence of the nucleic acid molecule encoding the heavy chain variable region of the antibody 13D4 is a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO: 17 or a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO:

21.

6. The biomaterial according to any one of claims 4 to 5, characterized in that, The nucleotide sequence of the nucleic acid molecule encoding the light chain variable region of the antibody 2E5 is a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO: 16 or a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO: 20; The nucleotide sequence of the nucleic acid molecule encoding the light chain variable region of the antibody 13D4 is a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO: 18 or a nucleotide sequence that has at least 80% identity with and has the same function as SEQ ID NO:

22.

7. The use of the antibody according to any one of claims 1 to 3 or the biological material according to any one of claims 4 to 6 in any one of (a) to (c): (a) Application in the preparation of products for the detection of PD-1 protein containing PD-1^28; (b) Use in the preparation of products for binding PD-1 protein containing PD-1^28; (c) Use in the preparation of products for in vivo imaging of PD-1 protein containing PD-1^28.

8. The method for preparing the antibody according to any one of claims 1 to 3, characterized in that, The method includes: culturing the recombinant host cell of claim 4 and then separating and purifying it to obtain the antibody.

Images