Ganoderma lucidum peroxidase GlDyP gene, and the encoded protein and application thereof
By mining the GlDyP gene from Ganoderma lucidum transcriptome data and recombinantly expressing it in Escherichia coli, a highly efficient GlDyP protein was obtained, which solved the problem of insufficient application of Ganoderma lucidum peroxidase in dye decolorization and achieved efficient decolorization of a variety of dyes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
- Filing Date
- 2023-04-25
- Publication Date
- 2026-08-04
AI Technical Summary
There is limited research on the Ganoderma lucidum peroxidase GlDyP gene in existing technologies, and its application in dye decolorization has not been fully utilized.
The GlDyP gene with high expression levels was extracted from transcriptome data of different developmental stages of Ganoderma lucidum and recombinantly expressed in Escherichia coli. The highly active GlDyP protein was obtained by nickel column purification and applied to dye decolorization.
The GlDyP protein achieved decolorization rates of 60.73%, 53.58%, 55.13%, 75.53%, and 79.14% for anthraquinone dyes, azo dyes, and trimethylbenzene dyes, respectively, demonstrating highly efficient dye decolorization.
Smart Images

Figure CN116837006B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fungal molecular biology, and more specifically, relates to the Ganoderma lucidum peroxidase GlDyP gene and its encoded protein and its applications. Background Technology
[0002] DyPs (Dye-decolorizing Peroxidases) are a class of heme-containing peroxidases first discovered in the basidiomycete *Bjerkandera adusta*, capable of degrading a variety of dyes. Their distal heme region differs from other heme peroxidases such as manganese peroxidase (MnP), vertabolic peroxidase (VP), and lignin peroxidase (LiP), thus making DyPs a novel type of heme peroxidase. DyPs are widely distributed in the genomes of fungi, bacteria, and archaea. Based on sequence alignment, DyPs are classified into four types in the PeroxiBase database: types A, B, and C are primarily derived from bacteria and archaea, while type D is of fungal origin. However, based on the classification of structural alignment, DyPs are divided into three categories: P (primary) refers to the former B category, which has the most compact structure; I (intermediate) refers to the former A category, with additional sequences; and V (advanced) refers to the former C and D categories, which also have additional sequences.
[0003] DyPs exhibit broad substrate specificity, capable of degrading not only typical peroxidase substrates such as ABTS and phenolic compounds, but also a variety of complex dyes. Furthermore, in prokaryotes, DyPs have been confirmed to possess physiological functions in degrading lignin. The role of DyPs in fungal biology is uncertain, but it has been reported that they may also be an important part of the lignin-degrading system in white-rot fungi. For example, DyP purified from Auricularia auricula-judae culture can oxidize the non-phenolic lignin model compound resveratrol (VA); the purified DyP protein obtained from heterologous expression of the Irpexlacteus DyP gene in Escherichia coli can oxidize the phenolic lignin model compound 2,6-dimethoxyphenol (DMP). Currently, research on fungal DyPs is limited, and our specific functions and applications are poorly understood. Therefore, enriching the diversity of fungal DyPs and clarifying their functions is of great significance.
[0004] Ganoderma lucidum, commonly known as "red Ganoderma," is a typical white-rot fungus that can transform lignocellulose-rich agricultural and forestry waste into fruiting bodies with both medicinal and edible value. In lignocellulose, cellulose, hemicellulose, and lignin are cross-linked to form a robust network structure, with lignin coating the outer layers of cellulose and hemicellulose. Degrading lignin effectively promotes the release of cellulose and hemicellulose, which is key to the efficient utilization of lignocellulose. Studies have shown that Ganoderma lucidum strains can produce dye decolorizing peroxidase, and the expression level of the GlDyP gene is significantly higher during the mycelial growth stage than in other developmental stages. We hypothesize that the GlDyP gene may also play an important role in substrate utilization, specifically in degrading lignin. Summary of the Invention
[0005] To address the aforementioned problems in the existing technology, the technical problem to be solved by the present invention is to provide a Ganoderma lucidum peroxidase GlDyP gene to meet the requirements for dye decolorization. Another technical problem to be solved by the present invention is to provide a protein encoded by the aforementioned Ganoderma lucidum peroxidase GlDyP gene. A further technical problem to be solved by the present invention is to provide an application of the aforementioned Ganoderma lucidum peroxidase GlDyP gene.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] The Ganoderma lucidum peroxidase GlDyP gene has the nucleotide sequence shown in SEQ ID NO.1.
[0008] The amino acid sequence of the protein encoded by the Ganoderma lucidum peroxidase GlDyP gene is shown in SEQ ID NO.2.
[0009] The host bacteria containing the Ganoderma lucidum peroxidase GlDyP gene.
[0010] The host bacterium mentioned is Escherichia coli BL21.
[0011] A recombinant protein containing the Ganoderma lucidum peroxidase GlDyP gene.
[0012] The application of the recombinant protein of the Ganoderma lucidum peroxidase GlDyP gene in the degradation of the peroxidase substrate ABTS.
[0013] Application of the recombinant protein of the Ganoderma lucidum peroxidase GlDyP gene in the degradation of lignin model compounds.
[0014] The application of the recombinant protein of the Ganoderma lucidum peroxidase GlDyP gene in dye decolorization.
[0015] The dye is one or more of anthraquinone dyes, azo dyes, and trimethylbenzene dyes.
[0016] The dye is one or more of Reactive Blue 19, Reactive Brilliant Blue X-BR, Reactive Black 5, Methyl Orange, Trypan Blue, and Malachite Green.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] This invention, starting from transcriptome data of Ganoderma lucidum at different developmental stages, identified the GlDyP gene, a peroxidase gene with high expression levels in the mycelial stage. The GlDyP gene was recombinantly expressed in E. coli, and the active GlDyP protein was obtained after nickel column purification. Degradation experiments showed that the GlDyP protein achieved a decolorization rate of 60.73% ± 0.01 for RB19, 53.58% ± 0.02 for Reactive Brilliant Blue, 55.13% ± 0.00 for RB5, 75.53% ± 0.01 for methyl orange, 79.14% ± 0.01 for trypan blue, and 79.03% ± 0.01 for malachite green. Attached Figure Description
[0019] Figure 1 Electrophoresis diagram of the GlDyP gene obtained by PCR amplification from Ganoderma lucidum cDNA (lane M is the DNA molecular weight marker; lane 1 is the nucleotide fragment of the GlDyP gene);
[0020] Figure 2 Figure 1 shows the SDS-PAGE analysis of GlDyP expression in *E. coli* (lane M represents protein molecular weight standards (protein markers); lane 1 shows the supernatant and precipitate after lysis of *E. coli*-GlDyP following IPTG induction at 28℃; lane 2 shows the supernatant and precipitate after lysis of *E. coli*-GlDyP following IPTG induction at 16℃; lane 3 shows the supernatant after lysis of *E. coli*-GlDyP following IPTG induction at 28℃; lane 4 shows the supernatant after lysis of *E. coli*-GlDyP following IPTG induction at 16℃). Lane 5 contains the supernatant after E. coli-G1DyP lysis, induced by IPTG and at 28℃; Lane 6 contains the precipitate after E. coli-G1DyP lysis, induced by IPTG and at 16℃; Lane 7 contains whole cells of E. coli-G1DyP without IPTG induction; Lane 8 contains the supernatant and precipitate after E. coli-pET32a lysis, induced by IPTG and at 28℃; Lane 9 contains the supernatant and precipitate after E. coli-pET32a lysis, induced by IPTG and at 16℃.
[0021] Figure 3The image shows the Western blot analysis of G1DyP (lane M is the protein molecular weight standard (protein marker); lanes 1, 2 and 3 are the recombinant G1DyP protein after induction; lane 4 is the empty vector control after induction).
[0022] Figure 4 This is an SDS-PAGE electrophoresis image of the purified GlDyP protein (lane M is the protein molecular weight standard (protein marker); lanes 1 and 2 are the purified recombinant GlDyP protein). Detailed Implementation
[0023] The present invention will be further described below with reference to specific embodiments. In the following embodiments, operations not described in detail are routine biological experimental procedures, which can be performed with reference to molecular biology experimental manuals and existing publicly available journal articles, or according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0024] Example 1: Cloning of the peroxidase GlDyP gene
[0025] 1. By analyzing the transcriptome data of four developmental stages of Ganoderma lucidum (Liu D, Sun X, Diao W, Qi X, Bai Y, Yu X, Li L, Fang H, Chen Z, Liu Q, Liang C. Comparative transcriptome analysis revealed candidate genes involved in fruiting body development and sporulation in Ganoderma lucidum. Arch Microbiol, 2022, 204(8): 514.), a dye decolorization peroxidase gene, namely GlDyP, was screened out, which was expressed at a high level only in the mycelial stage.
[0026] 2. Total RNA was extracted from the mycelial stage of Ganoderma lucidum using the KK Ultrafast Plant Total RNA Extraction Kit, and then reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper).
[0027] 3. Based on the sequence of the GlDyP gene in the transcriptome, the following specific primers were designed and synthesized:
[0028] 1-F: 5′-ATGGCTCCCACCGTAGCACC-3′:
[0029] 1-R: 5′-TCATGCTAACGCGAAAGTAC-3′.
[0030] 4. PCR amplification was performed using cDNA as a template, and the results were detected by 1% agarose gel electrophoresis as follows: Figure 1 As shown in the figure. The PCR product with the correct fragment size was purified and ligated into a T vector, which was then transformed into E. coli DH5α. Single clones were picked, and after PCR detection, they were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The nucleotide sequence of the GlDyP gene was 1461 bp, as shown in SEQ ID NO.1, and the corresponding amino acid sequence of the encoded protein was shown in SEQ ID NO.2.
[0031] Example 2: Heterologous expression of the GlDyP gene
[0032] 1. The GlDyP gene fragment was ligated to the expression vector pET-32a(+) via homologous recombination (the vector was digested with EcoR1 and Xho1 enzymes) and transformed into *E. coli* BL21(DE3). The homologous recombination primer sequences are as follows:
[0033] 2-F:GCTGATATCGGATCCGAATTCATGGCTCCCACCGTAGCAC;
[0034] 2-R: GTGGTGGTGGTGGTGCTCGAGTGCTAACGCGAAAGTACTGCG.
[0035] Single colonies were selected, and after PCR testing, they were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Single colonies with correct sequencing were amplified, plasmids were extracted, and enzyme digestion was performed for verification. Single colonies with correct sequencing and enzyme digestion verification were preserved.
[0036] 2. Inoculate the BL21 strain containing the recombinant plasmid into 20 mL of LB medium and culture overnight at 37°C with shaking at 220 rpm. Then, transfer the 1% strain to 100 mL of LB medium and culture at 37°C with shaking at 220 rpm for approximately 4 hours to allow the OD to adjust. 600 The concentration was between 0.4 and 0.6. Then, IPTG, the inducer, was added to a final concentration of 0.1 mM and induced overnight at 16 °C (120 r / min) and 28 °C (220 r / min), respectively, to select the appropriate induction temperature. The BL21 strain containing the empty vector was used as a control.
[0037] 3. Collect the induced bacterial cells by centrifugation at 8000 rpm for 10 min, resuspend in PBS buffer, centrifuge again to collect the cells, resuspend in 20 mL Tris-HCl buffer (pH = 7.4, 0.5 M NaCl), then add 1 mM of the protease inhibitor phenylmethylsulfonyl fluoride, and sonicate in an ice-water bath for 20 min (200 W, 6 s on, 6 s off). Perform SDS-PAGE electrophoresis analysis on the total protein, supernatant, and precipitate. The results are shown below. Figure 2 As shown, compared with the control, a specific band appeared at a position slightly above 65 kDa, consistent with the expected molecular weight of the target protein and the His fusion expression protein, and the expression level in the supernatant was higher at 16℃ induction; Western blot analysis was performed on the supernatant of the fragmented recombinant protein and the empty vector, and the results are as follows. Figure 3 As shown, compared with the control, a specific band appeared at a position slightly above 65 kDa, consistent with the expected molecular weight of the target protein and the His fusion expressed protein. This indicates that the dye-decolorized peroxidase protein can be efficiently expressed in E. coli BL21.
[0038] Example 3: Purification of GlDyP protein
[0039] Based on the results of Example 2, 16℃ induction was selected for protein purification. The buffer in the Ni-NTA chromatography column was drained, the column was washed with Tris-HCl buffer, and then the supernatant was added. The flow rate was controlled to allow for slow efflux (ensuring sufficient protein binding to the membrane), and the flow-through was collected. Elution was performed with buffers containing different concentrations of imidazole (0 mM, 20 mM, 50 mM, 100 mM, 250 mM). The eluent was tested with Coomassie Brilliant Blue G-250 until it did not turn blue; then the next concentration of eluent was used. The purer protein obtained was selected and concentrated using ultrafiltration. The final purified protein was purified by SDS-PAGE, and the results are shown below. Figure 4 As shown, the enzyme purity has met the requirements for enzyme property analysis and can be used for subsequent determination of enzyme properties.
[0040] Example 4: G1DyP protein degrades typical peroxidase substrate ABTS
[0041] The reaction system consisted of 100 mM sodium acetate buffer (pH 3.5), 0.5 mM ABTS, 0.1 mM H2O2, and 50 μL G1DyP protein (187 μg / mL). After mixing, the mixture was incubated at 40 °C for 10 min, and the absorbance of the reaction solution at 420 nm was measured. One unit of enzyme activity (U) was defined as the amount of enzyme required to oxidize 1 nmol of ABTS per minute per milligram of G1DyP protein. The calculated enzyme activity was 1399.67 U / mg ± 10.68.
[0042] Example 5: Model compound of GlDyP protein degrading lignin
[0043] The reaction system consisted of 100 mM sodium acetate buffer (pH 3.5), 2.5 mM DMP or 5 mM guaiacol, 0.1 mM H2O2, and 50 μL G1DyP protein (187 μg / mL). After mixing, the mixture was incubated at 40 °C for 10 min, and the absorbance changes at 469 nm (DMP) and 465 nm (guaiacol) were measured. One unit of enzyme activity (U) was defined as the amount of enzyme required to oxidize 1 nmol of DMP or 1 nmol of guaiacol per minute per milligram of G1DyP protein. The calculated DMP enzyme activity was 194.97 U / mg ± 6.62, and the guaiacol enzyme activity was 534.50 U / mg ± 5.10.
[0044] Example 6: Destaining the destaining effect of G1DyP protein on different dyes
[0045] In this embodiment, a total of 6 dyes were selected, of which Reactive Blue 19 (RB19) and Reactive Brilliant Blue X-BR are anthraquinone dyes, Reactive Black 5 (RB5), Methyl Orange and Trypan Blue are azo dyes, and Malachite Green is a trimethylbenzene dye.
[0046] The concentration of RB19 used was 150 μM, the concentration of Reactive Brilliant Blue X-BR was 50 μM, the concentration of RB5 was 50 μM, the concentration of Methyl Orange was 100 μM, the concentration of Trypan Blue was 15 μM, and the concentration of Malachite Green was 150 μM.
[0047] The reaction system contained 100 mM sodium acetate buffer (pH 3.5), different dyes, 0.1 mM H2O2, and 50 μL of protein (187 μg / mL). After mixing, the mixture was incubated at 40 °C for 10 min.
[0048] The absorbance of the reaction solution was measured at 595 nm (RB19), 592 nm (Reactive Brilliant Blue X-BR), 598 nm (RB5), 460 nm (methyl orange), 606 nm (trypan blue), and 614 nm (malachite green). The decolorization rate was calculated using the following formula:
[0049] Dye decolorization rate (%) = (A0 - A) t ) / A0×100%
[0050] A0 is the initial absorbance value, and At is the absorbance value after decolorization.
[0051] The destaining rates of G1DyP protein for different dyes are shown in Table 1. The destaining rate of RB19 was 60.73% ± 0.01, the destaining rate of Reactive Brilliant Blue was 53.58% ± 0.02, the destaining rate of RB5 was 55.13% ± 0.00, the destaining rate of methyl orange was 75.53% ± 0.01, the destaining rate of trypan blue was 79.14% ± 0.01, and the destaining rate of malachite green was 79.03% ± 0.01.
[0052] Table 1. Decolorization rate of G1DyP protein for different dyes
[0053] RB19 60.73%±0.01 Active Brilliant Blue X-BR 53.58%±0.02 RB5 55.13%±0.00 Methyl orange 75.53%±0.01 Trypan Blue 79.14%±0.01 Peacock Green 79.03%±0.01
Claims
1. The Ganoderma lucidum peroxidase GlDyP gene, the nucleotide sequence of which is shown in SEQ ID NO.
1.
2. The protein encoded by the Ganoderma lucidum peroxidase GlDyP gene according to claim 1, the amino acid sequence of which is shown in SEQ ID NO.
2.
3. A host bacterium containing the Ganoderma lucidum peroxidase GlDyP gene as described in claim 1.
4. The host bacterium containing the Ganoderma lucidum peroxidase GlDyP gene according to claim 3, characterized in that, The host bacterium mentioned is Escherichia coli BL21.
5. The application of the protein encoded by the Ganoderma lucidum peroxidase GlDyP gene as described in claim 2 in the degradation of the peroxidase substrate ABTS.
6. The application of the protein encoded by the Ganoderma lucidum peroxidase GlDyP gene as described in claim 2 in the degradation of lignin model compounds; wherein the lignin model compounds are DMP and guaiacol.
7. The application of the protein encoded by the Ganoderma lucidum peroxidase GlDyP gene as described in claim 2 in dye decolorization, wherein the dye is one or more of Reactive Blue 19, Reactive Brilliant Blue X-BR, Reactive Black 5, Methyl Orange, Trypan Blue, and Malachite Green.