Application of tRF-54:75-Ala-AGC-2-M2 as a marker and a diagnostic product for retinopathy of prematurity

Abstract

The application discloses application of tRF-54:75-Ala-AGC-2-M2 as a marker and a premature infant retinopathy diagnosis product. The application proves that the tRF-54:75-Ala-AGC-2-M2 level of a premature infant retinopathy patient is significantly reduced, and there is a significant difference with a normal control. The tRF-54:75-Ala-AGC-2-M2 can be used as a biomarker for diagnosing premature infant retinopathy in clinic, and can be used for diagnosing and differentiating premature infant retinopathy patients. Moreover, the tRF-54:75-Ala-AGC-2-M2 level can be lowered to construct a premature infant retinopathy model.

Description

Technical Field

[0001] This application relates to the field of medical technology, and in particular to the application of tRF-54:75-Ala-AGC-2-M2 as a biomarker and diagnostic products for retinopathy of prematurity. Background Technology

[0002] Retinopathy of prematurity (ROP), a significant neonatal disease, has become a major concern for improving the survival rate of premature infants. Severe ROP cases can lead to long-term vision loss, and ROP has been proven to be one of the leading causes of childhood blindness. Therefore, there is an urgent need to address a range of issues related to the diagnosis and treatment of ROP. The diagnosis of ROP is usually determined through fundus screening using binocular indirect ophthalmoscopy or wide-field digital retinal imaging systems (such as the RetCam digital retinal camera). However, these screening methods are inefficient, have a high rate of misdiagnosis, and the criteria for determining whether ROP patients require treatment are sometimes not objective. Therefore, it is crucial to explore biomarkers with high sensitivity and specificity for the diagnosis and prognosis of ROP. Summary of the Invention

[0003] This invention provides the application of tRF-54:75-Ala-AGC-2-M2 as a biomarker and a diagnostic product for retinopathy of prematurity, in order to solve the technical problem of low efficiency in existing screening methods.

[0004] This study found that the expression level of tRF-54:75-Ala-AGC-2-M2 was suppressed in retinopathy of prematurity.

[0005] This invention provides the application of tRF-54:75-Ala-AGC-2-M2 as a marker in the preparation of diagnostic products for retinopathy of prematurity.

[0006] This invention also provides the application of the reagent for detecting tRF-54:75-Ala-AGC-2-M2 in the preparation of diagnostic products for retinopathy of prematurity.

[0007] The reagents for detecting tRF-54:75-Ala-AGC-2-M2 provided by this invention include detection primers for tRF-54:75-Ala-AGC-2-M2 or chips for detecting tRF-54:75-Ala-AGC-2-M2.

[0008] Furthermore, the detection primers for tRF-54:75-Ala-AGC-2-M2 include primer pairs as shown in SEQ ID NO.2 to 3.

[0009] The present invention also provides a diagnostic product for retinopathy of prematurity, comprising the above-mentioned reagent for detecting tRF-54:75-Ala-AGC-2-M2.

[0010] Furthermore, diagnostic products for retinopathy of prematurity also include total RNA extraction reagents, reverse transcription reagents, and qRT-PCR detection reagents.

[0011] This invention also provides the application of tRF-54:75-Ala-AGC-2-M2 as a target in constructing a retinopathy of prematurity model.

[0012] Furthermore, the retinopathy of prematurity model is an animal model or a cell model.

[0013] The reagents provided by this invention for constructing a retinopathy of prematurity model include one or more of the following: reagents that knock out or knock down tRF-54:75-Ala-AGC-2-M2, reagents that reduce the activity of tRF-54:75-Ala-AGC-2-M2, and substances that increase the level or activity of tRF-54:75-Ala-AGC-2-M2 inhibitors.

[0014] This invention provides a method for constructing a retinopathy of prematurity (ROP) model, wherein the method involves treating the infant with the reagents described above for constructing an ROP model to reduce the level or activity of tRF-54:75-Ala-AGC-2-M2.

[0015] This invention demonstrates that the tRF-54:75-Ala-AGC-2-M2 level is significantly reduced in patients with retinopathy of prematurity (ROP) and shows a significant difference compared to normal controls. Clinically, it can be used as a biomarker for the diagnosis and differential diagnosis of ROP. Furthermore, downregulating the tRF-54:75-Ala-AGC-2-M2 level can be used to construct a model of ROP. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1Principal component analysis (PCA) plots of small RNA sequencing of PBMC samples from the control group (Control) and the treatment group (Treatment) are shown. The samples within the two groups show a clustering trend, and the samples between the two groups are completely distinguishable. The differences within the groups are small, while the differences between the groups are large, making the two groups comparable.

[0018] Figure 2 The Venn diagram shows the comparison between tsRNAs obtained from small RNA sequencing and known tsRNAs in the tRFdb database; blue represents small RNA sequencing analysis, red represents the tRFdb database, and the cross region represents the sequencing analysis that yielded a total of 602 tsRNAs, of which 95 are known tsRNAs.

[0019] Figure 3 Volcano plot showing differentially expressed tsRNAs in PBMCs of preterm infants with retinopathy of prematurity; in the figure, green lines divide the corresponding log2 (fold change) and -log10 (P-value), with fold change up or down ≥1.5-fold and P<0.05; red represents 44 significantly upregulated tsRNAs and green represents 81 significantly downregulated tsRNAs.

[0020] Figure 4 A heatmap generated from hierarchical clustering analysis of differentially expressed tsRNA in PBMCs of patients with retinopathy of prematurity; color-coded markers show the relative expression levels of tsRNA in different samples, with red representing upregulation and blue representing downregulation.

[0021] Figure 5 The results of qRT-PCR amplification of PBMC target tsRNA are shown; the data in the figure are presented as mean ± SD (Control: n1 = 5, ROP: n2 = 5). P<0.05 P<0.01 P<0.001; Figure 6 The results of qRT-PCR amplification of tRF-54:75-Ala-AGC-2-M2 using an expanded validation sample set (Control: n1 = 26, ROP: n2 = 30) are shown in the figure; data are presented as mean ± SD. P<0.05 P<0.01, P<0.001.

[0022] Figure 7 The ROC curve of tRF-54:75-Ala-AGC-2-M2 is shown; the AUC is 0.8795, and the P value is 0.0001. Detailed Implementation

[0023] To enable those skilled in the art to better understand the technical solutions in this application, the technical solutions in the embodiments of this application will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this application, and not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0024] This application provides the application of tRF-54:75-Ala-AGC-2-M2 as a biomarker and a diagnostic product for retinopathy of prematurity. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this application. The methods and applications of this application have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this application to implement and apply the technology of this application.

[0025] Transfer RNA (tRNA) is a linker molecule that decodes mRNA and translates proteins. tsRNA (tRNA-derived small RNA) is a novel class of small non-coding RNAs, 18–40 nucleotides in length, derived from precursor or mature tRNA. Studies have shown that tsRNA plays important roles in cell proliferation, gene expression, RNA processing, regulation of DNA damage, tumor suppression, and neurodegeneration. tsRNA exhibits high stability in circulating body fluids and is present in a higher proportion (up to 70%) than miRNA, making it a potential biomarker for detecting various clinical diseases.

[0026] The tsRNA provided in this application is used as a biomarker in the preparation of diagnostic products for retinopathy of prematurity (ROP). This is of great significance for the detection of ROP. The molecular marker used for the early diagnosis of ROP is tRF-54:75-Ala-AGC-2-M2. Studies in this application have found that the expression level of tRF-54:75-Ala-AGC-2-M2 is inhibited in ROP.

[0027] The tRF-54:75-Ala-AGC-2-M2 tRNA has two tRNA sources because the same sequence appears in certain parts of different tRNA transcripts, corresponding to tRNA-Ala-AGC-2-1 and tRNA-Ala-AGC-3-1, respectively. Their full names are transferRNA: Alanine-AGC 2-1 and tRNA-Ala (anticodon AGC) 3-1. The former is the standard tRF & tiRNA ID, derived from the NCBI official full gene name (https: / / www.ncbi.nlm.nih.gov / gene / 3771884, https: / / www.ncbi.nlm.nih.gov / gene / 100189299), and the latter is the NCBI official gene symbol. The sequence of tRF-54:75-Ala-AGC-2-M2 is shown in SEQ ID NO.1: TCATCCCCGGCACCTCCACCA.

[0028] This application also provides the application of the reagent for detecting tRF-54:75-Ala-AGC-2-M2 in the preparation of diagnostic products for retinopathy of prematurity.

[0029] The diagnostic products described above can be used for the early diagnosis of retinopathy of prematurity. In some embodiments, the diagnostic products may be diagnostic reagents, diagnostic tools, and / or diagnostic kits, which are not limited by the present invention.

[0030] The reagents for detecting tRF-54:75-Ala-AGC-2-M2 provided in this application include detection primers for tRF-54:75-Ala-AGC-2-M2 or chips for detecting tRF-54:75-Ala-AGC-2-M2.

[0031] The reagents for detecting tRF-54:75-Ala-AGC-2-M2 provided in this application embodiment are used to detect samples by PCR or isothermal amplification. The PCR methods mentioned above include conventional PCR, as well as RT-qPCR, qRT-PCR, or real-time quantitative PCR. Isothermal amplification includes LAMP, ERA, NERA, NASBA, RCA, HAD, or RPA. The target of the PCR or isothermal amplification can be tRF-54:75-Ala-AGC-2-M2, or the product obtained from the transcription of tRF-54:75-Ala-AGC-2-M2, which can be full-length or a partial fragment; this application does not limit this.

[0032] In some embodiments, the detection primers for tRF-54:75-Ala-AGC-2-M2 include primer pairs as shown in SEQ ID NO. 2 to 3. Specifically, the sequence shown in SEQ ID NO. 2 is: CTACAGTCCGACGATCTCAATCC, and the sequence shown in SEQ ID NO. 3 is: TCCGATCTTGGTGGAGGTGC.

[0033] The chip used in this application embodiment for detecting tRF-54:75-Ala-AGC-2-M2 can carry the above-mentioned primers, or it can carry other substances that can be used to detect tRF-54:75-Ala-AGC-2-M2. This application does not limit this.

[0034] The diagnostic product for retinopathy of prematurity provided in this application includes the reagents described above for detecting tRF-54:75-Ala-AGC-2-M2.

[0035] In some embodiments, diagnostic products for retinopathy of prematurity also include total RNA extraction reagents, reverse transcription reagents, and qRT-PCR detection reagents.

[0036] The total RNA extraction reagent used in this application is a total RNA extraction reagent from peripheral blood mononuclear cells (PBMCs). In some embodiments, the total RNA extraction uses the TRIZOL method.

[0037] In this embodiment, the diagnostic product for retinopathy of prematurity (ROP) uses qRT-PCR to determine whether a sample originates from a ROP patient based on the expression level of ROP. The sample is peripheral blood mononuclear cells. The diagnostic product in this embodiment is an auxiliary diagnostic method for ROP patients requiring treatment. Specifically, it includes: taking a peripheral blood PBMC sample from the test subject, performing qRT-PCR detection using U6 as an internal control, and using a tRF-54:75-Ala-AGC-2-M2 / U6 ratio of 0.0008075 as the cutoff value. If this ratio is below the cutoff value, the test subject is considered a high-risk group for ROP requiring treatment, and further confirmation using methods such as fundus examination is recommended.

[0038] The expression level of tRF-54:75-Ala-AGC-2-M2 in patients with retinopathy of prematurity was significantly lower than that in normal controls. Therefore, knocking down or eliminating tRF-54:75-Ala-AGC-2-M2, downregulating its expression, or inhibiting its activity can be used to construct a retinopathy of prematurity model.

[0039] This application provides the application of tRF-54:75-Ala-AGC-2-M2 as a target in constructing a retinopathy of prematurity (ROP) model. The aforementioned ROP model can be an animal model or a cell model.

[0040] This application provides reagents for constructing a retinopathy of prematurity model, including one or more of the following: reagents that knock out or knock down tRF-54:75-Ala-AGC-2-M2, reagents that reduce the activity of tRF-54:75-Ala-AGC-2-M2, and substances that increase the level or activity of tRF-54:75-Ala-AGC-2-M2 inhibitors.

[0041] In the embodiments of this application, the reagents for knocking down or eliminating tRF-54:75-Ala-AGC-2-M2 can be reagents used for transfecting or transforming cells, and this application is not limited to any particular reagent. The reagents that reduce the activity of tRF-54:75-Ala-AGC-2-M2 in the embodiments of this application can downregulate the activity of tRF-54:75-Ala-AGC-2-M2 or inhibit tRF-54:75-Ala-AGC-2-M2. Substances that increase the level or activity of tRF-54:75-Ala-AGC-2-M2 inhibitors can be small molecule compounds or can be overexpressed or activated by genetic engineering methods. This application is not limited to any particular substance.

[0042] The method for constructing a retinopathy of prematurity model in the embodiments of this application involves treating the infant with the above-mentioned reagents to reduce the level or activity of tRF-54:75-Ala-AGC-2-M2.

[0043] This application demonstrates through research that the tRF-54:75-Ala-AGC-2-M2 level is significantly reduced in patients with retinopathy of prematurity (ROP) and shows a significant difference compared to normal controls. Clinically, it can be used as a biomarker for the diagnosis and differential diagnosis of ROP. Furthermore, downregulating the tRF-54:75-Ala-AGC-2-M2 level can construct a model of ROP.

[0044] All reagents used in the following examples are commercially available. The invention is further illustrated below with reference to the examples.

[0045] Example 1: Establishment of tsRNA expression profile in retinopathy of prematurity (ROP) infants 1. Sample collection: This study has been approved by the Ethics Committee of the Second Xiangya Hospital of Central South University and complies with the purposes of the Declaration of Helsinki. Informed consent was obtained from the guardians of the participants, and the nature of the study and its possible consequences were explained. A total of 66 preterm infants were enrolled in this study. Based on fundus examination, 35 infants were diagnosed with retinopathy of prematurity (ROP) requiring further treatment (5 screening cases, 30 validation cases), such as intravitreal injection of anti-VEGF drugs and laser photocoagulation. The experimental group was included according to the International Classification of Retinopathy of Prematurity (ICCROP) criteria (ICCROP, 2021). For ethical reasons, to avoid additional blood draws, peripheral blood PBMC samples from the control group were collected during the last blood draw before leaving the NICU. Exclusion criteria included: 1. Infectious diseases such as HIV, syphilis, hepatitis, or cytomegalovirus infection; 2. Major systemic diseases such as congenital metabolic diseases, blood diseases, etc.; 3. Congenital cataracts, glaucoma, defects, and other ocular abnormalities; 4. Major systemic malformations; 5. In an abnormal coagulation state, or currently using medications that may affect metabolic and immune status.

[0046] 2. PBMC Extraction: 1.0–1.5 mL of venous blood from the subjects was collected in the morning in EDTA anticoagulant tubes and delivered to the laboratory within 2 hours. An equal volume of PBS buffer was added at a 1:1 ratio, gently mixed, and then transferred to a centrifuge tube containing an equal volume of Ficoll-Paque PLUS (GE Healthcare, NJ, USA). The tube was centrifuged at 400 g for 20 min with acceleration at 1 and deceleration at 0 (no break). The white membrane layer (PBMC) was aspirated, and PBS was added to 10–15 mL. The tube was then centrifuged at 300 g for 10 min with acceleration at 9 and deceleration at 9. After removing the supernatant, 1 mL of TRIZOL reagent (Invitrogen, Carlsbad, USA) was added and mixed. The mixture was then transferred to a 1.5 mL cryovial, flash-frozen in liquid nitrogen for 30 min, stored at -80°C, and transported on dry ice for tsRNA biomarker analysis.

[0047] 3. RNA extraction: Add 0.2 mL of chloroform to each 1 mL of TRIZOL reagent homogenate sample and tighten the cap. Vigorously shake the tube manually for 15 seconds, then incubate at 15°C to 30°C for 2 to 3 minutes. Centrifuge at 12000 ×g for 15 minutes at 4°C. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, a middle layer, and a colorless aqueous phase on top. All RNA will be allocated to the aqueous phase. The volume of the aqueous phase is approximately 60% of the TRIZOL reagent added during homogenization. Transfer the aqueous phase to a new centrifuge tube. Mix the aqueous phase with isopropanol to precipitate the RNA; add 0.5 mL of isopropanol. After mixing, incubate at 15°C to 30°C for 10 minutes, then centrifuge at 12000 ×g for 10 minutes at 4°C. At this point, the RNA precipitate, which was not visible before centrifugation, will form a gel-like precipitate on the bottom and sides of the tube. Remove the supernatant and add at least 1 mL of 75% ethanol to each 1 mL of TRIZOL reagent homogenate sample to wash away the RNA precipitate. After vortexing, centrifuge at 7500 ×g for 5 minutes at 4°C. Remove the ethanol solution and air-dry the RNA precipitate for 5–10 minutes; do not vacuum centrifuge. Note that the RNA precipitate should not be completely dried, otherwise the solubility of RNA will be greatly reduced. The A260 / 280 ratio of partially dissolved RNA samples will be less than 1.6. When dissolving RNA, first add RNase-free water and repeatedly pipette, then incubate at 55°C to 60°C for 10 minutes. Store the obtained RNA solution at -70°C. Before further investigation, check the RNA integrity by denaturing agarose gel electrophoresis.

[0048] 4. RNA quality testing: Dissolve 1 g of agarose in 72 mL of water and cool to 60°C. Add 10 mL of 10×MOPS electrophoresis buffer and 18 mL of 37% formaldehyde solution (12.3 M). Pour the solution into gel plates, leaving wells sufficient for at least 25 μL of sample. After gelation, remove the comb and place the gel plate in the electrophoresis tank. Add sufficient 1×MOPS electrophoresis buffer to cover the gel surface by several millimeters. Take 3 μg of RNA, add 3 times the volume of formaldehyde loading staining solution, and add EB to the formaldehyde loading staining solution to a final concentration of 10 μg / mL. Heat to 70°C and incubate for 5 minutes to denature the sample. Load the sample into the gel wells and electrophoresis at 5–6 V / cm until the bromophenol blue indicator penetrates at least 2–3 cm into the gel. The bands for 28S and 18S ribosomal RNA are very bright and dense (their size depends on the species from which RNA is extracted), with the density of the upper band approximately twice that of the lower band. A smaller, slightly diffuse band may also be observed, composed of low-molecular-weight RNA (tRNA and 5S ribosomal RNA). Between the 18S and 28S ribosomal bands, a diffuse EB staining material is typically visible, possibly composed of mRNA and other heterologous RNAs. If DNA contamination occurs during RNA preparation, it will appear above the 28S ribosomal RNA band, as a higher-molecular-weight, diffusely migrating material or band. RNA degradation manifests as the diffusion of the ribosomal RNA band.

[0049] 5. RNA pretreatment and cDNA synthesis: RNA pretreatment was performed using the rtStar™ tRF&tiRNA Pretreatment Kit (Cat# AS-FS-005, Arraystar), following this sequence: 3' end deacetylation, removal of 3'-cP and addition of 5'-p, demethylation, ligation of 3' adapters, reverse transcription primer hybridization, and ligation of 5' adapters. This process removed RNA modifications that could interfere with the creation of small RNA-seq libraries. Subsequently, cDNA synthesis and amplification were performed in a one-step process using the rtStar™ First-Strand cDNA Synthesis Kit (3' and 5' adapter) (Cat# AS-FS-003, Arraystar), amplifying the fragments.

[0050] 6. Construct sequencing libraries and perform sample sequencing: PCR amplification fragments of 134-160 bp were extracted by polyacrylamide gel electrophoresis and purified. Library quantification was performed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). After library denaturation and dilution, standard tRF and tiRNA sequencing was performed using an Illumina NextSeq 500 system with NextSeq 500 / 550V2 kit (Illumina, San Diego, CA), and mature tRNA and precursor tRNA libraries were further constructed.

[0051] 7. tRF & tiRNA data analysis: Using the Arraystar tRF&tiRNA-seq data analysis package, sequence information was compared with a reference genome to identify tRF&tiRNAs. Subsequently, differential expression analysis of tRF&tiRNAs was performed. Principal component analysis revealed a clear distinction between the control and patient groups. Figure 1 Data visualization was performed using scatter plots, volcano plots, and heatmaps. Detected tsRNA was considered statistically significant with a fold change ≥1.5 and P<0.05.

[0052] 8. Results: In 10 PBMC samples (5 control groups and 5 patient groups), a total of 602 tsRNAs were detected by the microarray, including 95 known tsRNAs. Figure 2 Among the target tsRNAs with significantly different expression (Fold Change ≥ 1.5 and P < 0.05), there were 44 upregulated targets and 81 downregulated targets. See [link to relevant documentation]. Figure 3 , Figure 4 .

[0053] Example 2: qRT-PCR Validation Eight target tsRNAs with significant differential expression were selected from the tsRNA expression profile established in Example 1, and their expression was further validated using qRT-PCR in 10 samples (5 control groups and 5 patient groups). The results showed that the differential expression levels of six tsRNAs in the two PBMCs were statistically different, and the trend was consistent with the microarray data. The six tsRNAs were tRF-1:30-Glu-TTC-1 and tRF-1:31-Glu-TTC-1, which were upregulated compared to the control group; and tRF-53:74-Gly-GCC-1, tRF-56:77-Thr-AGT-1-M2, tRF-54:75-Ala-AGC-2-M2, and tRF-55:76-Tyr-GTA-1-M2, which were downregulated compared to the control group. Figure 5 Further validation of the significantly differentially expressed tsRNAs was conducted. Total RNA was transcribed into cDNA using 2X PCR master mix (Arraystar: AS-MR-006-5). The cDNA could be stored on ice or at -20°C.

[0054] Example 3 The expression level of tRF-54:75-Ala-AGC-2-M2 in PBMCs was further verified by expanding the sample size using qRT-PCR, and its diagnostic value was examined.

[0055] 1. Sample collection and total RNA extraction were performed as before.

[0056] 2. cDNA synthesis and qRT-PCR: Primers were designed for the target sequence using Primer 5 software. The bidirectional primer sequences were: F: 5' CTACAGTCCGACGATCTCAATCC 3'; R: 5' TCCGATCTTGGTGGAGGTGC 3'.

[0057] The 384-well plate was placed in a QuantStudio™ 5 Real-time PCR System (AppliedBiosystems, Foster City, CA, USA) to perform real-time PCR reactions under the following conditions: 95°C for 10 minutes; 40 PCR cycles (95°C, 10 seconds; 60°C, 60 seconds). After the amplification reaction, melting curves of the PCR products were established at 95°C for 10 seconds; 60°C for 60 seconds; and 95°C for 15 seconds. The target gene and housekeeping gene of each sample were subjected to real-time PCR reactions separately. Based on the plotted gradient dilution DNA standard curve, the corrected relative concentration of the target gene in each sample was calculated by dividing the concentration of its housekeeping gene by the concentration of the target gene in that sample.

[0058] The data were calculated using the double standard curve method. Quantitative data were expressed as median ± interquartile range, and the Mann-Whitney U test was performed. A p-value < 0.05 was considered statistically significant (see Table 1).

[0059] Table 1. P-value levels of tRF-54:75-Ala-AGC-2-M2

[0060] 3. Results: The expression level of tRF-54:75-Ala-AGC-2-M2 was detected in 56 peripheral blood microvascular mesenchymal stem cell (PBMC) samples (26 control samples and 30 samples from preterm infants with retinopathy of prematurity, age- and sex-matched). The results showed a statistically significant difference in tRF-54:75-Ala-AGC-2-M2 expression between the two groups of PBMC samples. Figure 6 .

[0061] To further examine the efficacy of tRF-54:75-Ala-AGC-2-M2 in diagnosing retinopathy of preterm infants using peripheral blood mononuclear cells (PBMCs), we plotted receiver operating characteristic (ROC) curves, referring to... Figure 7 The area under the ROC curve for tRF-54:75-Ala-AGC-2-M2 in diagnosing retinopathy of preterm infantile gestation (ROC) in PBMC samples was found to be 0.8795. When the diagnostic value of tRF-54:75-Ala-AGC-2-M2 in PBMC was set to <0.0008075, its diagnostic sensitivity and specificity were 73.33 / 96.15 (%), as shown in Table 2.

[0062] Table 2. Clinical diagnostic value of tRF-54:75-Ala-AGC-2-M2

[0063] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of reagents for detecting tRF-54:75-Ala-AGC-2-M2 in the preparation of diagnostic products for retinopathy of prematurity, among which, The sequence of tRF-54:75-Ala-AGC-2-M2 is shown in SEQ ID NO.1: TCATCCCCGGCACCTCCACCA.

2. The application according to claim 1, characterized in that, The reagents for detecting tRF-54:75-Ala-AGC-2-M2 include detection primers for tRF-54:75-Ala-AGC-2-M2 or a chip for detecting tRF-54:75-Ala-AGC-2-M2.

3. The application according to claim 2, characterized in that, The detection primers for tRF-54:75-Ala-AGC-2-M2 include primer pairs as shown in SEQ ID NO.2 to 3.

4. The application according to claim 2 or 3, characterized in that, The diagnostic product for retinopathy of prematurity includes the reagent for detecting tRF-54:75-Ala-AGC-2-M2.

5. The application according to claim 4, characterized in that, The diagnostic products also include total RNA extraction reagents, reverse transcription reagents, and qRT-PCR detection reagents.

Images