White fungus strain, fruiting body and culture method and application thereof

Abstract

The present application relates to white fungus strain, fruiting body and culture method and application thereof, belong to edible fungus technical field;The preservation number of the white fungus strain is GDMCC NO:61908.Its advantages are that the white fungus strain provided by the present application is SCAR molecular marker for specific DNA fragment with size 702bp, compared with existing WB-61 white fungus variety, the white fungus cultivated by the white fungus strain provided by the present application is completely different in growth, the stem is thick, the cap is thick and solid, there is no tumor cap, the taste is crisp, the average single bottle yield is high, the biological conversion rate is high;The culture and cultivation cycle is short, the conversion rate of raw materials and the production efficiency of factory can be greatly improved, and the cost is reduced, the energy consumption is saved;The appearance characteristics are excellent, the mushroom shape is neat and no tumor cap appears, the A product rate is high in production, which is more conducive to product packaging and sales;The comprehensive performance is good, and has broad market prospect.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, and in particular to white jade mushroom strains, fruiting bodies, cultivation methods, and applications. Background Technology

[0002] White jade mushroom, also known as white snow mushroom, white crab mushroom, white true shiitake mushroom, seafood mushroom, or spotted jade mushroom, belongs to the order Agaricales, family Tricholomataceae, and genus Jade mushroom. It is a rare edible fungus.

[0003] White jade mushrooms have a delicate texture, are crisp, tender, and smooth, and have a sweet and delicious taste. They are a top-quality delicacy highly favored in domestic and international markets and are considered the "golden branches and jade leaves" among edible fungi. White jade mushrooms have analgesic, sedative, antitussive, expectorant, laxative, detoxifying, and blood pressure-lowering effects.

[0004] White jade mushrooms have a higher protein content than most vegetables, containing a suitable ratio of essential amino acids and various trace elements necessary for the human body. Long-term consumption of white jade mushrooms can provide excellent health benefits. Furthermore, white jade mushrooms are rich in nutrients, containing abundant polysaccharides and various vitamins. Regular consumption can improve metabolism and lower cholesterol levels. White jade mushrooms also contain indigestible crude fiber, semi-crude fiber, and lignin. Long-term consumption can maintain intestinal water balance and absorb excess cholesterol and sugar, then excrete them from the body, offering significant benefits in preventing constipation, colon cancer, arteriosclerosis, and diabetes. In addition, extracts from white jade mushrooms, especially the fruiting body (the part above the culture medium), contain various physiologically active ingredients. The polysaccharides, purines, and adenosine in these mushrooms can enhance immunity and promote antibody formation, while the antioxidants have anti-aging and beautifying effects.

[0005] White jade mushrooms have a very broad cultivation prospect and market potential. However, the current market offers relatively limited varieties of white jade mushrooms, with significant issues of synonymy. Therefore, the cultivation methods of known varieties and the breeding of new varieties have always been important research topics in the white jade mushroom research and production field. Furthermore, existing white jade mushrooms generally suffer from long cultivation cycles, low yields, and some varieties exhibiting tubercles on the cap and generally poor mushroom shape. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of existing technologies by providing a white jade mushroom strain to solve problems such as long cultivation cycle, low yield, and unsatisfactory mushroom shape.

[0007] The present invention also provides a white jade mushroom fruiting body.

[0008] The present invention also provides a method for cultivating the fruiting bodies of the above-mentioned white jade mushroom.

[0009] This invention also provides applications of the above-mentioned white jade mushroom strain.

[0010] The present invention also provides applications of the above-mentioned white jade mushroom fruiting bodies.

[0011] Specifically, the first aspect of this invention provides a strain of *Pleurotus ostreatus*, with accession number GDMCC NO:61908, belonging to the genus *Pleurotus ostreatus*, with accession date of September 1, 2021; and accession location of Guangdong Provincial Microbial Culture Collection Center (GDMCC).

[0012] According to one technical solution of the white jade mushroom strain of the present invention, it has at least the following beneficial effects:

[0013] Compared with the white jade mushroom varieties in related technologies, the white jade mushroom fruiting bodies cultivated by the strain of this invention have completely different growth characteristics. They have thick stipes, thick caps, and a crisp texture. Under the optimal cultivation and growing period, the average yield per bottle (850cc) is over 255g, and the biological conversion rate is over 120.3%. The cultivation and growing period is short, and the mushrooms are uniform in shape and do not develop tubercles.

[0014] According to some embodiments of the present invention, the white jade mushroom strain belongs to Hypsizygus marmoreus and is named Xinghe No. 2.

[0015] According to some embodiments of the present invention, the white jade mushroom strain uses a variant of Hypsizygus marmoreus Xinghe 1 (disclosed in Chinese Patent 202010345235.X, the strain was deposited at the China Center for Type Culture Collection on April 17, 2020, with accession number CCTCC NO:M2020068) as the parent.

[0016] According to some embodiments of the present invention, the white jade mushroom strain was obtained through selection and breeding of the Xinghe No. 1.

[0017] According to some embodiments of the present invention, the cultivation method of the white jade mushroom strain includes mycelial transfer, shake flask culture, fermenter culture and bottle culture.

[0018] The second aspect of this invention discloses a white jade mushroom fruiting body, which is cultivated from the above-mentioned white jade mushroom strain (Xinghe No. 2).

[0019] According to some embodiments of the present invention, the cap diameter of the white jade mushroom fruiting body is 1.8cm to 2.2cm.

[0020] According to some embodiments of the present invention, the cap diameter of the white jade mushroom fruiting body is 2.0cm to 2.2cm.

[0021] According to some embodiments of the present invention, the stipe diameter of the fruiting body of the white jade mushroom is 1.1cm to 1.3cm.

[0022] According to some embodiments of the present invention, the stipe diameter of the fruiting body of the white jade mushroom is 1.2cm to 1.3cm.

[0023] According to some embodiments of the present invention, the cap of the white jade mushroom fruiting body is off-white in color.

[0024] The third aspect of this invention discloses a method for cultivating the fruiting bodies of the aforementioned white jade mushroom, comprising the following steps:

[0025] The white jade mushroom strain was cultured and cultivated on a culture medium.

[0026] According to some embodiments of the present invention, the cultivation medium is composed of the following raw materials in weight fractions:

[0027] The ingredients are: 20%–30% corn cobs, 15%–25% hardwood sawdust, 15%–20% rice bran, 20%–25% wheat bran, 3%–8% corn flour, and 15%–25% cottonseed hulls.

[0028] According to some embodiments of the present invention, the culture temperature is 21°C to 26°C.

[0029] According to some embodiments of the present invention, the humidity during the cultivation process is 70% to 80%.

[0030] According to some embodiments of the present invention, the concentration of CO2 during the cultivation process is 2000ppm to 4000ppm.

[0031] According to some embodiments of the present invention, the concentration of CO2 during the cultivation process is 2000ppm to 3000ppm.

[0032] According to some embodiments of the present invention, the concentration of CO2 during the cultivation process is 2500ppm to 3000ppm.

[0033] According to some embodiments of the present invention, the culture time is 70 days to 85 days.

[0034] According to some embodiments of the present invention, the cultivation temperature is 13°C to 18°C.

[0035] According to some embodiments of the present invention, the humidity of the cultivation is 92% to 99%.

[0036] According to some embodiments of the present invention, the CO2 concentration during the cultivation process is 1000ppm to 2500ppm.

[0037] According to some embodiments of the present invention, the CO2 concentration during the cultivation process is 1000ppm to 2000ppm.

[0038] According to some embodiments of the present invention, the CO2 concentration during the cultivation process is 1500ppm to 2500ppm.

[0039] According to some embodiments of the present invention, the light intensity during the cultivation process is 0 Lux to 300 Lux.

[0040] According to some embodiments of the present invention, the light intensity control method during the cultivation process is as follows:

[0041] From day 1 to day 7, the light intensity was 0 Lux to 100 Lux;

[0042] After the 7th day, the light intensity was 200 Lux to 300 Lux.

[0043] According to some embodiments of the present invention, the cultivation period is 23 to 25 days.

[0044] The fourth aspect of this invention discloses the application of the above-mentioned *Pleurotus ostreatus* strain in the preparation of any one of *Pleurotus ostreatus* spores, *Pleurotus ostreatus* mycelia, and *Pleurotus ostreatus* fruiting bodies.

[0045] According to a fifth aspect of the present invention, a white jade mushroom spore is provided, which is obtained by culturing the above-mentioned white jade mushroom strain.

[0046] According to a sixth aspect of the present invention, a white jade mushroom mycelium is provided, which is obtained by aseptic culture after tissue isolation of the above-mentioned white jade mushroom strain.

[0047] The *Pleurotus ostreatus* strain provided by this invention was cultured to obtain *Pleurotus ostreatus* mycelium. This *Pleurotus ostreatus* mycelium grows vigorously and proliferates rapidly. Under suitable culture conditions, the mycelium on the slant culture medium is dark white, with vigorous aerial mycelium, strong climbing ability, and can cover the test tube slant in 12-16 days.

[0048] The fifth aspect of this invention discloses the application of the above-mentioned white jade mushroom fruiting bodies in food processing.

[0049] The fruiting bodies of *Mucuna macrocarpa* obtained by cultivating the *Mucuna macrocarpa* strain of the present invention can be used in food processing, for example, the fruiting bodies of *Mucuna macrocarpa* can be made into dried mushrooms, mushroom powder, fried mushrooms, seasonings, etc.

[0050] According to some embodiments of the present invention, the fruiting body of *Pleurotus ostreatus* is used to prepare *Pleurotus ostreatus* polysaccharide.

[0051] The sixth aspect of this invention discloses the application of the above-mentioned white jade mushroom fruiting body in the preparation of any one of the following: immune-enhancing drugs, cholesterol-lowering drugs, anti-aging drugs, analgesic drugs, sedative drugs, antitussive and expectorant drugs, laxative and detoxifying drugs, and antihypertensive drugs.

[0052] The fruiting bodies of the white jade mushroom of this invention contain abundant protein, amino acids, trace elements, vitamins, polysaccharides, crude fiber, semi-crude fiber, lignin, purines, adenosine, and other components. They can be applied to the preparation of drugs that enhance immunity, lower cholesterol, delay aging, relieve pain, calm the nerves, stop coughing and expectorating, promote bowel movements and detoxification, and / or lower blood pressure, so that the prepared drugs have good health care effects.

[0053] The sixth aspect of this invention discloses the application of the above-mentioned white jade mushroom strain as a parent in breeding.

[0054] The white jade mushroom strain Xinghe 2 provided by this invention can be used as a parent in the breeding of white jade mushrooms. It can be used as a parent for conventional hybridization, and then a new strain of white jade mushrooms can be obtained through systematic selection. From the perspective of seed source, the goal of shortening the cultivation cycle of white jade mushrooms, increasing the yield of white jade mushrooms, and avoiding the occurrence of tubercles can be achieved. Attached Figure Description

[0055] Figure 1 The figure shows the antagonistic experimental results of the white jade mushroom strain provided by the present invention and some existing white jade mushroom strains on the market (Xinghe No. 1, WB-88-1 and WB-90).

[0056] Figure 2 The figure shows the antagonistic experimental results of the white jade mushroom strain provided by the present invention and some commercially available white jade mushroom strains (WB-86-1, WB-61 and WB-79).

[0057] Figure 3 This is an electrophoresis result of amplification using the first pair of SRAP primers in the variety identification and detection of Example 3 of the present invention.

[0058] Figure 4 This is an electrophoresis result of amplification using the second pair of SRAP primers in the variety identification and detection of Example 3 of the present invention.

[0059] Figure 5 This is an electrophoresis result of amplification using the third pair of SRAP primers in the variety identification and detection of Example 3 of the present invention.

[0060] Figure 6 This is an electrophoresis result of SRAP primer amplification in variety identification detection of Example 4 of the present invention.

[0061] Figure 7 This is an image showing the electrophoresis results of ITS in the variety identification test of Example 5 of the present invention.

[0062] Figure 8 This is a series of developmental trees used in variety identification and testing in Example 5 of the present invention.

[0063] Figure 9 This is an electrophoresis result of SCAR-PCR in the variety identification and detection of Example 6 of the present invention. Detailed Implementation

[0064] To make the objectives, technical solutions, and advantages of this application clearer, the application is described and illustrated below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. All other embodiments obtained by those skilled in the art based on the embodiments provided in this application without inventive effort are within the scope of protection of this application.

[0065] Obviously, the accompanying drawings described below are merely some examples or embodiments of this application. Those skilled in the art can apply this application to other similar scenarios based on these drawings without any inventive effort. Furthermore, it is understood that although the efforts made in this development process may be complex and lengthy, for those skilled in the art related to the content disclosed in this application, any changes to design, manufacturing, or production based on the technical content disclosed in this application are merely conventional technical means and should not be construed as insufficient disclosure of the content of this application.

[0066] In this application, the reference to "embodiment" means that a specific feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment that is mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described in this application may be combined with other embodiments without conflict.

[0067] Unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning understood by one of ordinary skill in the art to which this application pertains. The terms “a,” “an,” “a,” “the,” and similar words used in this application do not indicate quantity limitation and may indicate singular or plural. The terms “comprising,” “including,” “having,” and any variations thereof used in this application are intended to cover non-exclusive inclusion; for example, a process, method, system, product, or apparatus that includes a series of steps or units (components) is not limited to the listed steps or units but may also include steps or units not listed, or may include other steps or units inherent to these processes, methods, products, or apparatus. The terms “multiple” / “several” used in this application refer to two or more. “And / or” describes the relationship between related objects, indicating that three relationships may exist; for example, “A and / or B” can represent: A alone, A and B simultaneously, and B alone. The character “ / ” generally indicates that the preceding and following related objects are in an “or” relationship. The terms “first,” “second,” “third,” etc., used in this application are merely to distinguish similar objects and do not represent a specific ordering of the objects.

[0068] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0069] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0070] Example 1

[0071] This embodiment describes a white jade mushroom strain named Hypsizygus marmoreus Xinghe 2. This white jade mushroom strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 1, 2021, with the accession number GDMCC NO:61908. The strain was found to be viable and belongs to the genus Hypsizygus.

[0072] The white jade mushroom strain in this embodiment was obtained through the following steps:

[0073] 1. Parental line:

[0074] The parent strain *Hypsizygus marmoreus* Xinghe 1 (disclosed in Chinese Patent 202010345235.X, strain deposited at the China Center for Type Culture Collection on April 17, 2020, accession number CCTCC NO: M2020068) was used as the breeding material. Xinghe 1 is a brownish-yellow *Hypsizygus marmoreus* variety developed through single-spore hybridization of white *Hypsizygus marmoreus* (WB-86) and brownish-yellow *Hypsizygus marmoreus* (WZ-96).

[0075] 2. Breeding process:

[0076] From January to August 2021: During the fruiting process of Xinghe No. 1, several mutant mushrooms with off-white caps were found in one mushroom. After obtaining them, tissue separation was performed to obtain the seed source, which was named Xinghe No. 2. Two batches of small-scale trials were completed at Xichong Xinghe Biotechnology Co., Ltd. The overall performance was stable and the mushroom quality was good.

[0077] From September 2021 to January 2022: Three batches of small-scale mushroom production trials were completed at Shaoguan Xinghe Biotechnology Co., Ltd., and the results were consistent with the small-scale trials; the yield, cycle, and mushroom quality were all relatively stable.

[0078] February 2022 to present: Continuous large-scale trial cultivation experiments have been conducted at Shaoguan Xinghe Biotechnology Co., Ltd. To date, all batches of mushrooms have shown relatively stable mushroom quality, growth traits, and growth cycle.

[0079] Example 2

[0080] This embodiment is an antagonistic experiment of white jade mushroom strains. In this embodiment, the white jade mushroom strain Xinghe No. 2 obtained in Example 1 is compared with existing white jade mushroom strains on the market for antagonistic testing.

[0081] The antagonistic test was conducted using PDA medium: 200g potato, 20g glucose, and 20g agar per 1L of medium.

[0082] The specific procedures for the antagonism experiment are as follows:

[0083] The white jade mushroom strain Xinghe 2 was inoculated and cultured against Xinghe 1 and commercially available strains WB-88-1 (Wancheng Biotechnology), WB-90 (Xinghe Biotechnology), WB-86-1 (Shennong Fungi Industry), WB-61 (Japan), and WB-79 (Japan) on PDA plates. The inoculation points were 3 cm apart, and the cultures were kept at 23°C for 18 days. The antagonistic results are shown in Table 1.

[0084] Table 1. Antagonistic experiments among different *Pleurotus ostreatus* strains

[0085]

[0086] Figures 1-2 This image shows the antagonistic experiment results of the *Pleurotus ostreatus* strain Xinghe 2 with other *Pleurotus ostreatus* strains. (Source: [Original Source Name]) Figures 1-2 It can be seen that at the boundary of the opposing culture colonies, the *Pleurotus ostreatus* strain Xinghe 2 exhibits obvious antagonistic lines with strains WB-88-1, WB-90, WB-86-1, WB-61, and WB-79, and the mycelial growth and morphology are completely different at the spawn stage. This indicates that the *Pleurotus ostreatus* strain Xinghe 2 provided by this invention is a different *Pleurotus ostreatus* strain from strains WB-88-1, WB-90, WB-86-1, WB-61, and WB-79.

[0087] Example 3

[0088] This example is the first variety identification and testing experiment.

[0089] The white jade mushroom Xinghe No. 2 (XH2 white) provided by this invention and four existing white jade mushroom strains (B-19-65 (Xinghe Biotechnology), WB-74 (Zhongmao), WB-86-1 (Shennong Fungi Industry), WB-61 (Japan)) were respectively transferred to the PDA medium in Example 2 for activation and cultured in a constant temperature incubator at 20℃ for 13 to 15 days. Mycelia were picked and placed in 1.5 mL centrifuge tubes for later use.

[0090] DNA was extracted from the mycelia obtained above using the Magen HiPure Fungal DNA Kit (100mg) (purchased from Guangzhou Meiji Biotechnology Co., Ltd.).

[0091] In order to conduct a variety identification and testing experiment on the white jade mushroom Xinghe No. 2 (XH2 white) provided by the present invention and four existing white jade mushroom strains on the market, three pairs of primers were designed, and their sequences are shown in Table 2.

[0092] Table 2. SRAP primer sequence list in this embodiment.

[0093] 1 Me1: TGAGTCCAAACCGGATA Em3: GACTGCGTACGAATTGAC 2 Me1: TGAGTCCAAACCGGATA Em6: GACTGCGTACGAATTGCA 3 Me2:TGAGTCCAAACCGGAGC Em7: GACTGCGTACGAATTATG

[0094] The extracted DNA was amplified using three pairs of SRAP primers, and the amplification products were detected by electrophoresis. The electrophoresis results of DNA amplification using the first pair of SRAP primers (numbered 1) are as follows: Figure 3 As shown, the electrophoresis results of DNA amplification using the second pair of SRAP primers (numbered 2) are as follows. Figure 4 As shown, the electrophoresis results of DNA amplification using the third pair of SRAP primers (numbered 3) are as follows. Figure 5As shown, the numbers and corresponding white jade mushroom variety codes are as follows: No. 1 represents B-19-65; No. 2 represents WB-74; No. 3 represents XH2 white; No. 4 represents WB-86-1; No. 5 represents WB-61.

[0095] according to Figures 3-5 In the electrophoresis results, count the number of bands that are at least 500bp or have high brightness and are not blurred:

[0096] The first pair of primers has 5 bands for primer 1, 1 band for primer 2, 3 bands for primer 3, 2 bands for primer 4, and 3 bands for primer 5, and the band sizes are inconsistent.

[0097] The second pair of primers has 4 lines for primer 1, 8 lines for primer 2, 7 lines for primer 3, 5 lines for primer 4, and 4 lines for primer 5.

[0098] For the third primer pair, primer 1 has 2 lines, primer 2 has 4 lines, primer 3 has 5 lines, primer 4 has 5 lines, and primer 5 has 3 lines (but with lower brightness). In summary, these 5 strains exhibit genetic differences and are presumed to be 5 different strains.

[0099] Example 4

[0100] This example is the second variety identification and testing experiment.

[0101] The white jade mushroom Xinghe No. 2 (XH2 white) provided by this invention and three existing strains of true shiitake mushroom (WB-86 (Shennong Fungi Industry), WZ-77-17 (Japan), WB-79-39 (Japan) strain) were used as analysis objects. The genetic characteristics of Xinghe No. 2 were further identified using SRAP analysis technology.

[0102] The DNA extraction and agarose electrophoresis system used in this embodiment are the same as those described above, and will not be repeated here.

[0103] The PCR amplification system consisted of a total volume of 25 μl.

[0104] Genomic template (genomic DNA selected from Xinghe 2 strain, WB-86, WZ-77-17 or WB-79-3) (20ng / μl) 1μl;

[0105] Primer Em1: GACTGCGTACGAATTAAT (10 μl) 0.5 μl;

[0106] Primer Me1: TGAGTCCAAACCGGATA (10 μl) 0.5 μl;

[0107] Add 12.5 μl of 2×PCR mix and make up to 25 μl with ddH2O.

[0108] PCR procedure:

[0109] The reaction was carried out in 5 cycles: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 35℃ annealing for 1 min, and 72℃ extension for 1 min.

[0110] The reaction was carried out in 40 cycles: denaturation at 94℃ for 1 min, annealing at 50℃ for 1 min, extension at 72℃ for 1 min, extension at 72℃ for 10 min, and amplification was terminated at 4℃.

[0111] In this SRAP analysis, the primers were able to clearly distinguish Xinghe 2 from the three control strains of white jade mushroom WB-86, WZ-77-17, and WB-79-3.

[0112] The agarose gel electrophoresis pattern of the PCR amplification corresponding to the primer pair Em1 / Me1 is as follows: Figure 6 As shown ( Figure 6 In the diagram, M represents the molecular weight marker; 1 represents Xinghe 2; 2 represents WB-86; 3 represents WZ-77-17; and 4 represents WB-79-3. The boxed area contains a unique DNA band found only in Xinghe 2. WB-86, WZ-77-17, and WB-79-3 do not contain this band. Therefore, the primer pair Em1 / Me1 can distinguish Xinghe 2 from the three control strains WB-86, WZ-77-17, and WB-79-3.

[0113] The above test results show that Xinghe No. 2 has significant genetic differences from WB-86, WZ-77-17, and WB-79-3, further indicating that Xinghe No. 2 is a completely new strain of white jade mushroom.

[0114] Will Figure 6 The unique DNA band of Galaxy-2 at the location of the box was cut, the DNA was recovered, and TA cloning and sequencing were performed. The result is shown in SEQ ID NO: 1, which is an 859bp DNA fragment.

[0115] Galaxy-2 SEQ IN NO: 1:

[0116] TTGAGTCCAAACCGGATAATAGTATCTGGCTTGCACTTAGTGCGGCAAGCGCAGGCTTAGTTGTTCTCCTCGCCTCAGCTGGTAACGCTATATTTCCTCACACTTCCTCCTGACTCGGAGATTGACTCTGCGACTCTTTTTCTAGTCTTCTGGTACGCAGGTCGTGCAGGCGGCGGTGATATTGGACAAATCAGGCTACCCGACAACGAGGCAGCGAAGCTCATGACCGACCATGTCCCCGCTTCACTGCACTTTTCTTCGCTCACCTACGCTCTCGGCTCCCGCGTCATCCTCGACAACATCTCTGGCTCCGTGAAGCCAGGCCAGGTAATGGCGATCATGGGTGCCTCTGGGGCAGGGAAGTCGACCTTCCTCGATATTCTGGCACGGAAGCGGAAGCGCGGGACTGTCAGCGGGACGACACTCGTCAATGGGCGGGAGGTGAAGGATGTGGAGTTTAAGAGCGTGATGGGTTTCGTGGATCAGGAGGACACGTTGATGAGCACGTTGACGGTGTACGAGACTGTGCTGTATAGTGCGCTGCTGAGGCTGCCGAGGGATATGAGCTATGAGGCGAAGAAGTATCGGACGTTAGAGACGATGAATGAGTTGGGGATTCTGGGGATTAAGGATATGAGAATTGGGGATAGTGGTGCGTTGTTTTTGTTACCTTGATGAAGGTTGGTTCGTCAGCTTATATTTATTCTAGGTCGCCGTTCAATATCTGGAGGCGAGAAGCGACGAGTCTCTATTGCATGTGAGCTGGTCACAAGTCCCTCGATCCTGTTCTTGGACGAACCTACCAGCGGTAAGATCTGTCCAACTGCTTGTTCTACTATGATTAATTCGTACGCAGTCA。

[0117] Example 5

[0118] This example is the third variety identification and detection experiment (ITS analysis).

[0119] The white jade mushroom Xinghe No. 2 (XH2 white) provided by this invention and three existing white jade mushroom strains (WB-86, WZ-77-17, and WB-79-3) were used as the analysis objects. ITS analysis was performed in a similar manner to the above to further identify the genetic characteristics of Xinghe No. 2.

[0120] The electrophoresis image of ITS is as follows Figure 7 As shown ( Figure 7 In the diagram, M represents the molecular weight designation; 1 represents Xinghe 2; 2 represents WB-86; 3 represents WZ-77-17; and 4 represents WB-79-3.

[0121] The ITS sequence of *Pleurotus ostreatus* 'XH2' (white variety) provided by this invention is shown in SEQ ID NO:2. Based on the sequencing sequence, the resulting phylogenetic tree is shown below. Figure 8 As shown.

[0122] Galaxy-2 SEQ ID NO:2:

[0123] .

[0124] Example 6

[0125] This example is the fourth variety identification and testing experiment.

[0126] By establishing SCAR molecular markers on the white jade mushroom Xinghe 2 (XH2 white) provided by this invention, the Xinghe 2 strain can be rapidly identified.

[0127] Based on the 859bp DNA fragment shown in SEQ ID NO:1 above, specific primer sequences were designed using Primer Premier 5.0 software. The final designed amplification primer pairs were 5'-TCACACTTCCTCCTGACTCG-3' and 5'-AGTTGGACAGATCTTACCGCT-3'.

[0128] Using the primers designed above, SCAR-PCR amplification was performed on the genomic DNA of Xinghe No. 2 and three existing white jade mushroom strains (WB-86, Z-29-82, and WB-79-3).

[0129] The amplification system consisted of a total volume of 25 μl.

[0130] 1 μl of genomic template (genomic DNA selected from Xinghe 2 strain, WB-86, WZ-77-17 or WB-79-3) (20 ng / μl), 1 μl of each primer pair (10 μM), 12.5 μl of 2×PC Rmix, and ddH2O to make up to 25 μl.

[0131] PCR procedure:

[0132] The reaction was carried out for 35 cycles: 95℃ pre-denaturation for 3 min, 94℃ denaturation for 30 sec, 56℃ annealing for 30 sec, 72℃ extension for 1 min, 72℃ extension for 10 min, and 4℃ to end the amplification.

[0133] After the reaction was completed, the amplification products were subjected to agarose gel electrophoresis for detection. The electrophoresis results are shown in the figure below. Figure 9 As shown ( Figure 9 In the diagram, M represents the molecular weight marker; 1 represents Xinghe 2; 2 represents WB-86; 3 represents Z-29-82; and 4 represents WB-79-3.

[0134] from Figure 9It can be seen that only Xinghe-2 has a specific amplification band, while WB-86, Z-29-82, and WB-79-3 do not have amplification bands. This indicates that 5'-TCACACTTCCTCCTGACTCG-3' and 5'-AGTTGGACAGATCTTACCGCT-3' are SCAR molecular marker primers of Xinghe-2. Sequencing results of the amplified products using these primers show that they are specific DNA fragments of 702 bp in size, as shown in SEQ ID NO:3. The specific DNA fragment is the SCAR molecular marker of Xinghe-2.

[0135] Galaxy II SEQ ID NO:3:

[0136] .

[0137] Example 7

[0138] This example is a comparative experiment on the cultivation and propagation of white jade mushrooms.

[0139] The white jade mushroom strain Xinghe 2 of this invention, the existing white jade mushroom WB-61, and the white jade mushroom strain Xinghe 1 were cultured and cultivated in experiments. Each strain was cultivated in 64 bottles each time, and the volume of each cultivation bottle was 850mL.

[0140] The culture medium used in the cultivation experiment, calculated by weight percentage, consisted of 35% ± 1% culture medium and 65% ± 1% water. The culture medium, by weight percentage, included 20% corn cob, 15% hardwood sawdust, 18% rice bran, 22% wheat bran, 5% corn flour, and 20% cottonseed hulls.

[0141] The cultivation and breeding experiments specifically include the following steps:

[0142] S1. Inoculation and Fermentation:

[0143] The above-mentioned white jade mushroom strains were inoculated into culture media and cultured at a temperature of 21℃~26℃, relative humidity of 75%, and carbon dioxide concentration of 2000ppm~3000ppm.

[0144] S2, Formation of primordia of daughter entities:

[0145] The cultivation room temperature was set at 13℃~18℃, humidity at 92%~99%, and carbon dioxide concentration at 1500ppm~2500ppm. The light intensity was set at 50Lux±50Lux for the first 1 to 7 days, and then at 250Lux±50Lux. The light intensity was set intermittently each day (the shelf lights were turned on for 10 seconds and off for 1 hour in a cycle). The mushrooms were harvested when the caps were nearly mature, and the fruiting bodies of the white jade mushroom strain Xinghe 2 were obtained.

[0146] The results of the culture and cultivation experiments of each strain are shown in Table 3.

[0147] The optimal cultivation period and the optimal growing period are determined by the yield per unit area, and the period with the lowest production cost is the optimal period.

[0148] Table 3. Results of the culture and cultivation experiments of *Pleurotus ostreatus* strains.

[0149]

[0150] Table 4. Fruiting experiment results of the white jade mushroom strain.

[0151]

[0152]

[0153] Table 5 Comparison of fruiting body yield and biological efficiency

[0154] Galaxy 2 212 255 120.3 WB-61 212 233 109.9 Galaxy-1 212 237 111.8

[0155] As shown in Table 3, the optimal culture period for the *Pleurotus ostreatus* strain Xinghe 2 provided by this invention is 75 days, while the optimal cultivation period is 23 days. When the culture period is 75 days and 85 days, the yield of Xinghe 2 differs by 2g. That is, compared to the highest yield of 85 days, Xinghe 2 achieves the average yield with a culture period of 75 days, shortening the period by 10 days. Furthermore, compared to *Pleurotus ostreatus* strains WB-61 and Xinghe 1, the optimal culture period for Xinghe 2 provided by this invention is shortened by 10 days, while the average yield is 18g-22g higher, and the biological conversion rate is increased by 8%-10%. This indicates that the *Pleurotus ostreatus* strain Xinghe 2 provided by this invention has significant advantages in terms of both culture and cultivation periods.

[0156] As shown in Table 5, using 850cc plastic bottles, the average yield of the White Jade Mushroom strain Xinghe 2 was 255g / bottle, with a bioconversion rate of over 120%, which was significantly higher than the other two strains.

[0157] Example 8

[0158] This example demonstrates a temperature gradient experiment for the mycelial growth of a white jade mushroom strain.

[0159] Inoculation blocks with a diameter of 3.0 mm were inoculated onto PDA medium (Example 2) of *Pleurotus ostreatus* strain Xinghe 2, existing *Pleurotus ostreatus* strain WB-61, and *Pleurotus eryngii* strain Xinghe 1, and cultured at 18℃~19℃, 22℃~23℃, and 26℃~27℃ for 10 days, respectively. The experimental results are shown in Table 6.

[0160] Table 6. Effects of temperature on mycelial growth rate of different *Pleurotus ostreatus* strains

[0161]

[0162] As shown in Table 6, the *Pleurotus ostreatus* strain Xinghe 2 provided by this invention exhibits faster growth rates at 22℃~23℃ and 26℃~27℃, with the optimal growth temperature being 22℃~27℃. Under these conditions, the mycelial growth rate of *Pleurotus ostreatus* strain Xinghe 2 is 4.1mm / d~4.4mm / d, which is higher than that of existing *Pleurotus ostreatus* strains WB-61 and Xinghe 1.

[0163] Example 9

[0164] This example is a taste test of the fruiting bodies of the white jade mushroom strain.

[0165] In this embodiment, 2 kg of fresh white jade mushroom strain Xinghe 2, existing white jade mushroom WB-61, and true shiitake mushroom strain Xinghe 1 were selected, stir-fried, and cooled at room temperature (25℃). Fifteen people were randomly selected to conduct blind taste tests on the fruiting bodies of these three strains based on color, aroma, umami, bitterness, and crispness. The scoring criteria for the taste test are shown in Table 7, and the results of the taste test are shown in Table 8.

[0166] Table 7 Scoring criteria for the taste test

[0167]

[0168] Table 8. Results of the Taste Test

[0169]

[0170] As shown in Table 8, the fruiting bodies of the white jade mushroom strain Xinghe 2 provided by the present invention have better color, aroma, taste and crispness than the existing white jade mushroom strain WB-61 and the shiitake mushroom strain Xinghe 1. This further illustrates that the white jade mushroom strain Xinghe 2 provided by the present invention has a pleasing color, aroma, taste and crispness, and is more acceptable to consumers and has a broader market prospect.

[0171] Example 10

[0172] This example illustrates the morphological characteristics of the white jade mushroom strain.

[0173] The *Pleurotus ostreatus* strain Xinghe 2 was cultured and cultivated according to the method in Example 7, with a culture period of 75 days and a cultivation period of 23 days. The results showed that after culture and cultivation, *Pleurotus ostreatus* strain Xinghe 2 exhibited thick stems, robust caps, and uniform mushroom shapes, without any tubercles, and possessed excellent morphological characteristics.

[0174] The characteristics of strain Xinghe No. 2 are shown in Table 9 (refer to NY / T 3713-2020).

[0175] Table 9. Characteristics of Xinghe No. 2 strain

[0176]

[0177] Example 11

[0178] This example is a preservation experiment of the white jade mushroom strain.

[0179] Twenty-four mushrooms of strain Xinghe 2 were harvested on day 23 of growth. In the packaging workshop, the roots were cut, and the mushrooms were boxed. They were weighed using an electronic scale, with the box weight controlled between 150g and 160g. The boxes were then plastic-coated using a packaging machine, and the packaging workshop temperature was maintained between 14℃ and 16℃. After packaging, the mushrooms were placed in foam boxes, sealed with transparent tape, and placed on a cold storage sample rack at a temperature of 2℃ to 4℃. Every week, the bags were opened and the color, freshness, odor, and quality of the mushroom caps and stems were recorded. The results are shown in Table 10.

[0180] Table 10. Preservation status of Xinghe 2 under different preservation days

[0181]

[0182]

[0183] As shown in Table 10, the shelf life of Xinghe 2 is about 60 days.

[0184] The advantages of this invention are as follows: the white jade mushroom strain of this invention has high yield per unit area, short cultivation and planting cycle, which can greatly improve the conversion rate of raw materials and the production efficiency of the factory, and reduce costs and save energy; its morphological characteristics are excellent, with uniform mushroom shape and no tubercles, which is more conducive to product packaging and sales and increasing total sales; its fruiting bodies have thick stems and thick caps, good taste, and higher consumer acceptance; it has good overall performance and broad market prospects. In other words, the white jade mushroom strain Xinghe No. 2 provided by this invention has excellent morphological characteristics, with uniform mushroom shape and no tubercles, and a high A-grade rate in production, which is more conducive to the packaging and sales of white jade mushroom products.

[0185] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. White jade mushroom strain ( Hypsizygus marmoreus ), characterized in that, The white jade mushroom strain was named Xinghe No. 2 and was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 1, 2021, with accession number GDMCC NO:61908.

2. The fruiting body of *Pleurotus ostreatus*, characterized in that, It is obtained by cultivating the white jade mushroom strain described in claim 1.

3. The fruiting body of *Pleurotus ostreatus* according to claim 2, characterized in that, The cap diameter of the white jade mushroom fruiting body is 1.8cm~2.2cm.

4. The fruiting body of *Pleurotus ostreatus* according to claim 2, characterized in that, The stipe diameter of the fruiting body of the white jade mushroom is 1.1cm to 1.3cm.

5. The method for cultivating the fruiting bodies of *Pleurotus ostreatus* as described in any one of claims 2 to 4, characterized in that, Includes the following steps: The white jade mushroom strain was cultured and cultivated on a culture medium.

6. The cultivation method according to claim 5, characterized in that, The cultivation medium consists of the following raw materials in weight fractions: The ingredients are: 20%–30% corn cobs, 15%–25% hardwood sawdust, 15%–20% rice bran, 20%–25% wheat bran, 3%–8% corn flour, and 15%–25% cottonseed hulls.

7. The cultivation method according to claim 5, characterized in that, The cultivation temperature is 21℃~26℃; the humidity during cultivation is 70%~80%; the CO2 concentration during cultivation is 2000ppm~4000ppm; the cultivation time is 70d~85d; the planting temperature is 13℃~18℃; the planting humidity is 92%~99%; the CO2 concentration during cultivation is 1000ppm~2500ppm; and the light intensity during cultivation is 0Lux~300Lux.

8. The use of the *Pleurotus ostreatus* strain as described in claim 1 in the preparation of any one of *Pleurotus ostreatus* spores, *Pleurotus ostreatus* mycelium, and *Pleurotus ostreatus* fruiting bodies.

9. The application of the fruiting body of *Pleurotus ostreatus* as described in any one of claims 2 to 4 in food processing.

Images