A novel pore membrane complex based on small conductance mechanosensitive channel

CN116814816BActive Publication Date: 2026-08-18SICHUAN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210758295.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-08-30
Filing Date
2022-06-29
Publication Date
2026-08-18
Estimated Expiration
2042-06-29

AI Technical Summary

Technical Problem

但通过修饰手段改变生物纳米孔的孔径需要大量的生物工程技术辅助

Benefits of technology

[0024] This invention creatively fuses a small-conductivity mechanosensitive channel (MscS) nanopore with an insulating membrane, providing a novel porous membrane composite based on the MScS nanopore. The researchers characterized the specific structure of the PaMscS nanopore within the MScS nanopore using cryo-electron microscopy and other techniques, and demonstrated through a series of experiments that the narrow channel structure of the MScS nanopore is suitable for detecting small molecules (while large molecules, such as single-stranded DNA, cannot generate translocation events).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116814816B_ABST
    Figure CN116814816B_ABST
Patent Text Reader

Abstract

The application belongs to the field of nanopore detection, and particularly relates to a novel pore membrane complex based on a small conductance mechanosensitive channel. The application creatively fuses a small conductance mechanosensitive channel (MscS) Emi pore and an insulating film, and provides a novel pore membrane complex based on the MscS Emi pore. The pore membrane complex has a narrow channel structure suitable for small molecule detection (without chemical modification), a narrow and controllable pore size, and is suitable for single molecule sensing.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims priority to Chinese invention patent application No. CN2021110062678, filed on August 30, 2021, entitled "A Novel Pore Membrane Complex Based on PaMscS Nanopores"; Chinese invention patent application No. CN2021110062606, filed on August 30, 2021, entitled "A Bio-nanopore System Based on PaMscS for dNTPs and COVID-19 Detection"; and Chinese invention patent application No. CN2021110042496, filed on August 30, 2021, entitled "A Bio-nanopore System Based on PaMscS for Small Molecule Drug Detection and Whole Blood Detection". The entire contents of these three priority patent applications are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of nanopore detection, specifically relating to a novel porous membrane composite based on a low-conductivity mechanically sensitive channel. Background Technology

[0003] In recent years, nanotechnology and nanobiotechnology have flourished, and nanopore single-molecule detection technology has been applied to the detection of single molecules, including nucleotides, DNA, drugs, polymers, and peptides. Nanopores can be divided into two main categories: solid-state and biological. Biological nanopores, also known as transmembrane protein channels, include α-hemolysin (α-HL), MspA, CsgG, Aerolysin, and the phi29 connector. These biological nanopores mainly originate from bacterial porins or viruses and have pore sizes approximately the size of single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) (1.0 nm–3.6 nm). Therefore, they are suitable for detecting nucleic acids and have been used in DNA / RNA sequencing, nucleic acid biomarker detection, and biomolecular interaction research.

[0004] However, most nanopores, including solid-state and biopores, have fixed channel sizes, allowing only the transport and detection of molecules within a specific size range, thus limiting their applications. For example, α-HL has a limited pore size of approximately 1.4 nm, thus restricting its application to the analysis of ssDNA, RNA, or other molecules. However, by utilizing cyclodextrin modification, it can be used for the direct detection of single nucleotide dNMPs without fluorescent labeling. But altering the pore size of biopores through modification requires extensive bioengineering techniques. Furthermore, compared to solid-state nanopores, traditional protein pores offer significantly less flexibility in size regulation. In this sense, there is an urgent need to find a biopore with a flexible structure to efficiently detect molecules of various sizes.

[0005] In summary, the present invention aims to provide a novel porous membrane composite, where angstroms are protein structures with channel sizes smaller than nanopores, in order to alleviate the shortcomings of the prior art. Summary of the Invention

[0006] In view of this, the present invention provides a novel porous membrane composite based on a small conductance (MscS) mechanosensitive channel, the specific technical solution of which is as follows.

[0007] A porous membrane composite comprising angstroms embedded in an insulating membrane, the angstroms being MScS variant angstroms having a radially symmetrical, cylindrical heptamer structure comprising seven side openings and one bottom opening.

[0008] Furthermore, the MScS variants include side-hole volume variants and / or side-hole charge variants.

[0009] Furthermore, the charge properties and / or aperture size of the opening are adjustable.

[0010] Furthermore, the adjustment of the opening includes subjecting the insulating film to mechanical force and / or changing the physical state of the insulating film.

[0011] Furthermore, the mechanical stimulation includes one or more of the following: changes in the osmotic pressure difference between the media on both sides of the insulating membrane, direct physical stimulation of the insulating membrane by microparticles, and stimulation of the insulating membrane by negative air pressure.

[0012] Furthermore, the aperture of the opening can be adjusted in the following way: (1) Selection of the types of the first medium and the second medium; and / or (2) The osmotic pressure difference between the first medium and the second medium.

[0013] Furthermore, the aperture of the opening is adjustable in the range of 5-15 angstroms.

[0014] Furthermore, the insulating film includes a phospholipid film and / or a polymer film.

[0015] Furthermore, the micropore is divided into a transmembrane region and a cytoplasmic region; each monomer of the micropore includes an N-terminal transmembrane helix and a C-terminal cytoplasmic region, the N-terminal transmembrane helix includes TM1, TM2 and TM3, and the C-terminal cytoplasmic region includes an intermediate β domain and a COOH terminal domain.

[0016] Furthermore, TM1 and TM2 are arranged together in an antiparallel direction, with TM1 passing through the insulating film outside the channel and TM2 forming a central layer, thereby forming a permeation path around the axis of the channel.

[0017] Furthermore, the micropore is a PaMscS variant micropore, and the mutation site of the micropore is located at the lateral opening of the cytoplasmic region of the micropore.

[0018] Furthermore, the micropore includes one or more of 130A, 130H, 180R, 271I, 130S, and 130P.

[0019] Furthermore, the seven side openings are equal in size, and the radii of the seven side openings are approximately [missing information].

[0020] Furthermore, the bottom opening comprises 7 β chains, and the narrowest radius of the bottom opening is approximately

[0021] On the other hand, the present invention also provides the application of the above-mentioned porous membrane complex in the preparation of molecular biosensors.

[0022] Furthermore, the angstrom provides a channel for the molecules to pass through the pore membrane complex, and the molecular biosensor senses the signals generated by the interaction between the molecules and the pore membrane complex.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] This invention creatively fuses a small-conductivity mechanosensitive channel (MscS) nanopore with an insulating membrane, providing a novel porous membrane composite based on the MScS nanopore. The researchers characterized the specific structure of the PaMscS nanopore within the MScS nanopore using cryo-electron microscopy and other techniques, and demonstrated through a series of experiments that the narrow channel structure of the MScS nanopore is suitable for detecting small molecules (while large molecules, such as single-stranded DNA, cannot generate translocation events).

[0025] The porous membrane composite provided by this invention requires no chemical modification, has a narrow and tunable pore size (i.e., the channel structure of the MScS angstrom pores can change the channel size in response to mechanical stimuli and / or changes in the physical state of the insulating membrane), and can convert mechanical stimuli into electrical or biochemical signals within milliseconds, making it suitable for single-molecule sensing. Specifically, the osmotic pressure difference across the insulating membrane can be adjusted by regulating the concentration of the medium on both sides of the insulating membrane, thereby changing the pore size of the MScS angstrom pores to achieve the detection of molecules of a specific size.

[0026] The properties of the cytoplasmic pores of the MScS micropores can also be altered through mutations, such as pore volume variants that change the volume of amino acids and pore charge variants that change the charge of amino acids, to achieve better sensing of specific charged molecules and molecules of specific sizes. Specifically, among the PaMscS1 (W130A) and PaMscS2 (K180R) variants, the W130A variant increases the pore size, making it easier to sense larger molecules, while the K180R variant enhances the positive charge distribution of the pores, making it easier to sense negatively charged molecules. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0028] Figure 1 The cryo-electron microscopy (cryo-EM) structure of PaMscS2 (K180R) is shown;

[0029] Figure 2 The cryo-electron microscopy analysis of MScS (K180R) is shown;

[0030] Figure 3 A flowchart of cryo-electron microscopy data processing for MScS (K180R) in GDN micelles is shown;

[0031] Figure 4 The SDS-PAGE results of the PaMscS protein are shown (1: wild-type PaMscS; 2: W130A mutant; 3: K180R mutant; 4: marker).

[0032] Figure 5 The overall structure of PaMscS is shown;

[0033] Figure 6 The current signal or current distribution of wild-type or mutant PaMscS is shown;

[0034] Figure 7 The current trace through a single PaMscS1 angstrom orifice is shown under ramp voltages from 0mV to +100mV.

[0035] Figure 8 Electrophysiological assays and dNTP detection based on PaMscS micropores are shown;

[0036] Figure 9 The transport capabilities of different ions through the PaMscS1 pores are shown;

[0037] Figure 10 The translocation frequency of dNTPs through the PaMscS1 pore is shown under different osmotic pressure differentials;

[0038] Figure 11 This demonstrates that single-stranded DNA cannot translocate through the PaMscS1 pore;

[0039] Figure 12 The single-channel embedded current trajectory of wild-type EcMscS is shown (voltage +100mV, conductivity solution 30mM:300mM NaCl);

[0040] Figure 13 The channel scan voltages (-100mV to 100mV) for wild-type EcMscS are shown.

[0041] Figure 14 The conductivity distribution of wild-type EcMscS is shown;

[0042] Figure 15 The sequence alignment of PaMscS with MScS from other bacteria is shown;

[0043] Figure 16 This demonstrates dNTP detection based on the micropores of wild-type PaMscS;

[0044] Figure 17 A drug single-molecule biosensing experiment based on PaMscS3(V271I) micropores is shown. Detailed Implementation

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0046] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.

[0047] As used in this specification, the term "about" typically means + / - 5% of the value, more typically + / - 4%, more typically + / - 3%, more typically + / - 2%, even more typically + / - 1%, even more typically + / - 0.5% of the value.

[0048] In this specification, some embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as specifically disclosing all possible subranges and the individual numerical values ​​within that range. For example, a description of the range 1–6 should be considered as specifically disclosing subranges such as 1–3, 1–4, 1–5, 2–4, 2–6, 3–6, etc., and the individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0049] Detailed description of the attached figures

[0050] Figure 1 A. EM images of PaMscS2 (K180R) are shown in side and top views. One subunit (or subunit) of the heptamer is gray, while the other subunits are light green or light red. Lipid density is shown in orange. Detergent micelle and bottom pore density are shown on the transparent image. Color and transparent images were counted using chimeraX at the 0.6 and 0.28 levels, respectively. B. Overall structural diagram of PaMscS2 (K180R), imaged using PyMol. C. Peptide folding of PaMscS2 subunits. Superposition of a single PaMscS1 subunit (green) with the open (blue; PDB ID code 2VV5) and closed (yellow; PDB ID code 2OAU) states of EcMscS is shown. D. Channel shape and channel radius distribution of PaMscS2 angstroms. The measurement origin of the channel radius (0 along the channel distance axis) is marked with a black dashed line. The channel was calculated using CARVE Analyst 2.0; the PaMscS2 radius was calculated using HOLE (right).

[0051] Figure 2 A. 2D categories of the original image and picked particles. B. Orientation distribution of particles in the final 3D reconstruction conforming to C7 symmetry. C. Local resolution of the C7 density map, with the right panel highlighting internal regions through volumetric slices. D. Fourier shell correlation (FSC) curves of the C1 and C7 maps. E. Validation of the improved model. The FSCs between the overall map / half-map and the structure demonstrate high quality before fitting.

[0052] Figure 5 Sequence alignment of the MScS family. Residues highlighted in red are identical in all four sequences. The cylinders above the sequences indicate α-helices and β-chains.

[0053] Figure 6 A. Background signal frequencies of wild-type PaMscS and mutant PaMscS1 and PaMscS2. The background noise frequencies of PaMscS1 and PaMscS2 are lower than those of wild-type PaMscS (voltage +50mV, n≥3). B. Insertion time of micropores in PaMscS1 and PaMscS2. The micropores in PaMscS2 have higher membrane fusion efficiency than those in PaMscS1 (n≥3). C. dNTP blocking current distribution of micropores in PaMscS1 and PaMscS2.

[0054] Figure 7 Current trace through a single PaMscS1 angstrom aperture under ramp voltages from 0mV to +100mV: Voltage gating was observed when the voltage rose above +90mV (buffer conditions: -cis terminal: 300mM NaCl, -trans terminal: 30mM NaCl, sampling frequency: 4999Hz).

[0055] Figure 8 A. Schematic diagram of the electrophysiological measurement chamber. B. Single-well insertion of PaMscS1 and PaMscS2 micro-wells at +50 mV. C. IV relationship of PaMscS1 and PaMscS2 micro-wells in the voltage range of -50 mV to +50 mV. D. Conductivity distribution of PaMscS1 and PaMscS2 micro-wells (N = 18, respectively) (buffered by -cis end: 300 mM NaCl, -trans end: 30 mM NaCl). E. Detection of dNTPs through PaMscS mutant micro-wells (buffered by -cis end: 300 mM NaCl, -trans end: 30 mM NaCl, and voltage: +50 mV).

[0056] Figure 9 The buffer conditions are: 300mM NaCl on the -cis side and 30mM NaCl on the -trans side, with n≥3 for each data point and mean ±SD.

[0057] Figure 10The translocation frequencies of dCTP (in orange) and dGTP (in blue) were tested under different osmotic pressure differentials: symmetric (A, 300 mM NaCl: 300 mM NaCl for the cis end: trans end), low osmotic pressure differential (LOD) (B, 300 mM NaCl: 100 mM NaCl for the cis end: trans end), and high osmotic pressure differential (HOD) (C, 300 mM NaCl: 30 mM NaCl for the cis end: trans end). Four groups of dNTP concentrations, 0.5 mM, 1.0 mM, 1.5 mM, and 2.0 mM, were used to test the translocation of dCTP and dGTP. D. Relationship between translocation frequencies and dCTP / dGTP concentrations under symmetric, low, and high osmotic pressure differentials (n=3 for each data point). E. Under three different osmotic pressure differentials, f dCTP and f dGTP The rate of increase.

[0058] Figure 11 Voltage: +50mV; Buffer conditions: 300mM NaCl on the cis side, 30mM NaCl on the trans side. The final concentration of ssDNA was 5μM, and the sequence was 5′TAGCTTATCAGACTGATGTTGA 3′ (SEQ ID NO:5).

[0059] Figure 17 A. Results of gentamicin sulfate detection via PaMscS3 (V271I) microwells, including representative current traces and blocking signals. B. Results of neomycin sulfate detection via PaMscS3 microwells. C. Quantitative standard curve (N=3) and heatmap of blocking signals for gentamicin sulfate (right, 878 blocking events). D. Quantitative standard curve (middle, N=4) and heatmap of blocking signals for neomycin sulfate (right, 883 blocking events). Electrolyte conditions: -cis end: 300 mM NaCl, -trans end: 30 mM NaCl, 10 mM HEPES, pH 7.0, detection voltage: -50 mV. E. Comparison of detection results for 1.5 μM gentamicin sulfate between LC-MS and PaMscS3 microwells. The electrolyte conditions were: -cis end: 130 mM NaCl, -trans end: 130 mM NaCl, 10 mM HEPES, pH 7.0, and the drug detection voltage was -50 mV.

[0060] Emicon

[0061] The micropores used in this invention are mechanosensitive channels of small conductance (MscS), preferably PaMscS (Pseudomonas aeruginosa mechanosensitive channel) or variants thereof. These variants (also understood as "mutants") can be naturally occurring variants expressed by an organism (e.g., Pseudomonas aeruginosa). Variants also include non-naturally occurring variants generated by recombinant technology. In this invention, "PaMscS variant," "mutant PaMscS," "mutant PaMscS," and "PaMscS mutant" have the same meaning unless otherwise stated.

[0062] In one embodiment of the invention, the micropore can be an MScS variant. Amino acid substitutions can be made to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, for example, substitution of one or more amino acids. The substitutions can be conservative or non-conservative. Preferably, non-conservative substitutions can be made at one or more positions of the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, wherein the substituted amino acid residues are replaced by amino acids with significantly different chemical properties and / or physical sizes. Further, the MScS variant can be classified into pore volume variants and pore charge variants. A pore volume variant is a variant in which the mutation site is located at the lateral opening (also understood as a "pore") at the cytoplasmic end, and the pore volume is altered by changing the amino acid at that site. A pore charge variant is a variant in which the mutation site is located at the lateral opening at the cytoplasmic end, and the pore charge is altered by changing the amino acid at that site. For example, the side pore volume variant may be the replacement of a larger volume amino acid (e.g., tryptophan (W)) with a smaller volume amino acid (e.g., alanine (A), serine (S), or proline (P)), or vice versa. The side pore charge variant may be the replacement of an amino acid with a certain charge with an amino acid with the opposite charge or a neutral charge, or the replacement of a neutral amino acid with a charged amino acid. Generally, non-limiting examples of positively charged amino acids include histidine, arginine, and lysine; non-limiting examples of negatively charged amino acids include aspartic acid and glutamic acid; and non-limiting examples of neutral amino acids include glycine, alanine, phenylalanine, valine, leucine, isoleucine, cysteine, asparagine, glutamine, serine, threonine, tyrosine, methionine, proline, and tryptophan. Conservative or non-conservative substitutions of amino acids, as well as many different types of modifications to amino acids (deletion, substitution, addition), are well known in the art, and those skilled in the art can modify MScS according to the actual situation to obtain corresponding MScS variants. Modification methods include altering the corresponding DNA sequence (e.g., directly synthesizing the corresponding protein after modifying the DNA sequence information or using PCR to perform site-directed mutagenesis on the DNA sequence) to obtain the corresponding variant (and its corresponding DNA sequence).

[0063] In one specific embodiment, the MScS variant may be a PaMscS variant. The PaMscS variant includes, for example, one or more of 130A, 130H, 180R, 271I, 130S, and 130P. Side pore volume mutants of PaMscS include, for example, 130A, 130S, and 130P, while side pore charge mutants of PaMscS include, for example, 130H, 180R, and 271I. Such modification can alter the pore size (or "channel size") of the modified side pore, thereby improving the detection capability for analytes of a specific molecular volume; it can also alter the local charge characteristics of the modified side pore channel, thereby improving the detection capability for specific charged analytes; and it can further enhance the stability of the protein channel current of the PaMscS variant.

[0064] In one embodiment of the present invention, the micropore can be wild-type PaMscS, which, although having high background noise, still has the ability to detect analytes.

[0065] In one embodiment of the present invention, the micropore can be wild-type EcMscS (E. coli small-conductivity mechanosensitive channel) or a variant thereof. EcMscS and PaMscS have highly similar structures and can both form stable channel currents, enabling them to detect analytes. PaMscS and EcMscS share a 60% sequence similarity. Conservative or non-conservative substitutions of amino acids, as well as many different types of modifications (deletion, substitution, addition) of amino acids, are well known in the art. Those skilled in the art can modify EcMscS according to the actual situation to obtain corresponding EcMscS variants.

[0066] In another embodiment of the invention, besides *Escherichia coli* and *Pseudomonas aeruginosa*, the micropores can also be derived from other bacilli, such as *Thermoanaerobacter tengcongensis* and *Helicobacter pylori*. PaMscS is structurally highly similar to TtMscS and HpMscS, with sequence similarities of 55% and 44%, respectively. Combined with actual electrophysiological detection results of PaMscS and EcMscS, it can be seen that the reason why MScS can be used as an analyte for micropore detection is due to their highly similar structure and similar functions. Conservative or non-conservative substitutions of amino acids, as well as many different types of modifications (deletion, substitution, addition) of amino acids, are well known in the art. Those skilled in the art can modify MScS according to the actual situation to obtain corresponding MScS variants.

[0067] Analytes

[0068] The analyte is a charged substance. It is charged if it carries a net charge. The analyte can be negatively or positively charged. It is negatively charged if it carries a net negative charge, and positively charged if it carries a net positive charge. Suitable analytes should be substances with a size smaller than or equal to the pore size of the angstrom pore, preferably nucleotides, amino acids, peptides, or drug molecules.

[0069] In one embodiment of the present invention, the analyte may be a nucleotide. A "nucleotide" refers to a monomeric unit composed of a heterocyclic base, a sugar, and a phosphate group. It should be understood that heterocyclic bases include naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) and non-naturally occurring base analogues. Sugars include naturally occurring sugars (deoxyribose and ribose) and non-naturally occurring sugar analogues. The nucleotides include deoxyribonucleotides and ribonucleotides, such as ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, dUTP, GMP, UMP, TMP, CMP, dGMP, dAMP, dTMP, dCMP, dUMP, ADP, GDP, TDP, UDP, CDP, dADP, dGDP, dTDP, dUDP, and dCDP. The nucleotides include naturally occurring nucleotides and non-naturally occurring nucleotide analogues that hybridize with nucleic acids in a manner similar to naturally occurring nucleotides. The nucleotide is free (or, can be understood as "single"). Preferably, the nucleotide is ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, or dUTP.

[0070] In one embodiment of the invention, the analyte may be a drug molecule. A drug molecule may be a compound. More specifically, a "drug molecule" may be a drug having a molecular weight of 1000 g / mol or lower (e.g., below 800, 700, 600, 500, 400, 300, or 200 g / mol). Preferably, the small molecule drug may be an aminoglycoside antibiotic. In another embodiment of the invention, the small molecule drug comprises amino acids and their salts (including non-drugizable amino acids) and peptides.

[0071] Pore ​​membrane complex

[0072] A "pore-membrane complex" refers to a composite structure formed between pores with angstrom-sized dimensions (referred to as "angstrom pores") and an insulating membrane. In one embodiment of the invention, the angstrom-sized pores are small conductivity mechanosensitive channels (MscS) angstrom pores. Preferably, the angstrom-sized pores have a radially symmetrical, cylindrical heptamer structure, comprising seven side openings and one bottom opening. In another embodiment of the invention, the angstrom-sized pores have a typical radially symmetrical, cylindrical heptamer structure comprising eight openings, seven equal openings distributed on the sides, and an eighth opening distributed at the bottom and formed by seven subunits; the diameter of all eight openings is adjustable. The angstrom-sized pores allow the analyte to translocate from one side of the insulating membrane to the other.

[0073] In one embodiment of the present invention, a first medium and a second medium are respectively located on both sides of the pore membrane composite (i.e., the pore membrane composite separates the first medium and the second medium), wherein the channels of the angstroms provide a passage connecting the first medium and the second medium. In a specific embodiment of the present invention, after a driving force is applied between the first medium and the second medium, the analyte located in the first medium interacts with the angstroms to form an electric current (i.e., an electrical signal) (e.g., passing through the angstroms and forming a specific current). In the present invention, the "first medium" refers to the medium in which the analyte is located when it is added to the pore membrane composite; the "second medium" refers to the other side of the "first medium" of the two media separated by the insulating membrane. In the present invention, the driving force refers to the force that drives the interaction between the analyte and the angstroms through electric potential, electroosmotic flow, concentration gradient, etc.

[0074] The first medium and the second medium may be the same or different, and both may include a conductive liquid. The conductive liquid is an aqueous solution of an alkali metal halide, specifically sodium chloride (NaCl), lithium chloride (LiCl), cesium chloride (CsCl), potassium chloride (KCl), or sodium bromide (NaCl). In one embodiment of the invention, the concentrations of the conductive liquid in the first medium and the second medium are different; in other words, there is a difference in the concentration of the conductive liquid in the first medium and the second medium, resulting in a difference in osmotic pressure across the insulating membrane. The first medium and / or the second medium may also include a buffer solution, such as HEPES. The concentration range of the first medium and / or the second medium may be 30 mM to 3 M.

[0075] An insulating membrane is a membrane capable of carrying angstrom-sized (or nanopores) pores and blocking ionic currents passing through non-angstrom-sized (or nanopores). The insulating membrane may include phospholipid membranes and / or polymer membranes. Exemplary phospholipid membranes include DPHPC, DOPC, and E. coli lipid; exemplary polymer membranes include triblock copolymer polymer membranes.

[0076] This membrane complex may contain any of the low-conductivity mechanosensitive channels described herein, such as wild-type PaMscS (SEQ ID NO:1), wild-type EcMscS (SEQ ID NO:2), wild-type TtMscS (SEQ ID NO:3), and wild-type HpMscS (SEQ ID NO:4) and their corresponding variants. The specific sequence information of the above four MScS is shown in Table 3. For example, the low-conductivity mechanosensitive channel may be a mutant PaMscS1 (W130A), a mutant PaMscS2 (K180R), or a mutant PaMscS3 (V271I).

[0077] In one specific embodiment of the invention, two electrolyte chambers are separated by the porous membrane composite, forming a trans (-trans) chamber and a cis (-cis) chamber. The pores of the micropores are embedded in an insulating membrane, which has only micropores to connect the two electrolyte chambers. When a potential is applied to the two electrolyte chambers, electrolyte ions in the solution within the electrolyte chambers move through the micropores via electrophoresis.

[0078] In one embodiment of the present invention, the small conductivity mechanosensitive channel (MscS) angstrom pore can be embedded in an insulating membrane, but retains its ability to alter protein structure in response to mechanical stimuli and changes in the physical state of the insulating membrane. Specifically, mechanical stimuli include changes in osmotic pressure across the insulating membrane, direct physical stimulation of the insulating membrane by microparticles, and stimulation of the insulating membrane by negative pressure. Physical changes in the insulating membrane include changes in the thickness of the insulating membrane, changes in the composition of the insulating membrane, and changes in the surface curvature of the insulating membrane. The alteration of protein structure includes changing the charge properties and / or pore size of the openings of the MScS. Furthermore, the altered charge properties and / or pore size of the openings of the MScS angstrom pore can be used to detect different analytes. The adjustable range of the pore size of the angstrom pore involved in the present invention can be 5–15 angstroms.

[0079] Interaction between the micropores and the analyte

[0080] The analyte can contact either side of the angstrom on the insulating membrane. The analyte can contact either side of the insulating membrane such that it passes through the channel of the angstrom to reach the other side of the insulating membrane. In this case, the analyte interacts with the angstrom as it passes through the channel of the angstrom through the insulating membrane. Alternatively, the analyte can contact a side of the insulating membrane, which allows the analyte to interact with the angstrom, causing it to separate from the angstrom and remain on the same side of the insulating membrane. The analyte can interact with the angstrom in any manner and at any location. The analyte can also impact the angstrom, interacting with it and causing it to separate from the angstrom and remain on the same side of the insulating membrane.

[0081] During the interaction between the analyte and the micropore, the analyte influences the current flowing through the micropore in a analyte-specific manner; that is, the current flowing through the micropore is characteristic of a particular analyte. Control experiments can be performed to determine the effect of a specific analyte on the current flowing through the micropore, thereby identifying the specific analyte in the sample or determining its presence in the sample. More specifically, the presence or concentration of the analyte can be identified by comparing the current pattern obtained by detecting the analyte with a known current pattern obtained under the same conditions using a known analyte.

[0082] The pore membrane composite of the present invention can also be used in conjunction with one or more measuring devices for measuring the current flowing through the angstrom pore, such as patch clamp amplifiers or data acquisition devices.

[0083] Example 1

[0084] Materials and Methods:

[0085] Sodium chloride (NaCl, >99.0%, CAS#7647-14-5), dNTP mixture (>99.0%), dATP (>97%, CAS#1927-31-7), dCTP (>98%, CAS#102783-51-7), dGTP (>98%, CAS#93919-41-6), and dTTP (>98%, CAS#18423-43-3) were purchased from Sangon Biotech. Yeast extract (CAS#8013-01-2), trypsin (CAS#73049-73-7), ampicillin sodium (≥98.5%, CAS#69-52-3), Tris (≥99.9%, CAS#77-86-1), imidazole (≥99%, CAS#288-32-4), n-Dodecyl-β-D-maltopyranoside (DDM) (≥99%, CAS#69227-93-6), isopropyl-β-D-thiogalactoside (IPTG) (≥99%, CAS#367-93-1), phenylmethylsulfonyl fluoride Fluoride (PMSF) (≥99.%, CAS#329-98-6) and 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) (>99.5%, CAS#7365-45-9) were purchased from Sigma-Aldrich. Phospholipids extracted from *E. coli* were purchased from Avanti. PrimeSTAR HS DNA polymerase was purchased from TaKaRa.

[0086] Expression and purification of wild-type and mutant PaMscS:

[0087] The PaMscS gene from the genomic DNA of *Pseudomonas aeruginosa* was amplified by polymerase chain reaction (PCR) using gene-specific primers. The gene was inserted into a plasmid using the ClonExpress II One Step Cloning Kit (Vazyme). *E. coli* BL21(DE3) cells containing the PaMscS gene plasmid were cultured and purified at 37°C in Luria-Bertani (LB) medium containing 50 μg / mL ampicillin. Peak values ​​were determined by SDS-PAGE analysis; see details below. Figure 4It should be noted that the purification and expression steps for wild-type and mutant proteins are the same in this invention. The only difference is in the plasmid synthesis stage due to the sequence differences between wild-type and mutant proteins.

[0088] Cryo-electron microscopy sample preparation and data collection:

[0089] Immediately after glow-discharging, aliquots of the GDN-dissolved MScS K180R mutant (3.5 μl, 10.7 mg / ml) were loaded onto porous carbon grids (Quantifoil Au R1.2 / 1.3), blotted for 3.5 s, and then rapidly frozen in liquid ethane using a Vitrobot (Mark IV, Thermo Fisher Scientific). Grid exposures were collected using a Titan Krios cryo-electron microscope running at 300 kV and a Gatan K3 camera with a GIF energy filter in super-resolution mode (81000× magnification), a slit width of 20 eV. Each movie stack containing 32 frames was exposed for 2.56 s, with a total dose rate of approximately [missing value]. Furthermore, the defocus range is from -0.5μm to -2.5μm. The acquisition program is automatically completed by the AutoEMation program (Table 1).

[0090] Table 1. Statistics on cryo-electron microscopy data collection, improvement, and validation

[0091] Data processing:

[0092] MotionCor2 uses 2x divisions for motion correction. 1773 photomicrographs were generated per pixel. Approximately two million particles were selected from the images after patch-CTF estimation using cryoSPARC v2. Two rounds of 2D classification yielded a set of 976,481 particles of good quality. Ab initio reconstruction and subsequent 3D classification (C1 point group) produced five classes, and uniform and non-uniform refinement jobs were used for the particle classes with the highest resolution and integrity. Similar 3D classification and refinement jobs were performed on the C1 reconstructed particle images with C7 symmetry. Phenix.mtriage was used... Figure 2 AD, Figure 3 The Fourier shell correlation (FSC) 0.143 criterion was used to determine whether the target was met. The resolution of the final image.

[0093] Model building:

[0094] The initial model of the MscS K180R protopolymer was established using SWISS-MODEL via homology modeling. After fitting high-resolution plots in Chimera, the model was manually tuned in COOT and then refined under appropriate chemical constraints using Phenix.real_space_refine. FSC validation of the final structure was performed using Phenix.mtriage. It can be inferred that the lipid molecule was not constructed.

[0095] Molecular model of PaMscS1 micropores:

[0096] Using the E. coli MScS structure (EcMscS, which shares 34% sequence homology with PaMscS1) in an open (2VV5) state, researchers generated a structural model of the PaMscS1 channel in the open state from the SWISS-MODEL server (https: / / swissmodel.expasy.org / ). Based on the existing structure and combined with structure prediction software, the gene sequence of this micropore was input. According to the PaMscS1 model of the PaMscS2 structure and the E. coli MScS structure in the open state, the approximate size of the PaMscS1 pore can be in the range of 0.694-1.224 nm (Table 2).

[0097] Table 2 shows the internal dimensions of the PaMscS1 orifice in both open and closed states.

[0098] Example 2

[0099] PaMscS micropore structure:

[0100] The experimenters The cryo-electron microscopy structure of PaMscS2 was resolved at high resolution. 2D particle class averages are shown in the accompanying views of the seven distinct subunits within each detergent micelle. Figure 1 A). The model established by the researchers revealed that the functional channel forms a typical heptamer that is radially symmetrical and cylindrical. It contains 8 openings, 7 on the sides and 1 at the bottom ( Figure 1 A). N-terminal residues 1-13 are too flexible to be resolved in the model. Topologically, PaMscS can be divided into two parts: a transmembrane region and a large cytoplasmic region (…). Figure 1B). Each monomer produces three N-terminal transmembrane helices, including TM1 (residues 17–52), TM2 (residues 58–83), and TM3 (residues 90–122). The C-terminal cytoplasmic region can be divided into an intermediate β-domain and a COOH-terminal domain. Figure 1 C). In each subunit, TM1 and TM2 are arranged in an antiparallel direction, with TM1 passing through the bilayer membrane on the outside of the channel and TM2 forming the central layer, thus creating a permeation path around the channel axis. Figure 1 D). The TM3 helix can be described as two helical segments, TM3a and TM3b, separated by a distinct kink at Gly108 ~53°, which are homologously conserved residues. TM3a, like TM1, crosses the membrane with a different deflection, while TM3b returns to the cytoplasm and interacts with the cytoplasmic region. Furthermore, the seven subunits form a ring with a radius of... The central pore senses tension and is involved in conformational changes. Comparing the MScS structures of *Pseudomonas aeruginosa* and *Escherichia coli*, the tilt angles of TM1 and TM2 in the former are smaller than those in the latter, leading to a large deflection of the TM region, especially the loop between TM1 and TM2. Figure 1 C Figure 5 In the cytoplasm, the intermediate β-domain (residues 123–172) contains five β-chains, which are tightly linked to the β-chains of other subunits. The C-terminal domain (residues 177–273) consists of five β-chains and two α-helices, forming a mixed structure. Between these two domains of adjacent monomers, seven equal, clearly visible openings are located on the lateral side, with a radius of approximately [missing information]. ( Figure 1 D), which has been proposed as the cause of ion permeation in EcMscS. In addition to these entrances, an eighth opening exists at the bottom of the protein, manifested through seven β chains, with a narrowest radius of [missing information]. ( Figure 1 D). In all sizes, extending to PaMscS2 is parallel to the seven-times axis and has a width of [missing information] in the vertical direction. The structure of PaMscS is similar to that of EcMscS in the off state (PDB: 20AU), and the TM structure domain has more than 101 rmsd values. C α Atoms, but in the open state (PDB: 2VV5), the TM region shows significant differences, with rmsd being [value missing]. ( Figure 1 C). These results indicate that the structural conformation of PaMscS reflects the closed state. Overall, the protein structure suggests that the MS channel PaMscS2 possesses a channel structure suitable for small molecule detection. The unique and fine structure of the micropores in the PaMscS mutant also shows great potential for design.

[0101] Example 3

[0102] Electrophysiological detection based on PaMscS micropores:

[0103] This embodiment relates to electrophysiological detection using the porous membrane complex formed by the lateral pore mutant PaMscS1 (W130A) and an insulating membrane, and the porous membrane complex formed by PaMscS2 (K180R) and an insulating membrane as examples.

[0104] The fundamental function of the MscS is as a rapid on / off switch in response to mechanical stimuli (such as changes in membrane tension during osmosis). The cytoplasmic domain of the MscS functions as a molecular sieve to balance the loss of permeate during osmoadaptation. In the micropores of this invention, seven lateral pores originating from the cytoplasmic region play a crucial role in the translocation of ions and solutes. Therefore, the lateral pore mutants PaMscS1 (W130A) and PaMscS2 (K180R) were selected for subsequent research due to their low background noise. Figure 4 , Figure 6 AC). In electrophysiological experiments, purified proteins are added to the -cis terminus of the electrophysiological device (AC). Figure 8 A). When the PaMscS mutant channel is embedded in a lipid bilayer membrane (BLM, a type of insulating membrane), stable channel current jumps can be observed at a voltage of +50mV. Figure 8 B). The channel conductance of PaMscS1 remains stable within a voltage range of -50mV to +50mV. Figure 8 C), and when the voltage is above +90mV, the gating probability of PaMscS1 increases ( Figure 7 The conductivity of the PaMscS1 micropore was 0.64 ± 0.02 nS (n = 91, peak value of Gaussian fitting ± SD, -cis end: 300 mM NaCl, -trans end: 30 mM NaCl), and the conductivity distribution of the PaMscS2 micropore was 34.9 ± 7.0 pA (mean ± SD, from 18 independent insertion events). Figure 8 D). The ion transport results of PaMscS1 indicate that PaMscS1 has better selectivity for Br-. Figure 9 A significant difference in the blocking current distribution was observed between the two mutants, indicating that the translocation of dNTPs is related to the side pores of the PaMscS micropores. Figure 8E) That is, under the same detection conditions, the distribution of dNTP blocking current in PaMscS1 and PaMscS2 micropores shows different characteristics. Specifically, the PaMscS1 micropore shows three peaks in the blocking rate of the four dNTP mixtures, while the PaMscS2 micropore shows two peaks. Since the difference in mutations between PaMscS1 and PaMscS2 lies in the difference in amino acids in the side pores, it is speculated that the detection signal of dNTPs is related to the side pores.

[0105] Compared to currently reported nanoporous α-hemolysin containing am7βCD, MoS2, and α-Hederin, although the detection accuracy of the PaMscS1 nanopore is lower than that of the reported best bio-nanopore containing am7βCD conjugates (i.e., constructed using α-hemolysin mutant protein and 6-amino-6-deoxy-β-cyclodextrin aptamer), the translocation rate is comparable to that of solid-state nanopores. In single-stranded DNA (ssDNA) detection experiments, 50 μM ssDNA was detected under buffer conditions of 30 mM NaCl / 300 mM NaCl and a bias voltage of +50 mV. Due to its narrow channel size, no translocation events were observed. Figure 11 Therefore, the PaMscS mutant micropore has the potential to become a useful small molecule sensor.

[0106] Example 4

[0107] dNTP detection based on PaMscS micropores:

[0108] This embodiment relates to the detection of dNTPs using a porous membrane complex formed by a side-pore volume variant PaMscS1 (W130A) and an insulating film as an example.

[0109] Wild-type PaMscS micropores exhibit two peaks in the blocking rate of a mixture of four dNTPs ( Figure 16 ).

[0110] Considering the mechanical sensitivity of the PaMscS1 micropores, researchers adjusted their selectivity by applying different osmotic pressure differentials. To maintain the constant charge characteristics of dCTP and dGTP under different osmotic pressure differentials, the concentration of the conductivity buffer at the -cis end was kept at 300 mM, and the concentration of the conductivity buffer at the -trans end was varied to change the osmotic pressure differential. The detection capabilities of the PaMscS1 micropores for macromolecular dGTP and small molecule dCTP were tested under three osmotic pressure differential conditions, including symmetric conditions. Figure 10 A, 300mM NaCl / 300mM NaCl, +50mV bias voltage), low osmotic pressure differential conditions ( Figure 10B, 100mM NaCl / 300mM NaCl, +50mV bias voltage) and high osmotic pressure differential conditions ( Figure 10 C, 30mM NaCl / 300mM NaCl, +50mV bias voltage). Under symmetrical osmotic pressure conditions, the translocation frequency of dCTP ranges from 0.16±0.03s. -1 Increased to 0.22±0.07s -1 , while dGTP from 0.09±0.02s -1 The change was 0.07 ± 0.003 s. -1 Under low osmotic pressure differential (LOD) conditions, the translocation frequency of dCTP ranges from 0.34 ± 0.1 s. -1 Increased to 0.67±0.14s -1 , while dGTP from 0.06±0.01s -1 Increased to 0.3 ± 0.04 s -1 Under high osmotic pressure differential (HOD) conditions, the translocation frequency of dCTP ranges from 0.12 ± 0.04 s. -1 Increased to 0.22±0.07s -1 , while dGTP from 0.37±0.08s -1 Increased to 1.12 ± 0.12 s -1 ( Figure 10 D, n=3 for each experiment, mean ± SEM). Figure 10 E summarized the detection of dGTP and dCTP, and concluded that low osmotic pressure gradient conditions showed an increase in the highest number of dCTP dislocation events, while high osmotic pressure gradient conditions showed an increase in the highest number of dGTP dislocation events. Figure 10 (E) Compared to the reduced capture efficiency of dCTP under high osmotic pressure conditions, low osmotic pressure differential conditions show a balanced capture capacity for both dCTP and dGTP. Given that the size and charge properties of dGTP and dCTP remain constant under given experimental conditions, and that the channel size of the MScS family can vary under different pressures, osmotic pressure conditions, or membrane potentials, researchers can conclude that the difference in selectivity of PaMscS1 micropores for dNTPs is caused by variations in channel size under different osmotic pressure differential conditions.

[0111] Example 5

[0112] Electrophysiological detection based on EcMscS micropores

[0113] When wild-type EcMscS channels are embedded in a lipid bilayer (BLM), stable channel current jumps can be observed at a voltage of +100 mV. Figure 12 The wild-type EcMscS channel current remains stable across a voltage range of -100mV to +100mV. Figure 13 The conductivity of wild-type EcMscS micropores is 0.334 ± 0.028 nS (-cis end: 300 mM NaCl, -trans end: 30 mM NaCl). Figure 14 ). Figure 15 The structures of EcMscS, TtMscS, and HpMscS are shown in ac, which are highly similar to the structure of PaMscS, i.e., all are radially symmetric heptamer structures with a cylindrical shape. Furthermore, Figure 15 ac and Figure 5 Further comparison of the sequences of PaMscS with EcMscS, TtMscS, and HpMscS (sequence information is shown in Table 3 below) revealed that EcMscS, TtMscS, and HpMscS share some homology with PaMscS, but this homology is not highly homologous. EcMscS and PaMscS share only 60% similarity, yet both are capable of detecting analytes. Therefore, those skilled in the art will understand that the key factor determining whether bacterial MScS can serve as an analyte for micropore detection lies in its radially symmetrical, cylindrical heptamer structure and channel pore size, rather than merely homology.

[0114] Table 3: Amino acid sequence information of four MSCS

[0115] Example 6

[0116] Small molecule drug detection based on PaMscS micropores:

[0117] This example demonstrates the use of PaMscS3 (V271I) to detect neomycin sulfate (molecular weight MW: 712.72) and gentamicin sulfate (molecular weight MW: 561.65). Figure 17 The detection experiments for gentamicin sulfate and neomycin sulfate were conducted under electrolyte conditions of 300 mM NaCl (-cis end) and 30 mM NaCl (-trans end), 10 mM HEPES, and pH 7.0. The detection voltage was -50 mV. A significant blocking current signal appeared after the drugs were added to the detection system. Figure 17 A, 17B). The standard curve for gentamicin sulfate showed a linear detection range of 10 nM to 10 μM (N=3). A typical 2D density plot of the gentamicin sulfate signal showed a peak blocking current of 11.57 ± 0.02 pA and a peak residence time of 1.33 ± 0.02 ms. Figure 17C, the peak value of the Gaussian fit, 878 blocking events). The standard curve of neomycin sulfate shows a linear detection range of 100 nM to 100 μM (N=3), and the 2D density plot of a typical neomycin sulfate signal shows a peak blocking current of 9.44 ± 0.02 pA and a peak residence time of 1.06 ± 0.01 ms. Figure 17 D, the peak value of the Gaussian fit, 883 blocking events). Besides gentamicin sulfate and neomycin sulfate, the PaMscS micropore can also sense other drugs as single molecules, such as sisomicin (MW: 447.53) and pyrophosphate (MW: 177.975). To evaluate the accuracy of the PaMscS micropore in drug detection, LC-MS was used to measure the concentration of gentamicin sulfate. For a 1.5 μM gentamicin sulfate sample, the PaMscS3 micropore and LC-MS showed similar detection results, indicating that the PaMscS3 micropore has good accuracy in detection. Figure 17 E).

[0118] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention. SEQUENCE LISTING <110> Sichuan University Westlake University <120> A novel porous membrane composite based on a low-conductivity, mechanically sensitive channel <150> CN2021110062678 <151> 2021-08-30 <150> CN2021110062606 <151> 2021-08-30 <150> CN2021110042496 <151> 2021-08-30 <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 278 <212> PRT <213> Pseudomonas aeruginosa <400> 1 Met Glu Leu Asn Tyr Asp Arg Leu Val Gln Gln Thr Glu Ser Trp Leu 1 5 10 15 Pro Ile Val Leu Glu Tyr Ser Gly Lys Val Ala Leu Ala Leu Leu Thr 20 25 30 Leu Ala Ile Gly Trp Trp Leu Ile Asn Thr Leu Thr Gly Arg Val Gly 35 40 45 Gly Leu Leu Ala Arg Arg Ser Val Asp Arg Thr Leu Gln Gly Phe Val 50 55 60 Gly Ser Leu Val Ser Ile Val Leu Lys Ile Leu Leu Val Val Ser Val 65 70 75 80 Ala Ser Met Ile Gly Ile Gln Thr Thr Ser Phe Val Ala Ala Ile Gly 85 90 95 Ala Ala Gly Leu Ala Ile Gly Leu Ala Leu Gln Gly Ser Leu Ala Asn 100 105 110 Phe Ala Gly Gly Val Leu Ile Leu Leu Phe Arg Pro Phe Lys Val Gly 115 120 125 Asp Trp Ile Glu Ala Gln Gly Val Ala Gly Thr Val Asp Ser Ile Leu 130 135 140 Ile Phe His Thr Val Leu Arg Ser Gly Asp Asn Lys Arg Ile Ile Val 145 150 155 160 Pro Asn Gly Ala Leu Ser Asn Gly Thr Val Thr Asn Tyr Ser Ala Glu 165 170 175 Pro Val Arg Lys Val Ile Phe Asp Val Gly Ile Asp Tyr Asp Ala Asp 180 185 190 Leu Lys Asn Ala Gln Asn Ile Leu Leu Ala Met Ala Asp Asp Pro Arg 195 200 205 Val Leu Lys Asp Pro Ala Pro Val Ala Val Val Ser Asn Leu Gly Glu 210 215 220 Ser Ala Ile Thr Leu Ser Leu Arg Val Trp Val Lys Asn Ala Asp Tyr 225 230 235 240 Trp Asp Val Met Phe Met Phe Asn Glu Lys Ala Arg Asp Ala Leu Gly 245 250 255 Lys Glu Gly Ile Gly Ile Pro Phe Pro Gln Arg Val Val Lys Val Val 260 265 270 Gln Gly Ala Met Ala Asp 275 <210> 2 <211> 286 <212> PRT <213> Escherichia coli <400> 2 Met Glu Asp Leu Asn Val Val Asp Ser Ile Asn Gly Ala Gly Ser Trp 1 5 10 15 Leu Val Ala Asn Gln Ala Leu Leu Leu Ser Tyr Ala Val Asn Ile Val 20 25 30 Ala Ala Leu Ala Ile Ile Ile Val Gly Leu Ile Ile Ala Arg Met Ile 35 40 45 Ser Asn Ala Val Asn Arg Leu Met Ile Ser Arg Lys Ile Asp Ala Thr 50 55 60 Val Ala Asp Phe Leu Ser Ala Leu Val Arg Tyr Gly Ile Ile Ala Phe 65 70 75 80 Thr Leu Ile Ala Ala Leu Gly Arg Val Gly Val Gln Thr Ala Ser Val 85 90 95 Ile Ala Val Leu Gly Ala Ala Gly Leu Ala Val Gly Leu Ala Leu Gln 100 105 110 Gly Ser Leu Ser Asn Leu Ala Ala Gly Val Leu Leu Val Met Phe Arg 115 120 125 Pro Phe Arg Ala Gly Glu Tyr Val Asp Leu Gly Gly Val Ala Gly Thr 130 135 140 Val Leu Ser Val Gln Ile Phe Ser Thr Thr Met Arg Thr Ala Asp Gly 145 150 155 160 Lys Ile Ile Val Ile Pro Asn Gly Lys Ile Ile Ala Gly Asn Ile Ile 165 170 175 Asn Phe Ser Arg Glu Pro Val Arg Arg Asn Glu Phe Ile Ile Gly Val 180 185 190 Ala Tyr Asp Ser Asp Ile Asp Gln Val Lys Gln Ile Leu Thr Asn Ile 195 200 205 Ile Gln Ser Glu Asp Arg Ile Leu Lys Asp Arg Glu Met Thr Val Arg 210 215 220 Leu Asn Glu Leu Gly Ala Ser Ser Ile Asn Phe Val Val Arg Val Trp 225 230 235 240 Ser Asn Ser Gly Asp Leu Gln Asn Val Tyr Trp Asp Val Leu Glu Arg 245 250 255 Ile Lys Arg Glu Phe Asp Ala Ala Gly Ile Ser Phe Pro Tyr Pro Gln 260 265 270 Met Asp Val Asn Phe Lys Arg Val Lys Glu Asp Lys Ala Ala 275 280 285 <210> 3 <211> 282 <212> PRT <213> Thermoanaerobacter tengcongensis <400> 3 Met Trp Ala Asp Ile Tyr His Lys Leu Val Glu Ile Tyr Asp Ile Lys 1 5 10 15 Ala Val Lys Phe Leu Leu Asp Val Leu Lys Ile Leu Ile Ile Ala Phe 20 25 30 Ile Gly Ile Lys Phe Ala Asp Phe Leu Ile Tyr Arg Phe Tyr Lys Leu 35 40 45 Tyr Ser Lys Ser Lys Ile Gln Leu Pro Gln Arg Lys Ile Asp Thr Leu 50 55 60 Thr Ser Leu Thr Lys Asn Ala Val Arg Tyr Ile Ile Tyr Phe Leu Ala 65 70 75 80 Gly Ala Ser Ile Leu Lys Leu Phe Asn Ile Asp Met Thr Ser Leu Leu 85 90 95 Ala Val Ala Gly Ile Gly Ser Leu Ala Ile Gly Phe Gly Ala Gln Asn 100 105 110 Leu Val Lys Asp Met Ile Ser Gly Phe Phe Ile Ile Phe Glu Asp Gln 115 120 125 Phe Ser Val Gly Asp Tyr Val Thr Ile Asn Gly Ile Ser Gly Thr Val 130 135 140 Glu Glu Ile Gly Leu Arg Val Thr Lys Ile Arg Gly Phe Ser Asp Gly 145 150 155 160 Leu His Ile Ile Pro Asn Gly Glu Ile Lys Met Val Thr Asn Leu Thr 165 170 175 Lys Asp Ser Met Met Ala Val Val Asn Ile Ala Phe Pro Ile Asp Glu 180 185 190 Asp Val Asp Lys Ile Ile Glu Gly Leu Gln Glu Ile Cys Glu Glu Val 195 200 205 Lys Lys Ser Arg Asp Asp Leu Ile Glu Gly Pro Thr Val Leu Gly Ile 210 215 220 Thr Asp Met Gln Asp Ser Lys Leu Val Ile Met Val Tyr Ala Lys Thr 225 230 235 240 Gln Pro Met Gln Lys Trp Ala Val Glu Arg Asp Ile Arg Tyr Arg Val 245 250 255 Lys Lys Met Phe Asp Gln Lys Asn Ile Ser Phe Pro Tyr Pro Arg Thr 260 265 270 Thr Val Ile Leu Ser Glu Lys Lys Thr Asn 275 280 <210> 4 <211> 274 <212> PRT <213> Helicobactor pylori <400> 4 Met Asp Glu Ile Lys Thr Leu Leu Val Asp Phe Phe Pro Gln Ala Lys 1 5 10 15 His Phe Gly Ile Ile Leu Ile Lys Ala Val Ile Val Phe Cys Ile Gly 20 25 30 Phe Tyr Phe Ser Phe Phe Leu Arg Asn Lys Thr Met Lys Leu Leu Ser 35 40 45 Lys Lys Asp Glu Ile Leu Ala Asn Phe Val Ala Gln Val Thr Phe Ile 50 55 60 Leu Ile Leu Ile Ile Thr Thr Ile Ile Ala Leu Ser Thr Leu Gly Val 65 70 75 80 Gln Thr Thr Ser Ile Ile Thr Val Leu Gly Thr Val Gly Ile Ala Val 85 90 95 Ala Leu Ala Leu Lys Asp Tyr Leu Ser Ser Ile Ala Gly Gly Ile Ile 100 105 110 Leu Ile Ile Leu His Pro Phe Lys Lys Gly Asp Ile Ile Glu Ile Ser 115 120 125 Gly Leu Glu Gly Lys Val Glu Ala Leu Asn Phe Phe Asn Thr Ser Leu 130 135 140 Arg Leu His Asp Gly Arg Leu Ala Val Leu Pro Asn Arg Ser Val Ala 145 150 155 160 Asn Ser Asn Ile Ile Asn Ser Asn Asn Thr Ala Cys Arg Arg Ile Glu 165 170 175 Trp Val Cys Gly Val Gly Tyr Gly Ser Asp Ile Glu Leu Val His Lys 180 185 190 Thr Ile Lys Asp Val Ile Asp Thr Met Glu Lys Ile Asp Lys Asn Met 195 200 205 Pro Thr Phe Ile Gly Ile Thr Asp Phe Gly Ser Ser Ser Leu Asn Phe 210 215 220 Thr Ile Arg Val Trp Ala Lys Ile Glu Asp Gly Ile Phe Asn Val Arg 225 230 235 240 Ser Glu Leu Ile Glu Arg Ile Lys Asn Ala Leu Asp Ala Asn His Ile 245 250 255 Glu Ile Pro Phe Asn Lys Leu Asp Ile Ala Ile Lys Asn Gln Asp Ser 260 265 270 Ser Lys <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <400> 5 tagcttatca gactgatgtt ga 22

Claims

1. A membrane-porous complex comprising an angstrom embedded in an insulating membrane, the angstrom being an MscS variant angstrom having a radially symmetrical, cylindrical heptamer structure comprising seven lateral openings and one bottom opening, the MscS variant comprising a lateral pore volume variant and / or a lateral pore charge variant; the insulating membrane comprising a phospholipid membrane and / or a polymer membrane; the MscS variant angstrom being a PaMscS variant angstrom, the mutation site of the PaMscS variant angstrom being located at the lateral opening in the cytoplasmic region of the angstrom, the PaMscS variant angstrom comprising one or more of 130A, 180R, and 271I.

2. The porous membrane composite as described in claim 1, characterized in that, The charge properties and / or aperture size of the opening are adjustable. The adjustment of the opening includes subjecting the insulating membrane to mechanical stimulation and / or changing the physical state of the insulating membrane. The mechanical stimulation includes one or more of the following: changes in the osmotic pressure difference of the medium on both sides of the insulating membrane, direct physical stimulation of the insulating membrane by microparticles, and stimulation of the insulating membrane by negative air pressure.

3. The porous membrane composite as described in claim 1, characterized in that, The membrane-porous composite has a first medium and a second medium on its two sides, respectively, and the pore size of the opening is adjusted in the following manner: (1) Selection of the types of the first medium and the second medium; and / or (2) The osmotic pressure difference between the first medium and the second medium; The first medium and the second medium both include a conductive liquid; the conductive liquid is an aqueous solution of an alkali metal halide.

4. The porous membrane composite as described in claim 3, characterized in that, The aperture of the opening is adjustable in the range of 5-15 angstroms.

5. The porous membrane composite as described in claim 1, characterized in that, The micropore is divided into a transmembrane region and a cytoplasmic region; each monomer of the micropore includes an N-terminal transmembrane helix and a C-terminal cytoplasmic region, the N-terminal transmembrane helix includes TM1, TM2 and TM3, and the C-terminal cytoplasmic region includes an intermediate β domain and a COOH terminal domain.

6. The porous membrane composite as described in claim 5, characterized in that, The TM1 and TM2 are arranged together in an antiparallel direction, with the TM1 passing through the insulating film outside the channel and the TM2 forming a central layer, thereby forming a permeation path around the axis of the channel.

7. The use of the porous membrane complex according to any one of claims 1-6 in the preparation of molecular biosensors.

8. The application as described in claim 7, characterized in that, The angstrom provides a channel for the molecules to pass through the pore membrane complex, and the molecular biosensor senses the signals generated by the interaction between the molecules and the pore membrane complex.

Citation Information

Patent Citations

  • Living cell biosensor as well as preparation method and application thereof

    CN110954445A

  • Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions

    US20090283412A1