A nucleic acid aptamer and kit for specifically recognizing grouper iridovirus

Abstract

This invention provides a nucleic acid aptamer and kit for specifically recognizing grouper iridovirus. The nucleotide sequence of the nucleic acid aptamer for specifically recognizing grouper iridovirus is GCGGAGCATTTAGAGCCCACACTGATAACCCTAAAAGCAGTGGTCCCCC. The nucleic acid aptamer provided by this invention has a small molecular weight, short preparation cycle, good reproducibility, is easy to synthesize in vitro, easy to label, and has a stable sequence that is easy to transport and store. This nucleic acid aptamer has high specificity and affinity for grouper iridovirus and is non-immunogenic.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular, relates to a nucleic acid aptamer and kit for specifically recognizing grouper iridovirus. Background Technology

[0002] In recent years, my country's marine economy has developed rapidly. Data from the "2021 China Marine Economy Statistical Bulletin" shows that the national marine GDP reached 9.03 trillion yuan in 2021, with marine fisheries accounting for over 15.6% of the total marine economy. Grouper is a highly nutritious, tender, and succulent edible fish, low in fat and high in protein, and is one of the most prized species in marine aquaculture. Most grouper species in my country are distributed in the South China Sea. With significant breakthroughs in artificial seedling breeding technology, seedling cultivation and adult fish farming techniques have developed rapidly, leading to the gradual entry of my country's grouper industry into a large-scale aquaculture stage. In 2021, my country's total grouper production exceeded 200,000 tons, making it extremely valuable economically.

[0003] Iridovirus is a recognized highly pathogenic and infectious viral pathogen, reported in various freshwater and marine farmed fish such as grouper, mandarin fish, red sea bream, sea bass, rainbow trout, large yellow croaker, and turbot. It has a high mortality rate, causing severe economic losses. SGIV, as one of the viral pathogens seriously threatening the grouper aquaculture industry, requires early detection and effective control measures to significantly reduce losses. Therefore, developing rapid detection technologies that are easy to operate, low-cost, quick, and highly accurate is extremely important for controlling the harm caused by SGIV in grouper.

[0004] Nucleic acid aptamers are oligonucleotide fragments that specifically bind to proteins or other small molecules, selected through systematic evolution of ligands by exponential enrichment (SELEX) technology. Nucleic acid aptamers possess numerous advantages, including high affinity and specificity, strong stability, and ease of chemical synthesis and modification. In other words, nucleic acid aptamers can highly specifically recognize the biological characteristics of target cells, and are therefore widely used in the development of detection technologies and the construction of biosensors to achieve accurate detection and diagnosis of target substances. Therefore, utilizing the characteristics of nucleic acid aptamers to develop precise detection methods for grouper iridoviruses has broad application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide a nucleic acid aptamer and kit for specifically recognizing grouper iridovirus, so as to improve the detection level of grouper iridovirus and effectively improve the efficiency of grouper iridovirus prevention and control.

[0006] According to a first aspect of the present invention, a nucleic acid aptamer that specifically recognizes grouper iridovirus is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Preferably, at least one base on the nucleotide sequence shown in SEQ ID NO.1 is phosphorylated, thiolated, methylated, aminoized, or isotopized.

[0008] Preferably, the secondary structure of the nucleic acid aptamer is as follows:

[0009]

[0010] Preferably, the nucleic acid aptamer is bound with a marker, which is selected from at least one of biotin, luminescent substances, and enzymes.

[0011] According to a second aspect of the invention, the above-described nucleic acid aptamer is provided for use in the preparation of a product for detecting grouper iridovirus, wherein the use is not included in the diagnosis of disease.

[0012] According to a third aspect of the present invention, a kit for detecting grouper iridovirus is provided, the kit containing the aforementioned nucleic acid aptamer that specifically recognizes grouper iridovirus.

[0013] Preferably, the method of using the kit includes the following steps: incubating the nucleic acid aptamer with the sample to be tested, then washing the sample to be tested, and finally detecting the labeling signal of the labeling agent on the sample to be tested, and determining whether the sample to be tested contains grouper iridovirus based on the intensity of the labeling signal.

[0014] Preferably, before incubating the nucleic acid aptamer with the sample to be tested, the nucleic acid aptamer is first deformed at 90-95°C for 5-10 min, and then annealed at 0°C for 10 min.

[0015] Compared with existing technologies, the advantages of this invention are:

[0016] ① The nucleic acid aptamer provided by this invention has high sensitivity to grouper iridovirus. Compared with existing protein antibodies, the nucleic acid aptamer obtained by screening through SELEX technology in this invention has higher affinity and specificity for grouper iridovirus. Moreover, it has characteristics that protein antibodies do not have, including short screening cycle, applicability to toxins and low immunogenic antigens, low working concentration, small batch variability, simple scale-up process, low cost, stable and easy to store, and can be transported at room temperature.

[0017] ② A reagent kit constructed using this nucleic acid aptamer, combined with detection equipment such as an ELISA reader, flow cytometer, and fluorescence microscope, can accurately detect the content of grouper iridovirus. The operation is simple and rapid, achieving high accuracy and sensitivity. The nucleic acid aptamer provided by this invention not only offers an important means for the rapid detection of grouper iridovirus but also broadens the application prospects of nucleic acid aptamers in the field of grouper iridovirus detection. Attached Figure Description

[0018] Figure 1 This is a predicted secondary structure diagram of the nucleic acid aptamer with the nucleotide sequence SEQ ID NO.1;

[0019] Figure 2 The results are the test results of the FAM fluorescence value of the sample in Example 2;

[0020] Figure 3 The results are the test results of the FAM fluorescence value of the sample in Example 3. Detailed Implementation

[0021] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0022] Example 1

[0023] This embodiment describes the screening and preparation of nucleic acid aptamers that can specifically recognize grouper iridovirus.

[0024] S1. Construction of the first ssDNA library and synthesis of primers

[0025] The first ssDNA library, Library 50, was designed and synthesized, with the following nucleotide sequence: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC. The two ends are fixed sequences, while the middle 50 nucleotides are random sequences.

[0026] The upstream primer includes the nucleotide sequence shown in SEQ ID NO.2 and is labeled with hydroxyfluorescein (FAM), with the specific sequence being: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.

[0027] The downstream primer includes the nucleotide sequence shown in SEQ ID NO.3 and is labeled with biotin, with the specific sequence being: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0028] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0029] S2. SELEX screening yielded aptamers that specifically recognize grouper iridovirus cells (positive screening).

[0030] S2.1 Dissolve 10 nmol of the first ssDNA library in 500 μL PBS, incubate at 92°C for 5 min, then quickly insert into ice and incubate for 10 min. Incubate the treated first ssDNA library with grouper iridovirus cells on ice for 1 h.

[0031] After S2.2 incubation and binding, the supernatant was removed by centrifugation. The grouper iridovirus cells were washed with 10 mL of PBS, incubated at 92°C for 10 min, and the supernatant was collected by centrifugation at 12000 g. This is the second ssDNA library that specifically recognizes grouper iridovirus cells.

[0032] S3. PCR amplification

[0033] Take 100 μL of the second ssDNA library obtained from screening and perform PCR amplification with upstream and downstream primers.

[0034] The PCR reaction system is as follows (1000 μL): 10×Buffer 100 μL, dNTP Mix (2.5 mM) 80 μL, upstream primer 40 μL, downstream primer 40 μL, second ssDNA library 100 μL, rTaq enzyme 12.5 μL, ddH2O 627.5 μL.

[0035] Perform PCR amplification according to the following procedure: 92℃ for 5 minutes, 92℃ for 1 minute, 60℃ for 30 seconds, 72℃ for 1 minute, for 25 cycles; then 72℃ for 5 minutes. The supernatant obtained after the first cycle should be used entirely for subsequent PCR amplification to obtain the amplified dsDNA library.

[0036] S4. Preparation of the third ssDNA library

[0037] 100 μL of streptavidin-labeled magnetic beads were incubated with a dsDNA library at room temperature for 20 min. The biotin on the dsDNA library binds to the magnetic bead surface via the affinity between biotin and streptavidin. The supernatant was removed using a magnetic separator. The magnetic beads were washed with 2 mL of PBS, and then 200 μL of NaOH solution (200 mM) was added to an EP tube. The reaction was carried out at room temperature for 15 min to denature and dissolve the dsDNA library. One strand carrying biotin bound to streptavidin remained on the magnetic bead. This single-stranded DNA bound to the magnetic bead was used as the third ssDNA library. The supernatant was recovered using a magnetic separator. The forward single-stranded nucleic acid in the supernatant was purified and recovered using a PCR purification kit. The collected solution was used for the next round of screening.

[0038] S5. Repeated screening

[0039] Replace the first ssDNA library with the third ssDNA library obtained in S4, and repeat the positive screening process, PCR amplification, and single-stranded DNA library preparation process shown in S2 to S4 12 times.

[0040] S6. Negative Screening

[0041] In the second and subsequent rounds of screening in S5, normal grouper spleen cells (GS) were used as a control. The ssDNA libraries obtained after S5 screening were subjected to negative screening to improve screening efficiency. The specific negative screening process was as follows: the selected ssDNA libraries were dissolved, incubated in a constant temperature water bath at 92℃, and then incubated with GS cells on ice for 1 hour. After incubation, the supernatant was collected by centrifugation, which was the negatively screened ssDNA library.

[0042] S7.12 round screening

[0043] The supernatant containing the ssDNA library collected in S6 was subjected to PCR amplification in S3 and ssDNA library preparation in S4. The processes S6, S2, S3, and S4 were repeated sequentially. Flow cytometry was used to detect changes in the recognition ability of the obtained ssDNA library against grouper iridovirus cells. This process was repeated 11 times, at which point the ssDNA library exhibited the strongest recognition ability against grouper iridovirus. After cloning and sequencing analysis of the amplified products, the aptamer for detecting grouper iridovirus in this embodiment was finally obtained, with the following nucleotide sequence:

[0044] GCTGAGGCATTTAGAGCCCACACTGATAACCCTAAAAGCAGTGGTCCCCC (SEQ ID NO.1)

[0045] The secondary structure of SEQ ID NO.1 was predicted online using the MFOLD software (http: / / mfold.rna.albany.edu / ?q=mfold / DNA-Folding-Form). The prediction results are as follows: Figure 1 As shown, the aptamer with the nucleotide sequence SEQ ID NO.1 forms a special stem-loop structure and hairpin structure.

[0046] Example 2

[0047] This embodiment is to test the binding effect and specificity of the nucleic acid aptamers screened in Example 1 on grouper spleen cells (GS cells) infected with different viruses.

[0048] The subjects were cell resuspensions obtained after incubation from Experimental Group I, Control Group I, Control Group II, and Control Group III.

[0049] Experimental Group I: The SEQ ID NO.1 aptamer was labeled with hydroxyfluorescein (FAM). 10 nmol of the labeled SEQ ID NO.1 aptamer was dissolved in 500 μL PBS and incubated at 92°C for 5 min. Then, it was quickly placed on ice and incubated for 10 min. The treated aptamer was then incubated with GS cells infected with grouper iridovirus on ice for 1 h. After the incubation binding was completed, the supernatant was removed by centrifugation.

[0050] Control Group I: This control group prepared cell resuspension according to the incubation method provided by the experimental group. The difference between this control group and Experimental Group I is that during the incubation process, the GS cells infected with SGIV virus in Example 2 were replaced with normal GS cells. All other raw materials and preparation methods were strictly consistent with those of the experimental group.

[0051] Control Group II: This control group prepared cell resuspension according to the incubation method provided by the experimental group. The difference between this control group and Experimental Group I is that during the incubation process, the GS cells infected with SGIV virus in Example 2 were replaced with GS cells infected with largemouth bass iridovirus (LMBV). All other raw materials and preparation methods were strictly consistent with those of the experimental group.

[0052] Control Group III: This control group prepared cell resuspension according to the incubation method provided by the experimental group. The difference between this control group and Experimental Group I is that during the incubation process, the GS cells infected with SGIV virus in Example 2 were replaced with GS cells infected with Chinese soft-shelled turtle iridovirus (STIV). All other raw materials and preparation methods were strictly consistent with those of the experimental group.

[0053] Test method: The cell resuspensions obtained from the test subjects were tested using a multi-functional microplate reader.

[0054] Experimental results: Test results are as follows Figure 2 As shown, Figure 2 The fluorescence values ​​of experimental group I were compared with those of control groups I, II, and III. A multi-functional microplate reader detected a higher fluorescence value of hydroxyfluorescein (FAM) on the cell surface of experimental group I. This indicates that the nucleic acid aptamer with the sequence SEQ ID NO.1 has a high specificity for recognizing GS cells infected with grouper iridovirus.

[0055] Example 3

[0056] This embodiment tests the binding of the nucleic acid aptamers screened in Example 1 to cells isolated from the liver, spleen, and kidney tissues of grouper.

[0057] Subjects: Cell resuspensions obtained after incubation from Experimental Group II and Control Group IV.

[0058] Experimental Group II: The SEQ ID NO.1 aptamer was labeled with hydroxyfluorescein (FAM). 10 nmol of the labeled SEQ ID NO.1 aptamer was dissolved in 500 μL PBS and incubated at 92°C for 5 min. Then, it was quickly placed on ice and incubated for 10 min. The treated aptamer and SGIV virus-infected cells were isolated from the liver, spleen and kidney tissues of grouper infected with grouper iridovirus and incubated on ice for 1 h. After the incubation binding was completed, the supernatant was removed by centrifugation.

[0059] Control Group IV: This control group prepared cell resuspensions using the incubation method provided in Experimental Group II. The difference between this control group and Experimental Group II was that, during the incubation process, cells infected with SGIV virus isolated from the liver, spleen, and kidney tissues of grouper infected with grouper iridovirus in Experimental Group II were replaced with cells not infected with SGIV virus isolated from the liver, spleen, and kidney tissues of healthy grouper. All other raw materials and preparation methods remained strictly consistent with the experimental group.

[0060] Test method: The cell resuspensions obtained from the test subjects were tested using a multi-functional microplate reader.

[0061] Experimental results: Test results are as follows Figure 3 As shown, Figure 3 A comparison of fluorescence values ​​between experimental group II and control group IV revealed that the fluorescence value of hydroxyfluorescein (FAM) on the cell surface of experimental group II was significantly higher, as detected by a multi-functional microplate reader. This indicates that the nucleic acid aptamer with the sequence SEQ ID NO.1 possesses high specificity for recognizing cells infected with grouper iridovirus.

[0062] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A nucleic acid aptamer that specifically recognizes grouper iridovirus, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.

1.

2. The nucleic acid aptamer for specifically recognizing grouper iridovirus as described in claim 1, characterized in that: At least one base on the nucleotide sequence shown in SEQ ID NO.1 is phosphorylated, thiolated, methylated, aminated, or isotopized.

3. The nucleic acid aptamer for specifically recognizing grouper iridovirus as described in claim 1, characterized in that, The secondary structure of the nucleic acid aptamer is as follows:

4. The nucleic acid aptamer for specifically recognizing grouper iridovirus as described in any one of claims 1 to 3, characterized in that: The nucleic acid aptamer is bound with a marker, which is selected from at least one of biotin, luminescent substances, and enzymes.

5. The use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a product for detecting grouper iridovirus, wherein the use does not include its use in disease diagnosis.

6. A kit for detecting iridovirus in grouper, characterized in that: It contains the nucleic acid aptamer that specifically recognizes grouper iridovirus as described in claim 4.

7. The kit as described in claim 6, characterized in that, The method of using the kit includes the following steps: The nucleic acid aptamer is incubated with the sample to be tested, then the sample to be tested is washed, and finally the labeling signal of the label is detected in the sample to be tested. The intensity of the labeling signal is used to determine whether the sample to be tested contains grouper iridovirus.

8. The kit as described in claim 7, characterized in that, Before incubating the nucleic acid aptamer with the sample to be tested, the nucleic acid aptamer is first deformed at 90-95℃ for 5-10 min, and then annealed at 0℃ for 10 min.

Images