Monoclonal antibodies against respiratory syncytial virus and uses thereof

Abstract

The present invention relates to the field of immunology and molecular virology, in particular the field of diagnosis, prevention and treatment of respiratory syncytial virus. The present invention relates to anti-respiratory syncytial virus monoclonal antibodies, as well as kits and uses comprising said antibodies. The antibodies comprise complementarity determining regions 1-3 of a heavy chain variable region having the amino acid sequences of SEQ ID NOs: 1-3, respectively, and complementarity determining regions 1-3 of a light chain variable region having the amino acid sequences of SEQ ID NOs: 4-6, respectively. The antibodies of the present invention can be used for the diagnosis, prevention and treatment of respiratory syncytial virus infection or diseases caused by said infection (e.g. bronchiolitis, croup).

Description

Technical Field

[0001] This invention relates to the fields of immunology and molecular virology, to the diagnosis, prevention and treatment of respiratory syncytial virus (RSV), and more specifically to monoclonal antibodies against RSV, as well as kits containing said antibodies and their uses. Background Technology

[0002] Respiratory syncytial virus (RSV) causes acute lower respiratory tract infections and is a leading cause of illness and death in children worldwide. The hospitalization rate for RSV-related illnesses is three times higher than that for influenza or parainfluenza virus-related illnesses. High hospitalization rates are common in infants under 5 years old, with the highest incidence in 3-year-olds. RSV accounts for 6.7% of all infant deaths between 1 month and 1 year of age globally, making it the most common respiratory infection pathogen among preschool children, especially infants. The mortality rate for individuals with weakened immune systems, those aged 65 and older, and those with chronic lung disease is as high as 40% once infected with RSV.

[0003] Despite the serious threat RSV poses to global health, there are few preventative and treatment options for RSV infection, and vaccine development has been hampered by the worsening of symptoms caused by formalin-inactivated vaccines. Maternal antibodies are passed to the infant via the placenta in the last few weeks of pregnancy, providing protective immunity, but this protection diminishes by about two times each month and has poor durability. Currently, there are no vaccines or specific treatments. The only preventative measure is palizumab, approved in 1998. While it can reduce infant hospitalization and mortality rates to some extent, its immunomodulatory activity is poor, and its high frequency of use—requiring five immunizations for premature infants with congenital respiratory and circulatory disorders throughout the epidemic season—makes it unsuitable for all infants and limits prevention for high-risk infants. Therefore, there is an urgent need to develop vaccines and antibody therapeutics.

[0004] Respiratory syncytial virus (RSV) belongs to the Paramyxoviridae family and the Pneumovirus genus. It is a single-stranded, negative-sense RNA virus with two antigenic serotypes, A and B. The adsorption protein (G) and fusion protein (F) on the RSV surface are the only two antigens capable of inducing a neutralizing antibody response. The G protein is responsible for viral adhesion to the cell membrane surface, but it exhibits antigenic variability, making it difficult to develop a broad-spectrum protective drug. The F protein is responsible for viral fusion with the cell and exhibits more neutralizing antibody target epitopes. It is a key target for most vaccines and immunotherapies currently under development, and is also the target for the clinical prevention of RSV disease using palivizumab and motavizumab. The F protein has two conformations: pre-fusion and post-fusion. Most strong neutralizing epitopes are concentrated in the pre-fusion conformation of the F protein, therefore, antibodies capable of neutralizing the pre-fusion conformation of the F protein are urgently needed.

[0005] To date, neutralizing antibodies have proven to be an effective treatment for viral diseases. Currently marketed drugs for the treatment and prevention of viral infections include palivizumab (Synagis) for the prevention of respiratory syncytial virus (RSV) infection in children, elbalizumab (Trogarzo) for the treatment of HIV infection, and rabishield for post-exposure prophylaxis against rabies. In addition, several monoclonal antibodies targeting different viruses are in different stages of clinical trials (https: / / clinicaltrials.gov / ). Antibodies primarily function in two ways. First, neutralizing antibodies can block viral infection by binding to viral envelope proteins, thus blocking the binding of the virus to cell receptors. Second, antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) can recruit immune cells and molecules such as macrophages or complement receptors, thereby clearing free viruses and infected cells.

[0006] Therefore, there is a need to develop neutralizing antibodies against respiratory syncytial virus (RSV) to provide an effective means of preventing and treating RSV infection. Summary of the Invention

[0007] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the cell culture, molecular genetics, nucleic acid chemistry, and immunology laboratory procedures used herein are all standard procedures widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0008] As used herein, the term "antibody" refers to an immunoglobulin molecule typically composed of two pairs of polypeptide chains (each pair having one "light" (L) chain and one "heavy" (H) chain). Antibody light chains can be classified as κ and λ light chains. Heavy chains can be classified as μ, δ, γ, α, or ε, and antibody isotypes are defined as IgM, IgD, IgG, IgA, and IgE, respectively. Within both light and heavy chains, variable and constant regions are linked by "J" regions of approximately 12 or more amino acids, and the heavy chain also contains "D" regions of approximately 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain, CL. The constant regions of antibodies mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. The VH and VL regions can be further subdivided into highly degenerated regions (called complementarity-determining regions (CDRs)) interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs arranged in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4, from the amino terminus to the carboxyl terminus. The variable regions (VH and VL) of each heavy / light chain pair form the antibody binding sites. The allocation of amino acids to various regions or domains follows the definitions in Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:878-883. The term "antibody" is not limited to any particular method of antibody production. For example, it includes recombinant antibodies, monoclonal antibodies, and polyclonal antibodies. Antibodies can be different isotypes of antibodies, such as IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM antibodies.

[0009] As used herein, the term “antigen-binding fragment” of an antibody refers to a polypeptide containing a fragment of the full-length antibody that retains the ability to specifically bind to the same antigen bound by the full-length antibody and competes with the full-length antibody for specific binding to the antigen; this fragment is also referred to as the “antigen-binding moiety.” See also Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed., Raven Press, NY (1989), which is incorporated herein by reference in its entirety for all purposes. Antigen-binding fragments of antibodies can be generated by recombinant DNA technology or by enzymatic or chemical cleavage of the intact antibody. In some cases, antigen-binding fragments include Fab, Fab', F(ab')2, Fd, Fv, dAb, and complementarity-determining region (CDR) fragments, single-chain antibodies (e.g., scFv), chimeric antibodies, diabody antibodies, and polypeptides containing at least a portion of an antibody sufficient to confer specific antigen-binding ability to the polypeptide.

[0010] In some cases, the antigen-binding fragment of an antibody is a single-chain antibody (e.g., scFv), where the VL and VH domains pair to form a monovalent molecule by enabling them to generate linkers as single polypeptide chains (see, for example, Bird et al., Science 242:423 426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879 5883 (1988)). Such scFv molecules may have a general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH. Suitable prior art linkers consist of a repeating GGGGS amino acid sequence or a variant thereof. For example, a linker having the amino acid sequence (GGGGS)4 can be used, but variants thereof can also be used (Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90:6444-6448). Other connectors that can be used in this invention are described by Alfthan et al. (1995), Protein Eng. 8:725-731, Choi et al. (2001), Eur. J. Immunol. 31:94-106, Hu et al. (1996), Cancer Res. 56:3055-3061, Kipriyanov et al. (1999), J. Mol. Biol. 293:41-56 and Roovers et al. (2001), Cancer Immunol.

[0011] In some cases, the antigen-binding fragment of an antibody is a biantibody, i.e., a bivalent antibody, in which the VH and VL domains are expressed on a single polypeptide chain, but the linker is too short to allow pairing between the two domains on the same chain, thus forcing the domain to pair with the complementary domain of another chain and creating two antigen-binding sites (see, for example, Holliger P. et al., Proc. Natl. Acad. Sci. USA 90:6444 6448 (1993), and Poljak RJ et al., Structure2:1121 1123 (1994)).

[0012] Antigen-binding fragments (e.g., the antibody fragments described above) of a given antibody (e.g., the monoclonal antibody SAARI009 provided in this invention) can be obtained using conventional techniques known to those skilled in the art (e.g., recombinant DNA technology or enzymatic or chemical fragmentation methods), and the antigen-binding fragments of the antibody can be specifically screened in the same manner as those used for intact antibodies.

[0013] In this article, unless the context clearly indicates otherwise, when referring to the term "antibody," it includes not only the complete antibody but also the antigen-binding fragment of the antibody.

[0014] As used herein, the term "monoclonal antibody" refers to an antibody or a fragment of an antibody derived from a group of highly homologous antibody molecules—that is, a group of identical antibody molecules except for the possibility of spontaneous natural mutations. Monoclonal antibodies exhibit high specificity for a single epitope on an antigen. Polyclonal antibodies, as opposed to monoclonal antibodies, typically contain at least two or more different antibodies that typically recognize different epitopes on an antigen. Monoclonal antibodies are usually obtained using hybridoma techniques first reported by Kohler et al. (Nature, 256:495, 1975), but can also be obtained using recombinant DNA techniques (see Journal of Virological Methods, 2009, 158(1-2):171-179).

[0015] As used in this article, "neutralizing antibody" refers to an antibody or antibody fragment that can eliminate or significantly reduce the virulence (e.g., the ability to infect cells) of a target virus.

[0016] As used herein, the term "Escherichia coli expression system" refers to an expression system consisting of Escherichia coli (strain) and a vector, wherein the Escherichia coli (strain) is derived from commercially available strains, such as, but not limited to: GI698, ER2566, BL21(DE3), B834(DE3), BLR(DE3).

[0017] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0018] As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK293 cells, or human cells.

[0019] As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the reaction between an antibody and its target antigen. In some embodiments, an antibody that specifically binds to an antigen (or an antibody that is specific to an antigen) means that the antibody binds to an antigen at a concentration of less than about 10. -5 M, for example, less than approximately 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or lower affinity (KD) binds to the antigen.

[0020] As used herein, the term "KD" refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, which describes the binding affinity between the antibody and the antigen. A smaller equilibrium dissociation constant indicates a tighter antibody-antigen binding and a higher affinity between the antibody and the antigen. Typically, antibodies (e.g., the monoclonal antibodies RV8 and RV11 of this invention) have a KD of less than approximately 10-10. - 5 M, for example, less than approximately 10 -6M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or smaller dissociation equilibrium constant (KD) binds to antigens (e.g., respiratory syncytial virus F protein), for example, as determined in a BIACORE instrument using surface plasmon resonance (SPR).

[0021] In this invention, amino acids are typically represented using single-letter and three-letter abbreviations known in the art. For example, alanine can be represented by A or Ala.

[0022] As used herein, the term "neutralizing activity" refers to the functional activity of an antibody or antibody fragment to bind to antigenic proteins on a virus, thereby preventing the virus from infecting cells and / or maturing and / or releasing viral progeny. Antibodies or antibody fragments with neutralizing activity can prevent viral amplification, thereby inhibiting or eliminating viral infection.

[0023] As used in this article, the terms “respiratory syncytial virus” and “RSV” have the same meaning and are used interchangeably.

[0024] After extensive experimental research, the inventors discovered an antibody, SAARI009, which specifically recognizes and targets the F protein of respiratory syncytial virus (RSV), particularly the pre-fusion conformation of the F protein, demonstrating a highly efficient ability to neutralize the virus. Therefore, the antibody of this invention is particularly suitable for the diagnosis, prevention, and treatment of RSV infection or diseases associated with RSV infection (e.g., bronchiolitis, croup).

[0025] In a first aspect of this application, a monoclonal antibody (SAARI009) or an antigen-binding fragment thereof is provided, comprising: heavy chain variable region (VH) complementarity-determining regions 1-3 (CDR1-3) as shown in SEQ ID NO:1-3; and light chain variable region (VL) complementarity-determining regions 1-3 (CDR1-3) as shown in SEQ ID NO:4-6.

[0026] (CDR of the variable region)

[0027] In some preferred embodiments, the monoclonal antibody SAARI009 includes a heavy chain variable region (VH) as shown in SEQ ID NO:7 and a light chain variable region (VL) as shown in SEQ ID NO:8.

[0028] In some preferred embodiments, the monoclonal antibody also has a leader sequence at the N-terminus of the heavy chain variable region. In some preferred embodiments, the SAARI009 leader sequence has the amino acid sequence shown in SEQ ID NO:11. (Leader sequence)

[0029] In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment is selected from Fab, Fab', F(ab')2, Fd, Fv, dAb, complementarity-determining region fragments, single-chain antibodies (e.g., scFv), human antibodies, chimeric antibodies, or bispecific or multispecific antibodies.

[0030] In some preferred embodiments, the monoclonal antibody SAARI009 further includes the amino acid sequence of the heavy chain constant region (CH) as shown in SEQ ID NO:9 and the amino acid sequence of the light chain constant region (CL) as shown in SEQ ID NO:10.

[0031] In some preferred embodiments, the light chain of the monoclonal antibody is of the κ type.

[0032] In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment can specifically bind to the pre-fusion conformation of the respiratory syncytial virus (RSV) fusion protein (F protein). In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment can target the post-fusion conformation of the RSV fusion protein (F protein). In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment can inhibit the F protein-mediated membrane fusion process, thereby inhibiting viral infection of cells.

[0033] In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment has neutralizing capability (e.g., capable of neutralizing respiratory syncytial virus). In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment is capable of inhibiting respiratory syncytial virus infection or entry into host cells. Thus, the monoclonal antibody or its antigen-binding fragment can neutralize respiratory syncytial virus, thereby preventing and treating respiratory syncytial virus infection.

[0034] This application also provides isolated nucleic acid molecules encoding the monoclonal antibody or its antigen-binding fragment of the present invention. Such nucleic acid molecules are not limited by the method of their production and can be obtained using genetic engineering recombination techniques or chemical synthesis methods.

[0035] Therefore, in another aspect, the present invention provides isolated nucleic acid molecules comprising a nucleotide sequence capable of encoding an antibody heavy chain variable region (VH), wherein the antibody SAARI009 heavy chain variable region has a nucleotide sequence as shown in SEQ ID NO:12.

[0036] In another aspect, the present invention provides isolated nucleic acid molecules comprising a nucleotide sequence capable of encoding an antibody light chain variable region (VL), wherein the antibody SAARI009 light chain variable region has a nucleotide sequence as shown in SEQ ID NO:13.

[0037] In a preferred embodiment, the nucleic acid molecule further comprises a nucleotide sequence encoding a leader sequence located at the 5' end of the nucleotide sequence capable of encoding the antibody heavy chain variable region. In some preferred embodiments, the antibody SAARI009 leader sequence has a nucleotide sequence as shown in SEQ ID NO:16.

[0038] In some preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide comprising a nucleotide sequence encoding a leader sequence and a nucleotide sequence capable of encoding the antibody heavy chain variable region; and a second polynucleotide comprising a nucleotide sequence encoding a leader sequence and a nucleotide sequence capable of encoding the antibody light chain variable region.

[0039] In some preferred embodiments, the isolated SAARI009 nucleic acid molecule comprises a first polynucleotide comprising a nucleotide sequence as shown in SEQ ID NO:16 and a nucleotide sequence as shown in SEQ ID NO:12; and a second polynucleotide comprising a nucleotide sequence as shown in SEQ ID NO:16 and a nucleotide sequence as shown in SEQ ID NO:13.

[0040] In some preferred embodiments, the isolated nucleic acid molecule further comprises a nucleotide sequence capable of encoding the antibody heavy chain constant region. In some preferred embodiments, the nucleotide sequence in SAARI009 capable of encoding the antibody heavy chain constant region has the nucleotide sequence shown in SEQ ID NO:14.

[0041] In some preferred embodiments, the isolated nucleic acid molecule further comprises a nucleotide sequence capable of encoding the constant region of the antibody light chain. In some preferred embodiments, the nucleotide sequence in SAARI009 capable of encoding the constant region of the antibody light chain has the nucleotide sequence shown in SEQ ID NO:15.

[0042] In some preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide comprising a nucleotide sequence encoding a leader sequence, a nucleotide sequence encoding a variable region of the antibody heavy chain, and a nucleotide sequence encoding a constant region of the antibody heavy chain; and a second polynucleotide comprising a nucleotide sequence encoding a leader sequence, a nucleotide sequence encoding a variable region of the antibody light chain, and a nucleotide sequence encoding a constant region of the antibody light chain.

[0043] In some preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide, wherein the first polynucleotide in SAARI009 comprises a nucleotide sequence as shown in SEQ ID NO:16, SEQ ID NO:12 and SEQ ID NO:14; and a second polynucleotide, wherein the second polynucleotide in SAARI009 comprises a nucleotide sequence as shown in SEQ ID NO:16, SEQ ID NO:13 and SEQ ID NO:15.

[0044] In some preferred embodiments, the monoclonal antibody SAARI009 comprises: VH CDR1-3 as shown in SEQ ID NO:1-3, VL CDR1-3 as shown in SEQ ID NO:4-6, VH as shown in SEQ ID NO:7, VL as shown in SEQ ID NO:8, CH as shown in SEQ ID NO:9, and CL as shown in SEQ ID NO:10. Specifically, the amino acid sequence of VH CDR1 is ADTFTNYW (SEQ ID NO:1), the amino acid sequence of VH CDR2 is IYPGDSDT (SEQ ID NO:2), and the amino acid sequence of VH CDR3 is ARQVGGVVTTEDNNYLYGMDV (SEQ ID NO:3); the amino acid sequence of VL CDR1 is QSISTF (SEQ ID NO:4), the amino acid sequence of VL CDR2 is DTD (SEQ ID NO:5), and the amino acid sequence of VLCDR3 is QQSRFIPII (SEQ ID NO:6).

[0045] In another aspect, the present invention provides a vector comprising isolated nucleic acid molecules as defined above. The vector of the present invention can be a cloning vector or an expression vector. In some preferred embodiments, the vector of the present invention is, for example, a plasmid, a granule, a bacteriophage, etc.

[0046] In another aspect, host cells comprising the isolated nucleic acid molecules or vectors of the present invention are also provided. Such host cells include, but are not limited to, prokaryotic cells such as *Escherichia coli* cells, and eukaryotic cells such as yeast cells, insect cells, plant cells, and animal cells (such as mammalian cells, such as mouse cells, human cells, etc.). The cells of the present invention can also be cell lines, such as 293T cells.

[0047] In another aspect, a method for preparing the monoclonal antibody or antigen-binding fragment thereof of the present invention is also provided, comprising culturing the host cell of the present invention under suitable conditions, and recovering the monoclonal antibody or antigen-binding fragment thereof of the present invention from the cell culture.

[0048] In another aspect, the present invention provides a kit comprising the monoclonal antibody of the present invention or an antigen-binding fragment thereof. In some preferred embodiments, the monoclonal antibody of the present invention or an antigen-binding fragment thereof further comprises a detectable label. In some preferred embodiments, the kit further comprises a second antibody that specifically recognizes the monoclonal antibody of the present invention or an antigen-binding fragment thereof. Preferably, the second antibody further comprises a detectable label. Such detectable labels are well known to those skilled in the art and include, but are not limited to, radioisotopes, fluorescent substances, luminescent substances, colored substances, and enzymes (e.g., horseradish peroxidase).

[0049] In another aspect, the present invention provides a method for detecting the presence or level of respiratory syncytial virus (RSV) or its F protein in a sample, comprising using a monoclonal antibody or its antigen-binding fragment of the present invention. In some preferred embodiments, the monoclonal antibody or its antigen-binding fragment of the present invention further includes a detectable label. In another preferred embodiment, the method further includes using a second antibody carrying a detectable label to detect the monoclonal antibody or its antigen-binding fragment of the present invention. The method can be used for diagnostic purposes (e.g., the sample is from a patient) or for non-diagnostic purposes (e.g., the sample is a cell sample, not from a patient).

[0050] In another aspect, the present invention provides a method for diagnosing whether a subject is infected with respiratory syncytial virus (RSV), comprising: detecting the presence of RSV or its F protein in a sample from said subject using a monoclonal antibody or antigen-binding fragment of the present invention. In some preferred embodiments, the monoclonal antibody or antigen-binding fragment of the present invention further includes a detectable marker. In another preferred embodiment, the method further includes using a second antibody carrying a detectable marker to detect the monoclonal antibody or antigen-binding fragment of the present invention or an anti-idiotype antibody.

[0051] In another aspect, the use of the monoclonal antibody or its antigen-binding fragment or anti-idiotype antibody of the present invention in the preparation of a kit for detecting the presence or level of respiratory syncytial virus or its F protein in a sample, or for diagnosing whether a subject is infected with respiratory syncytial virus.

[0052] In some preferred embodiments, the sample includes, but is not limited to, excrement, oral or nasal secretions, bronchoalveolar lavage fluid, etc., from a subject (e.g., a mammal, preferably a human).

[0053] General methods for detecting the presence or level of a target virus or antigen (e.g., respiratory syncytial virus or its F protein) in a sample using antibodies or their antigen-binding fragments are well known to those skilled in the art. In some preferred embodiments, the detection method may use enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay, chemiluminescent immunoassay, radioimmunoassay, fluorescence immunoassay, immunochromatography, competitive assays, and similar methods.

[0054] In another aspect, the present invention provides a pharmaceutical composition comprising the monoclonal antibody of the present invention or an antigen-binding fragment thereof, and a pharmaceutically acceptable carrier and / or excipient.

[0055] In another aspect, the present invention provides a method for neutralizing the virulence of respiratory syncytial virus (RSV) in a sample, comprising contacting a sample containing RSV with a monoclonal antibody or an antigen-binding fragment thereof of the present invention. Such methods can be used for therapeutic purposes or non-therapeutic purposes (e.g., the sample is a cell sample, rather than a patient or a sample from a patient).

[0056] In another aspect, the use of the monoclonal antibody or antigen-binding fragment thereof of the present invention for the preparation of a medicament for neutralizing the virulence of respiratory syncytial virus in a sample is provided.

[0057] In another aspect, the use of the monoclonal antibody or its antigen-binding fragment or anti-idiotype antibody of the present invention in the preparation of a pharmaceutical composition for the prevention or treatment of respiratory syncytial virus infection or a disease associated with respiratory syncytial virus infection (e.g., bronchiolitis, croup) in a subject is provided.

[0058] In another aspect, the present invention provides a method for preventing or treating respiratory syncytial virus infection or respiratory syncytial virus-related diseases (e.g., bronchiolitis, croup) in a subject, comprising administering to the subject in need a preventive or therapeutically effective amount of a monoclonal antibody of the present invention or an antigen-binding fragment thereof, or a pharmaceutical composition of the present invention.

[0059] The monoclonal antibody or its antigen-binding fragment, or the pharmaceutical composition of the present invention, can be administered to a subject via any suitable route of administration. Such routes of administration include, but are not limited to, oral, oral, sublingual, topical, parenteral, rectal, intrathecal, or nasal routes.

[0060] The pharmaceuticals and pharmaceutical compositions provided by this invention can be used alone or in combination, or in combination with other pharmaceutically active agents (e.g., antiviral drugs). In some preferred embodiments, the pharmaceutical compositions further contain a pharmaceutically acceptable carrier.

[0061] Information on some of the sequences involved in this application is shown in Table 1 below.

[0062] Table 1. Information on partial sequences

[0063]

[0064]

[0065]

[0066] Beneficial effects

[0067] The monoclonal antibody of this application can bind to the respiratory syncytial virus (RSV) F protein with high affinity and exhibits strong neutralizing activity against RSV. For example, the SAARI009 antibody of this invention has an affinity ≤0.0032 nM for the pre-fusion conformation of the A2 strain F protein, does not bind to the post-fusion conformation of the F protein, and has a neutralizing titer (half-inhibitory concentration, IC50) against RSV. 50 The concentration was 0.02 ng / mL. Therefore, the monoclonal antibody SAARI009 of this application has clinical application value in the prevention and treatment of respiratory syncytial virus infection. Attached Figure Description

[0068] Figure 1 The results of molecular sieve chromatography and SDS-PAGE analysis of the pre-fusion conformation of the respiratory syncytial virus (RSV) F protein are shown.

[0069] Figure 2 The molecular sieve chromatography and SDS-PAGE results of the recombinant SAARI009 antibody are shown. In the gel image, "-DTT" indicates no DTT was added (non-reducing SDS-PAGE); "+DTT" indicates DTT was added (reducing SDS-PAGE).

[0070] Figure 3 The results of the kinetic curves of the binding of the SAARI009 antibody to the F protein are shown.

[0071] Figure 4 The neutralizing activity of different concentrations of SAARI009 antibody against live RSV virus was demonstrated. Detailed Implementation

[0072] The invention will now be described with reference to the following embodiments, which are intended to illustrate the invention (and not limit it).

[0073] To obtain a neutralizing antibody with protective efficacy, the inventors of this application first used the RSV transient expression F protein DS-Cav1 from 293F cells as an antigen. Memory B cells capable of specifically binding to the F protein DS-Cav1 were screened from peripheral blood mononuclear cells (PBMCs) of healthy adults using flow cytometry. Then, RT-PCR was performed on the selected single B cells to obtain the sequence encoding the antibody's variable region. Further, the sequence encoding the antibody's variable region was ligated into an expression vector along with the constant region gene, and expressed and purified in mammalian cells to obtain the antibody SAARI009. A series of functional tests on antibody SAARI009 showed that it specifically binds to the pre-fusion conformation of the F protein, inhibiting RSV infection of human cells and exhibiting neutralizing activity against RSV infection.

[0074] Unless otherwise specified, the molecular biology experimental methods and immunoassays used in the following examples are generally performed in accordance with the methods described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F.M. Usubel et al., A Concise Guide to Molecular Biology, 3rd Edition, John Wiley & Sons, Inc., 1995; the use of restriction endonucleases is in accordance with the conditions recommended by the product manufacturer. Where specific conditions are not specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the present invention.

[0075] Example 1: Expression and purification of RSV viral F protein

[0076] Using NdeI and XhoI enzymes, a DNA fragment encoding the RSV strain F protein DS-Cav1 (its amino acid sequence is shown in SEQ ID NO:17) was ligated into the pCAGGS vector. The DNA fragment also contained a nucleotide sequence encoding a 6*histidine tag (6*His tag) and a stop codon at the 3' end of the coding region. The ligation product was transformed into DH5α *E. coli* competent cells. Single colonies were then picked and inoculated into 5 mL of LB medium and cultured for 6–8 hours; subsequently, they were transferred to 300 mL of LB medium and cultured for 12–16 hours. Cells were collected, and the DS-Cav1 plasmid was extracted using an endotoxin-free plasmid extraction kit (TIANGEN). The extracted plasmid was transfected into 293F cells to express the F protein. The F protein was then purified by affinity chromatography and molecular sieve chromatography, using AKTA-purifier (GE) and Histrap... TMHP, Superdex 200 Hiload 10 / 300 column (GE), and buffers A (20mM Tris, 150mM NaCl, pH 8.0) and B (20mM Tris, 150mM NaCl, 1M Minazole, pH 8.0) were used. During purification, the UV absorbance at 280nm was monitored, and fractions containing the target protein were collected. After purification, the purity of the target protein (DS-Cav1) was determined by SDS-PAGE. Results are as follows: Figure 1 As shown. Figure 1 The results showed that high-purity F protein (DS-Cav1) was obtained, with a monomer size of 50 kDa.

[0077] Example 2: Isolation of memory B cells that specifically recognize F protein

[0078] With informed consent from healthy volunteers, 20 mL of blood was collected for PBMCs isolation. The isolated PBMCs were then processed at a ratio of 1*102. 7 DS-Cav1 protein (prepared as in Example 1) at a density of 1 / mL was incubated on ice for half an hour to bind to a final concentration of 400 nM. The PBMCs were then washed twice with PBS (containing 2% FBS) and incubated with the following antibodies (all purchased from BD): anti-human CD3 / PE-Cy5, anti-human CD16 / PE-Cy5, anti-human CD235a / PE-Cy5, anti-human CD19 / APC-Cy7, anti-human CD27 / Pacific Blue, anti-human CD38 / APC, anti-human IgG / FITC, and anti-His / PE. After incubation on ice for half an hour, the PBMCs were washed twice with PBS (containing 2% FBS). Subsequently, the PBMCs were sorted using FACSAria III, and PE was collected. - Cy5 - APC - APC - Cy7 + Pacific Blue + FITC + PE + The cells (i.e. B cells) were collected directly into 96-well plates at a density of 1 cell / well.

[0079] Example 3: Isolation and Identification of SAARI009 Antibody

[0080] The B cells obtained in Example 2 were reverse transcribed using Superscript III reverse transcriptase (Invitrogen) (at 55°C for 60 minutes), and the reverse transcription primers used are shown in Table 2.

[0081] Table 2. Sequence information of the reverse transcription primers used

[0082] IgM-RT(SEQ) ATGGAGTCGGGAAGGAAGTC IgD-RT TCACGGACGTTGGGTGGTA IgE-RT TCACGGAGGTGGCATTGGA IgA1-RT CAGGCGATGACCACGTTCC IgA2-RT CATGCGACGACCACGTTCC IgG-RT AGGTGTGCACGCCGCTGGTC Cκ-new RT GCAGGCACACAACAGAGGCA Cλ-new-ext AGGCCACTGTCACAGCT

[0083] Using the reverse transcription product as a template, a first round of PCR (PCRa) was performed using HotStar Tap Plus enzyme (QIAgen) to amplify the sequence of the antibody variable region. The primers used are shown in Table 3. The reaction conditions were as follows: 95℃, 5 min; 35 cycles (95℃ 30 s, 55℃ (heavy chain / κ chain) 30 s, 72℃ 90 s); 72℃, 7 min. Subsequently, a second round of PCR (PCRb) was performed using the amplified product as a template. The primers used are shown in Table 4. The reaction conditions were as follows: 95℃, 5 min; 35 cycles (95℃ 30 s, 58℃ (heavy chain) / 60℃ (κ chain) / 64℃ (λ chain) 30 s, 72℃ 90 s); 72℃, 7 min.

[0084] PCR products were separated by 1% agarose gel electrophoresis. PCR products with band sizes of 400-500 bp were recovered and sent to a sequencing company for sequencing. Sequencing results were analyzed using NCBI online software.

[0085] Sequence determination yielded the sequence of an antibody, named SAARI009. The amino acid sequence of the heavy chain variable region of the SAARI009 antibody is shown in SEQ ID NO:7 (encoding gene shown in SEQ ID NO:12), and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:8 (encoding gene shown in SEQ ID NO:13). The sequence identity of the SAARI009 antibody with the germline gene is shown in Tables 5-6 below.

[0086] Table 3. Primers used in the first round of PCR (PCRa)

[0087] VH1-Ext CCATGGACTGGACCTGGAGG VH2-Ext ATGGACATACTTTGTTCCA VH3-Ext CCATGGAGTTTGGGCTGAGC VH4-Ext ATGAAACACCTGTGGTTCTT VH5-Ext ATGGGGTCAACCGCCATCCT VH6-Ext ATGTCTGTCTCCTTCCTCAT IgG-Ext CGCCTGAGTTCCACGACACC Vκ1-2-Ext GCTCAGCTCCTGGGGCT Vκ3-Ext GGAARCCCCAGCDCAGC Vκ4-5-Ext CTSTTSCTYTGGATCTCTG Vκ6-7-Ext CTSCTGCTCTGGGYTCC Cκ-Ext GAGGCAGTTCCAGATTTCAA Vλ1-Ext CCTGGGCCCAGTCTGTG Vλ2-Ext CTCCTCASYCTCCTCACT Vλ3-Ext GGCCTCCTATGWGCTGAC Vλ31-Ext GTTCTGTGGTTTCTTCTGAGCTG Vλ4ab-Ext ACAGGGTCTCTCTCCCAG Vλ4c-Ext ACAGGTCTCTGTGCTCTGC Vλ5-9-Ext CCCTCTCSCAGSCTGTG Vλ6-Ext TCTTGGGCCAATTTTATGC Vλ7-8-Ext ATTCYCAGRCTGTGGTGAC Vλ10-Ext CAGTGGTCCAGGCAGGG Cλ-new-Ext AGGCCACTGTCACAGCT

[0088] Table 4. Primers used in the second round of PCR (PCRb)

[0089]

[0090]

[0091] Table 5. Comparison of SAARI009 antibody heavy chain and germline genes

[0092] SAARI009 5-51*01 3-3*01 6*04 93.2％

[0093] Table 6. Comparison of SAARI009 antibody light chain and germline genes

[0094] SAARI009 1-39*01 5*01 92.60％

[0095] The nucleotide sequences encoding the variable regions of the heavy / light chains were ligated to the corresponding nucleotide sequences encoding the constant regions of the heavy / κ chains using bridged PCR, and then cloned into the expression vector pCAGGS (purchased from Addgene) to obtain recombinant expression vectors encoding the antibody heavy and light chains, respectively. The construction schemes for the heavy and light chain expression constructs are as follows:

[0096] Heavy chain coding sequence (5'-3'): CMV promoter - EcoR I restriction site - leader sequence gene - VH gene - CH gene - Xho I restriction site;

[0097] Light chain (κ) coding sequence (5'-3'): CMV promoter - Sac I restriction site - leader sequence gene - VL gene - CL(κ) gene - Xho I restriction site;

[0098] The amino acid sequence of the leader sequence is shown in SED ID NO:11 (encoding gene is shown in SEQ ID NO:16), the amino acid sequence of CH is shown in SED ID NO:9 (encoding gene is shown in SEQ ID NO:14), and the amino acid sequence of CL is shown in SED ID NO:10 (encoding gene is shown in SEQ ID NO:15).

[0099] Example 4: Expression and purification of SAARI009 antibody

[0100] 293F cells were used. 293F cells were co-transfected with the recombinant expression vectors encoding the heavy and light chains of the antibodies obtained in Example 3. Feed was added at 24 and 72 hours, and the cells were cultured for 6 days. The supernatant was then collected.

[0101] The collected supernatant was centrifuged at 8000 rpm for 120 min, then mixed with an equal volume of buffer containing 20 mM sodium phosphate (pH 7.0), filtered through a 0.22 μm filter membrane, and loaded into a pre-packed protein A column (5 mL, GE Healthcare). Proteins bound to the pre-packed column were eluted with 100 mM glycine (pH 3.0). The eluted protein was concentrated and then purified by molecular sieve chromatography. Subsequently, the purified target protein was detected by SDS-PAGE (reducing and non-reducing). Under non-reducing conditions, the antibody showed a single band in SDS-PAGE; under reducing conditions, the Fc disulfide bonds of the antibody were opened, resulting in two bands. The antibody purity exceeded 95%, as shown in the results. Figure 2 As shown.

[0102] Example 5: Evaluation of the binding ability of SAARI009 antibody to F protein

[0103] In this embodiment, molecular interaction analysis is performed using BLI (BioFort Octet). The specific steps are as follows:

[0104] First, DS-Cav1 was immobilized on NTA-Ni sensors at 50 μg / mL. Then, purified SAARI009 antibody was bound via antibody capture. Additionally, the SAARI009 antibody was serially diluted with PBST (containing 0.05% Tween-20). The serially diluted antibody was then added sequentially to each well of a 96-well plate (starting with the lowest concentration). The kinetic curve of SAARI009 antibody binding to DS-Cav1 protein was recorded. Figure 3 The kinetic constants were calculated using BLI data software, and the KD of the binding kinetic constant between the SAARI009 antibody and the F protein was found to be 6.175E-11. (R) 2 (0.9999). The results showed that the SAARI009 antibody could bind to the F protein of RSV with high affinity.

[0105] Example 6: Evaluation of the ability of SAARI009 antibody to neutralize live RSV virus

[0106] The purified SAARI009 antibody from Example 4 was serially diluted from 25 μg / mL to the 11th gradient (0.0098 μg / mL), and then each diluted with half-maximum tissue culture infection dose (TCID50). 50BetaCoV / Shenzhen / SZTH-003 / 2020 virus (obtained from the Third People's Hospital of Shenzhen, GISAID: EPI_ISL_406594) was mixed and incubated at 37°C for 1 hour. After incubation, the virus was added to 96-well plates pre-inoculated with Hep-2 cells and incubated for 3 hours. DMEM (containing 2% FBS) medium was added and the plates were incubated at 37°C in a 5% CO2 incubator for 4 days. Cytopathic effect (CPE) was observed, and the neutralizing titer of SAARI009 antibody was calculated. Results are as follows. Figure 4 As shown. Figure 4 This study compares the neutralizing activity of different concentrations of SAARI009 antibody against live RSV virus with that of palivizumab / Nirsevimab. The results show that the neutralizing titers (half-inhibitory concentration, IC50) of SAARI009 antibody against live A2 and B viruses... 50 The concentrations were 20 ng / mL and 120 ng / mL.

Claims

1. A monoclonal antibody or antigen-binding fragment thereof that specifically recognizes and targets the F protein of respiratory syncytial virus, comprising a heavy chain and a light chain, characterized in that, The heavy chain contains complementary determination regions 1-3 of the variable region of the heavy chain, as shown in SEQ ID NO:1-3; the light chain contains complementary determination regions 1-3 of the variable region of the light chain, as shown in SEQ ID NO:4-6.

2. The monoclonal antibody or its antigen-binding fragment as described in claim 1, characterized in that, The monoclonal antibody also has a leader sequence at the N-terminus of the heavy chain variable region and a leader sequence at the N-terminus of the light chain variable region.

3. The monoclonal antibody or its antigen-binding fragment as described in claim 2, characterized in that, The amino acid sequence of the leader sequence is shown in SEQ ID NO:

11.

4. An isolated nucleic acid molecule encoding the monoclonal antibody or its antigen-binding fragment as described in any one of claims 1 to 3.

5. A carrier comprising the isolated nucleic acid molecule of claim 4.

6. A host cell comprising the isolated nucleic acid molecule of claim 4 or the vector of claim 5.

7. A kit comprising the monoclonal antibody or antigen-binding fragment thereof as described in any one of claims 1 to 3.

8. The kit according to claim 7, characterized in that, The monoclonal antibody or its antigen-binding fragment further includes a detectable marker selected from radioactive isotopes, fluorescent substances, chemiluminescent substances, colored substances, or enzymes.

9. The kit according to claim 7, characterized in that, The kit also includes a second antibody that specifically recognizes the monoclonal antibody or its antigen-binding fragment; and the second antibody also includes a detectable marker selected from radioactive isotopes, fluorescent substances, chemiluminescent substances, colored substances or enzymes.

10. A method for detecting the presence or level of respiratory syncytial virus or its F protein in a sample for non-diagnostic purposes, comprising detection using a monoclonal antibody or its antigen-binding fragment as described in any one of claims 1 to 3.

11. The method as described in claim 10, characterized in that, The monoclonal antibody or its antigen-binding fragment includes a detectable marker; The method further includes using a second antibody carrying a detectable label to detect the monoclonal antibody or its antigen-binding fragment, wherein the detectable label is selected from radioactive isotopes, fluorescent substances, chemiluminescent substances, colored substances, or enzymes.

12. The method as described in claim 11, characterized in that, The sample is excrement, oral or nasal secretions from mammals in the environment; the sample is not a cell sample from the patient.

13. The method as described in claim 12, characterized in that, The detection methods used include enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay, chemiluminescence immunoassay, radioimmunoassay, fluorescence immunoassay, immunochromatography, and competitive methods.

14. A pharmaceutical composition comprising a monoclonal antibody or an antigen-binding fragment thereof of any one of claims 1 to 3, and a pharmaceutically acceptable carrier.

15. The pharmaceutical composition according to claim 14, characterized in that, The pharmaceutical composition also contains other pharmaceutically active agents.

16. The pharmaceutical composition of claim 15, characterized in that, Other pharmaceutically active agents are selected from favipiravir, remdesivir, or interferon.

17. Use of the monoclonal antibody of any one of claims 1 to 3 or the antigen-binding fragment thereof for the preparation of a medicament for neutralizing the virulence of respiratory syncytial virus in a sample, or for preventing or treating respiratory syncytial virus infection in a subject.

18. The use as described in claim 17, characterized in that, The subjects were mammals; The drug may be used alone or in combination with other pharmaceutically active agents.

19. The use as described in claim 18, characterized in that, The other pharmaceutically active agents mentioned are favipiravir, remdesivir, or interferon.

20. The use as described in claim 19, characterized in that, The drug can be administered orally, orally, rectally, or nasally.

Images