Method for preferential transmission and rapid homozygosity of a gene of interest

Abstract

The application discloses a method for dominant transmission and rapid homozygosis of a target gene, and provides a reproductive isolation gene locus and a component gene RHS12 site, a strategy for breeding a rice line with site affinity, and a method for using DUYAO and JIEYAO the genes to realize dominant transmission and rapid homozygosis of a transgenic event, which has important application values in improving hybrid fertility of rice and accelerating the improvement process of rice varieties. In addition, the mechanism of DUYAO and JIEYAO is clarified, and the two genes also have toxicity and detoxification effects on cells of plants (for example, rice), cells of fungi (for example, yeast) and cells of animals (for example, Drosophila S2 cells), which widens the application range of the two genes, and has high scientific research and application values in genetic improvement, medical treatment, biological pharmacy and the like of other species.

Description

[0001] This application is a divisional application of the Chinese invention patent filed on August 30, 2022, with application number 202211059979.0, entitled "Rice Reproductive Isolation Locus RHS12 Genes DUYAO and JIEYAO and Their Breeding Utilization". Technical Field

[0002] This invention belongs to the field of plant genetic engineering technology, specifically involving the identification of the RHS12 locus, the cloning of the RHS12 locus constituent genes DUYAO and JIEYAO, the functional verification of the two genes DUYAO and JIEYAO in plants (rice), fungi (yeast) and animals (fruit flies), and their utilization in rice breeding. Technical Background

[0003] Rice is the staple food for half the world's population and 60% of China's population; therefore, increasing rice yield is of great significance to ensuring food security. Strong heterosis exists between rice species and subspecies, with indica-japonica hybridization having the potential to increase rice yield by approximately 30% (Qian, 2016). Furthermore, the introduction of some excellent agronomic traits from wild rice, such as stress tolerance, insect resistance, and disease resistance, into cultivated rice can maintain stable yields (Xu, 2005). However, reproductive isolation between species and subspecies severely affects the utilization of heterosis in rice; that is, the presence of hybrid sterility genes not only seriously affects yield increases but also severely restricts the exchange and aggregation of beneficial genes between species or subspecies (Ouyang and Zhang, 2013).

[0004] To clone hybrid sterility genes and elucidate the mechanisms of hybrid sterility in order to better utilize heterosis, dozens of loci controlling hybrid sterility have been identified. Based on the different traits they cause, these genes are classified into hybrid male gamete sterility genes, such as Sa, Sb, Sc, Sd, Se, and S24 (Zhao et al., 2011; Li et al., 2006, 2008; Long et al., 2008; Shen et al., 2017; Zhu Wenyin et al., 2008), etc. There are also female gamete sterility genes, such as S1, S5, S7, S29, and S31 (Zhao et al., 2007; Xie et al., 2019; Yang et al., 2012; Yu et al., 2016; Zhu et al., 2005), etc. However, currently only a few loci, such as Sa, S5, S1, Sc, and qHMS7 (Long et al., 2008; Shen et al., 2017; Xie et al., 2019; Yang et al., 2012; Yu et al., 2018), have been cloned, which is insufficient to solve the hybrid sterility problem. Therefore, it is necessary to identify and clone more hybrid sterility genes. After cloning hybrid sterility genes, it is possible to screen or create broadly compatible materials. Broadly compatible materials refer to japonica rice carrying the Sj type gene, indica rice carrying the Si type allele, and rice carrying the neutral Sn gene. Broadly compatible materials exhibit normal fertility when crossed with either japonica or indica rice. Furthermore, currently cloned rice hybrid sterility genes only affect rice reproductive cells (gametes). Whether they affect somatic cells or even species other than rice warrants further investigation and is of significant importance. Summary of the Invention

[0005] One of the objectives of this invention is to provide the reproductive isolation site RHS12, which is widely present among rice species, subspecies of indica and japonica, and varieties of japonica and indica rice.

[0006] The second objective of this invention is to provide the genes that make up the RHS12 locus: DUYAO and JIEYAO.

[0007] The third objective of this invention is to provide the proteins encoded by the DUYAO and JIEYAO genes.

[0008] The fourth objective of this invention is to provide the application of the DUYAO and JIEYAO genes in rice breeding to cultivate fertility-compatible rice lines.

[0009] The specific technical solution for the objective stated in this invention is as follows:

[0010] The reproductive isolation locus RHS12 described in this invention is located on the short arm of chromosome 12 in rice, specifically within a 30.8 kb interval between markers DK24 and TGR4.

[0011] The sequence of the molecular marker DK24 is as follows:

[0012] DK24-F TGTAATTGCAAGAATGGGCC

[0013] DK24-R CTCCGTTCGTCCGTAAAGTA.

[0014] The sequence of the molecular marker TGR4 is as follows:

[0015] TGR4-F ATTCGAATAGCCGTGCCCGT

[0016] TGR4-R CCAACCACCCACCTGAACT.

[0017] The RHS12 locus discovered in this invention can determine whether hybridization between species, between indica and japonica subspecies, or between indica or japonica rice varieties will result in reproductive isolation, specifically manifested as pollen or female gamete abortion.

[0018] This invention clones two genes, DUYAO and JIEYAO, that make up the RHS12 locus. The nucleotide sequence of gene DUYAO is shown in SEQ ID NO.1, and the protein sequence is shown in SEQ ID NO.2. The nucleotide sequence of gene JIEYAO is shown in SEQ ID NO.3, and the protein sequence is shown in SEQ ID NO.4.

[0019] This invention also elucidates the genetic and molecular mechanisms by which the DUYAO and JIEYAO genes cause reproductive isolation at the RHS12 locus. The DUYAO protein exerts cytotoxicity by interacting with OsCOX11, causing cell and gamete death; while the JIEYAO protein, by interacting with DUYAO, alters the mitochondrial localization of the DUYAO protein and degrades it, thereby eliminating its toxicity and allowing cells and gametes to survive.

[0020] This invention also provides the utilization of the fertility-compatible lines cultivated above in rice breeding. Specifically, the fertility-compatible lines with a non-functional DUYAO gene but a functional JIEYAO gene are crossed with any other variety to cultivate hybrid materials without the reproductive isolation effect at the RHS12 locus, which are then used for rice breeding. The non-functional DUYAO gene mentioned in this invention refers to the situation where the DUYAO gene is not normally expressed, for example, the DUYAO gene is knocked out or silenced. The hybrid materials cultivated without the reproductive isolation effect at the RHS12 locus are fertile hybrid materials, that is, materials where the RHS12 locus does not cause a decrease in pollen or embryo sac fertility, and are used for rice breeding.

[0021] This invention also provides a strategy for cultivating fertility-compatible rice lines, specifically by disrupting the DUYAO gene in the target rice variety or by transferring the JIEYAO gene into the target rice variety. The method for disrupting the DUYAO gene can employ methods commonly used in the art, such as, but not limited to, CRISPR / Cas9 technology, to mutate the DUYAO gene, causing it to lose its function.

[0022] The present invention also provides a strategy for cultivating hybrid sterile biological lines, characterized in that the gene DUYAO and the gene JIEYAO described in claim 2 are transferred together into the target organism.

[0023] The present invention also provides a method for breaking reproductive isolation in rice by destroying the DUYAO gene in the target organism or transferring the JIEYAO gene into the target rice variety.

[0024] The present invention also provides a method for establishing biological reproductive isolation, characterized in that the genes DUYAO and JIEYAO are transferred together into the target organism.

[0025] The organisms described in this invention are plants containing the RHS12 locus, and fungi or animals that do not contain the RHS12 locus; more preferably, rice, yeast or fruit flies.

[0026] This invention also provides a strategy for the rapid homozygous transfer of a target gene through transgenic technology. Specifically, the DUYAO and JIEYAO genes are combined into a single element. The gene requiring transgenic transfer is then tandemly linked with this element to form a new element. This single-copy new element can be nearly 100% transferred to the T1 generation, and nearly 50% of the T1 generation is transgenic homozygous.

[0027] This invention also provides the application of the DUYAO and JIEYAO genes in somatic cells (taking rice as an example). Specifically, when the DUYAO gene is expressed in rice callus cells, it can kill the cells. However, when DUYAO and JIEYAO are expressed simultaneously, JIEYAO can eliminate the toxicity of DUYAO, allowing the cells to grow normally.

[0028] This invention also provides the application of two proteins, DUYAO and JIEYAO, in yeast. Specifically, when DUYAO protein is expressed in yeast, the yeast cannot grow normally. However, when DUYAO and JIEYAO are expressed simultaneously in yeast, JIEYAO can relieve the inhibitory effect of DUYAO, allowing the yeast to grow normally.

[0029] This invention also provides the application of the two proteins DUYAO and JIEYAO in Drosophila S2 cells. Specifically, when DUYAO protein is expressed alone in Drosophila S2 cells, the proliferation rate of Drosophila S2 cells decreases, while when JIEYAO is expressed alone, the proliferation rate of Drosophila S2 cells increases; and when DUYAO and JIEYAO are expressed simultaneously, JIEYAO can eliminate the inhibitory effect of DUYAO on Drosophila S2 cells, restoring their proliferation rate.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The reproductive isolation locus and constituent genes provided by this invention, the strategy for breeding RHS12 locus-compatible rice lines, and the method for rapidly achieving homozygosity by utilizing the DUYAO and JIEYAO genes to transfer transgenic advantages are of significant application value for improving rice hybrid fertility and accelerating the process of rice variety improvement. Furthermore, the elucidation of the mechanisms of action of DUYAO and JIEYAO, and their toxicity and detoxification effects on plant (e.g., rice) cells, fungal (e.g., yeast) cells, and animal (e.g., Drosophila S2 cells) cells, broadens the application scope of these two genes. They have extremely high scientific research and application value for genetic improvement of other species, as well as for medical and biopharmaceutical applications. Attached Figure Description

[0032] Figure 1 QTL detection of pollen fertility in two F2 populations of indica and japonica rice;

[0033] Figure 2 RHS12 locus induces observation and fine localization of pollen abortion phenotype;

[0034] Figure 3 Transgenic knockout and complementation confirmed the genetic roles of DUYAO and JIEYAO;

[0035] Figure 4Transgenic complementation confirms the genetic roles of DUYAO and JIEYAO;

[0036] Figure 5 DUYAO produces toxicity through interaction with OsCOX11;

[0037] Figure 6 JIEYAO neutralizes its toxicity by interacting with DUYAO;

[0038] Figure 7 Effects of the RHS12 locus among wild rice, different species, different subspecies, and different indica rice varieties;

[0039] Figure 8 Transgenic application of the DUYAO-JIEYAO system and the spread of the RHS12 site in japonica rice;

[0040] Figure 9 Somatic cell effects of DUYAO and JIEYAO in rice callus, yeast and Drosophila S2 cells. Detailed Implementation

[0041] Example 1: Identification, phenotypic observation, and fine localization of RHS12 loci

[0042] Two F1 plants from indica-japonica crosses (Taichung 65 (T65) / Guanglu Dwarf 4 (G4), Dianjingyou 1 (DJY1) / RD23) exhibited strong heterosis, but severe reproductive isolation was observed, manifested in a significant reduction in F1 pollen fertility. Figure 1 A-1B). Through genome-wide QTL identification of the two F2 populations, we identified a major locus controlling pollen abortion on chromosome 12 in both populations, and named it RHS12 ( Figure 1 A-1B).

[0043] We then constructed a NIL with DJY1 as the background and RD23 as the insertion fragment through backcrossing, and named it DJY. RD23 When DJY1 and DJY RD23 During hybridization, the F1 generation exhibits pollen semi-sterility, with the abortion type being chromosomal abortion, and the aborted pollen cannot germinate. Figure 2 A). Scanning and transmission electron microscopy observations of F1 pollen revealed that aborted pollen grains were smaller in size, with incomplete starch accumulation and incomplete pollen grain wall development. Figure 2 B). Further cytological observation revealed that the F1 pollen abortion was caused by the developmental arrest of the microspores at the uninucleate margin stage, resulting in their development consistently lagging behind that of normal pollen. Figure 2C). Finally, we precisely located this site using map-based cloning. In the japonica rice genome, this site is 30.7 kb and includes two genes (jORF1 and jORF5) and one transposon; while in the indica rice genome, in addition to iORF1 and iORF5, there are three more genes, named iORF2, iORF3 (DUYAO), and iORF4 (JIEYAO). The nucleotide sequence of gene DUYAO is shown in SEQ ID NO.1, and the protein sequence is shown in SEQ ID NO.2; the nucleotide sequence of gene JIEYAO is shown in SEQ ID NO.3, and the protein sequence is shown in SEQ ID NO.4.

[0044] Example 2: Gene cloning at the RHS12 locus

[0045] To clone the genes constituting the RHS12 locus and determine their inheritance pattern, we conducted the following transgene knockout and complementation experiments. First, when we knocked out DUYAO in F1, we found that it restored normal fertility. Figure 3 A), and the separation ratio was restored to 1:2:1 (A), Figure 3 B) indicates that DUYAO is a "toxic" gene. Then, when JIEYAO was transferred into F1, the single-copy transgenic plants regained 75% fertility. Figure 3 C), and the separation ratio becomes 1:3:2 ( Figure 3 D), indicating that JIEYAO is a "detoxification" gene. Next, we tandemly transferred DUYAO and JIEYAO into japonica rice parents and F1, and found that single-copy transgenesis caused semi-sterility in the parents. Figure 3 E) and 1:1 partial separation ( Figure 3 F), and the effects of transgenics are equivalent to the RHS12 site effect (F). Figure 4 ).

[0046] Example 3: DUYAO generates "toxicity" through interaction with OsCOX11.

[0047] Subcellular localization results showed that DUYAO was located in the mitochondria ( Figure 5 A) suggests that DUYAO exerts its "toxic" function through mitochondria. OsCOX11 is an important subunit of the mitochondrial electron transport chain, providing energy for normal cell growth and development. We found that DUYAO and OsCOX11 are co-localized in mitochondria ( Figure 5 A). Furthermore, yeast two-hybrid, pull-down, and co-IP experiments confirmed the interaction between DUYAO and OsCOX11 ( Figure 5B-5E). Although OsCOX11 forms a dimer and DUYAO forms an oligomer, when the two are together, OsCOX11 cannot disrupt the oligomeric state of DUYAO (B-5E). Figure 5 F-5H). However, with the increase of DUYAO protein in the interaction system, the ability of OsCOX11 to interact with itself weakens (F-5H). Figure 5 The presence of DUYAO indicates that it disrupts the formation of the OsCOX11 protein dimer. Subsequently, we designed two targets to knock out OsCOX11, but found that we could not obtain OsCOX11 knockout plants, and the knockout heterozygous plants exhibited a 1:1 segregation, suggesting that OsCOX11 is an essential factor for cell (gamete) growth and development. Figure 5 (J and 5K). In summary, we believe that DUYAO exerts "toxicity" by interacting with OsCOX11, affecting cell (gamete) growth and development.

[0048] Example 4: JIEYAO "detoxifies" by interacting with DUYAO.

[0049] After elucidating how DUYAO produces "toxicity," we then clarified the molecular mechanism by which JIEYAO "detoxifies." Through yeast double hybridization, LCI, pull-down, and Co-IP experiments, we confirmed that DUYAO and JIEYAO can interact (…). Figure 6 A-6D). Previous research results confirmed that DUYAO can form oligomers, and when JIEYAO is expressed together with DUYAO, JIEYAO disrupts the oligomeric state of DUYAO (A-6D). Figure 6 E and 6F). Furthermore, the presence of JIEYAO disrupts the interaction between DUYAO and OsCOX11 ( Figure 6 G). Next, we investigated how JIEYAO affects DUYAO at the subcellular level. The results showed that, unlike DUYAO, which is located in mitochondria, JIEYAO is located in the MVB and autophagosomes (G). Figure 6 H). Furthermore, when JIEYAO was expressed in conjunction with DUYAO, the results showed that JIEYAO altered the mitochondrial localization of DUYAO, causing it to be localized to the MVB and autophagosome (H). Figure 6 I). This also explains why JIEYAO can completely disrupt the interaction between DUYAO and OsCOX11, because it alters the mitochondrial localization of DUYAO. So, what effect does JIEYAO's localization of DUYAO to the autophagosome have on DUYAO? Through in vitro degradation experiments, we found that JIEYAO promotes the degradation of DUYAO, while the addition of the autophagy pathway inhibitor BFA1 significantly inhibits its degradation (I). Figure 6In summary, we elucidated the mechanism by which JIEYAO detoxifies DUYAO at the molecular level. Specifically, JIEYAO interacts with DUYAO, disrupting its oligomeric state, altering its mitochondrial localization, and ultimately degrading it via autophagy.

[0050] Example 5: RHS12 loci are widely present among species, subspecies, and varieties.

[0051] To investigate the prevalence and importance of the RHS12 locus in rice, we constructed NILs with japonica rice DJY1 as the background and different types of wild rice and cultivated indica rice as the insert sources. Pollen phenotypic results from diallel crosses between different NILs showed that RHS12 exists among wild rice species, between wild and cultivated rice species, between indica and japonica subspecies, and among indica varieties. Figure 7 A). Subsequently, the above results were confirmed by NILs with different wild and cultivated rice fragments inserted against a DJY1 background, and we found that changing the amino acid at position 115 of the JIEYAO protein from K to E or Q caused it to lose its function. Figure 7 B). More diverse types of indica and japonica rice, and the NILs of indica-japonica combinations also confirmed the widespread presence of the RHS12 locus between indica-japonica subspecies and indica varieties. Figure 7 C).

[0052] Example 6: Application of the DUYAO-JIEYAO system in rice breeding and improvement

[0053] Due to the unique gamete transfer characteristics of the DUYAO-JIEYAO system, we attempted to utilize this system to study its role in rice variety improvement. First, we inserted a Ubi-driven GFP gene into the middle of the DUYAO-JIEYAO gene combination, and then analyzed the effect of single-copy transgenic transformation. The results showed that, compared to single-copy transgenic events with Ubi-driven GFP alone, the transgenic pollen of the tandem DUYAO-JIEYAO system was semi-sterile, and only pollen carrying GFP was normal (…). Figure 8 (AB) This indicates that this system can produce approximately 50% homozygous transgenic offspring and approximately 50% heterozygous transgenic offspring, far exceeding the conventional transgenic system's 25% homozygous, 25% heterozygous, and 25% non-transgenic offspring. This demonstrates that when the Ubi-driven GFP is replaced with any element, that element can be preferentially passed on to the next generation, accompanied by a very high homozygous proportion. This characteristic significantly accelerates the breeding process when using the DUYAO-JIEYAO element for transgenic breeding improvement.

[0054] The previous results showed that the DUYAO-JIEYAO system is specific to indica rice but not to japonica rice. Analysis of japonica rice varieties from before the 1970s confirmed this. However, after the 1970s, the DUYAO-JIEYAO system began to invade japonica rice and gradually spread. By 2020, the DUYAO-JIEYAO system accounted for nearly 90% of japonica rice. Figure 8 (C) This result is consistent with the genetic characteristics of the system, namely that the DUYAO-JIEYAO system will pass on its advantages to the next generation. So, since there are no reproductive isolation sites in japonica rice varieties to begin with, will the newly invasive DUYAO-JIEYAO system cause reproductive isolation between japonica rice varieties? By hybridizing different types of japonica rice varieties, the results showed that the DUYAO-JIEYAO system caused new reproductive isolation in japonica rice varieties (C). Figure 8 D).

[0055] Example 7: Cross-species somatic cell effects of the DUYAO-JIEYAO system

[0056] Previous cytological observations and genetic results confirmed that DUYAO is toxic to male gametes, while JIEYAO can neutralize this toxicity. Therefore, whether the DUYAO-JIEYAO system has similar effects on somatic cells or other species besides germ cells warrants further investigation. When transforming rice callus by linking DUYAO driven by the 35S promoter with Ubi-driven GFP, we found that cells did not express GFP light; however, when Actin-driven JIEYAO was co-transformed with it, the rice callus regained GFP light. Of course, using the rice's own promoter to drive DUYAO and JIEYAO also yielded the same effect. Figure 9 AB). This indicates that DUYAO is also "toxic" to rice somatic cells, while JIEYAO can neutralize the "toxicity" produced by DUYAO. Next, we transferred the DUYAO-JIEYAO system into yeast and obtained similar results. Expression of DUYAO in yeast prevented yeast growth, while simultaneous expression of JIEYAO detoxified the toxicity of DUYAO, allowing the yeast to resume normal growth. Figure 9 C). The same pattern was observed in Drosophila S2 cells; when DUYAO was expressed, the cell proliferation rate decreased, while when JIEYAO was co-expressed, the cell proliferation rate was restored. Figure 9 D). In summary, we believe that the DUYAO-JIEYAO system exhibits similar "toxicity-detoxification" effects not only in plants but also in other species (such as yeast and fruit flies). Given the broad applicability of the DUYAO-JIEYAO system, we believe it can be utilized not only for plant breeding and improvement but also for further applications in genetic improvement of other species and in pharmaceuticals and medicine.

Claims

1. A method for the advantageous transfer and rapid homozygosity of a target gene, characterized in that, The gene shown in SEQ ID NO.1 DUYAO The gene shown in SEQ ID NO.2 JIEYAO The target gene, along with the target gene, is transferred into the target organism, which is rice.

Images