Phyllostachys nireh flavonoid compound synthesis related gene pnf3h and application thereof

Abstract

Phyllostachys nireh flavonoid compound synthesis related gene PnF3H and application thereof belong to the technical field of molecular biology. The present application provides, on one hand, flavonoid compound synthesis related gene PnF3H and its coding protein, and on the other hand, the use of flavonoid compound synthesis related gene PnF3H. The present application provides an important and possibly universal gene resource for regulating flavonoid synthesis in Phyllostachys nireh, which provides an excellent candidate gene for cultivating plant varieties with changes in bamboo culm color.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a gene related to the synthesis of flavonoid compounds in *Purple Bamboo*. PnF3H And its applications. Background Technology

[0002] Flavonoids are a class of naturally occurring polyhydroxyphenolic secondary metabolites found in plants, widely distributed throughout the plant kingdom, and possessing high biological activity. As important secondary metabolites synthesized naturally in plants, flavonoids are closely related to the color development of leaves, stems, and flowers. Furthermore, flavonoids are now widely recognized as a major class of bioactive components in phytochemicals, playing diverse roles in plant growth, development, reproduction, and responses to various stresses. They also play a crucial role in animal growth and development, medical advancements, and human health. Studies have found that naturally occurring flavonoids possess many beneficial physiological activities and functions, including antibacterial, antioxidant, bacteriostatic, and anticancer effects.

[0003] The basic structure of flavonoids consists of a core C-skeletal structure formed by the connection of a 3-carbon pyran ring and a 15-carbon phenylpropane ring between two benzene rings. This skeleton can be acylated, methoxylated, hydroxylated, or O-glycosylated by different enzymes to form different types, which can be specifically divided into six major classes: flavonols, anthocyanidins, flavones, flavanones, isoflavones, and flavanols.

[0004] The phenylalanine metabolic pathway is a major process in the biosynthesis of flavonoids, generally starting with phenylalanine metabolism and entering the flavonoid biosynthesis branch. First, phenylalanine is deaminated by phenylalanine ammonia-lyase (PAL) to produce cinnamic acid. Cinnamate 4-hydroxylase (C4H) introduces a hydroxyl group onto the benzene ring of cinnamic acid to produce coumaric acid. Then, under the action of coumaroyl-CoA ligase, coumaric acid is catalyzed to coumaroyl-CoA. Coumaroyl-CoA and malonyl-CoA, catalyzed by chalcone synthase (CHS) and chalcone isomerase (CHI), produce naringenin, an important precursor in flavonoid biosynthesis. Subsequently, naringenin, as the main metabolite, enters the synthesis pathway of other flavonoids. Catalyzed by enzymes such as flavanone-3-hydroxylase (F3H), flavanone-3'-hydroxylase (F3'H), and flavonol synthase (FLS), it is finally converted into flavonoids, isoflavones, flavonols, and anthocyanin precursors.

[0005] Flavanone-3-carboxylase (F3H) is a key enzyme gene in the anthocyanin biosynthesis pathway in plants, primarily responsible for catalyzing the conversion of naringenin to dihydroflavonols, and is ubiquitous in plants. However, no genes related to the synthesis of flavonoid compounds in *Phyllostachys edulis* have been reported in the current technology. F3H And its uses.

[0006] In summary, regarding the flavonoid synthesis pathways involved in flavonoid synthesis... F3H Gene research helps to understand the mechanism of flavonoid synthesis and lays the foundation for understanding the molecular mechanism of bamboo culm color development. Summary of the Invention

[0007] To address the problems existing in the prior art, the purpose of this invention is to design and provide a gene related to the synthesis of flavonoid compounds from *Purple Bamboo*. PnF3H and the technical solutions for their application.

[0008] This invention is achieved through the following technical solution: The first aspect of this invention provides a gene related to the synthesis of flavonoid compounds in purple bamboo. PnF3H The nucleotide sequence is shown in SEQ ID NO.1.

[0009] The second aspect of this invention provides a gene related to the synthesis of the aforementioned flavonoid compounds from *Purple Bamboo*. PnF3H The encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0010] A third aspect of this invention provides a gene containing the above-mentioned gene for the synthesis of a type of flavonoid compound from *Purple Bamboo*. PnF3H The carrier.

[0011] The fourth aspect of this invention provides a gene related to the synthesis of the aforementioned flavonoid compounds from *Purple Bamboo*. PnF3H Or the application of the aforementioned carriers in regulating the synthesis of flavonoid compounds.

[0012] Furthermore, the aforementioned application enables plants to contain genes. PnF3H Or cause plants to overexpress genes PnF3H .

[0013] The fifth aspect of this invention provides a method for regulating the synthesis of plant flavonoids, the method comprising: incorporating a gene into the plant PnF3H Or cause plants to overexpress genes PnF3H .

[0014] Furthermore, the method specifically includes the following steps: 1) Collect leaves of one-year-old purple bamboo, extract RNA, reverse transcribe it into cDNA, and clone it. PnF3H The CDS sequence was obtained, then ligated into the pC-1300GFP vector and sequenced. After confirmation, a 35S:: vector was constructed. PnF3H Overexpression vector; 2) Construct 35S:: PnF3H The overexpression vector was transferred into plant callus tissue, enabling the plant to contain the gene. PnF3H Or cause plants to overexpress genes PnF3H .

[0015] The present invention has the following beneficial effects: 1. This invention is the first to obtain from purple bamboo. PnF3H The gene and its encoded protein were identified, and its biological function in regulating flavonoid synthesis was verified.

[0016] 2. This invention is the first to incorporate purple bamboo. PnF3H The gene was overexpressed in the callus of tobacco and Malayan sweet bamboo. PCR was used to prove that the gene had been successfully integrated into the tobacco genome and the callus of Malayan sweet bamboo, i.e., positive lines.

[0017] 3. This invention uses cDNA from transgenic tobacco leaves, wild-type tobacco leaves, common Malayan sweet bamboo callus, and transgenic Malayan sweet bamboo callus as templates for qRT-PCR analysis, and determines... PnF3H Flavonoid content in transgenic tobacco and *Phyllostachys pubescens* callus was determined by overexpression. PnF3H In the transgenic lines, the expression levels of most genes in the tobacco flavonoid synthesis pathway were upregulated, but not significantly, suggesting... PnF3H It may play a role in the synthesis of tobacco flavonoids. (In overexpression) PnF3H Genetically modified callus of Malayan sweet bamboo, PnF3H The expression levels of key genes in the flavonoid synthesis pathway were increased in different lines of transgenic Malayan sweet bamboo, suggesting that... PnF3H It may play a certain role in the synthesis of flavonoids in bamboo. Attached Figure Description

[0018] Figure 1 Key enzyme genes in the flavonoid synthesis pathway F3H -like expression heatmap; Figure 2 PnF3H Gene cloning; Figure 3 Tobacco (A) and Malayan sweet bamboo (B) are different strains. PnF3H Gene expression levels, ** indicates highly significant (P≤0.01). Figure 4 Tobacco (A) is different from Malayan sweet bamboo (B). PnF3H Flavonoid content in overexpression strains, * indicates significant (P≤0.05); Figure 5 PnF3H Expression levels of key genes in the flavonoid synthesis pathway in different transgenic tobacco lines. * indicates significant (P≤0.05); ** indicates highly significant (P≤0.01). Figure 6 PnF3H Expression levels of key genes in the flavonoid synthesis pathway in different lines of transgenic Malayan sweet bamboo. * indicates significant (P≤0.05); ** indicates highly significant (P≤0.01). Detailed Implementation

[0019] The present invention will be further described in detail below with reference to specific examples. These descriptions are for explanation purposes only and not for limitation.

[0020] Example 1: Purple Bamboo PnF3H Cloning of genes 1. Material preparation One-year-old leaves of purple bamboo were collected from the purple bamboo forest of Zhejiang A&F University in Lin'an District, Hangzhou City, Zhejiang Province, and stored at -80℃ for subsequent experiments.

[0021] 2. RNA extraction RNA extraction was performed according to the instructions of the RNA extraction kit from Hangzhou Simgen Biotechnology Co., Ltd. The specific steps are as follows: (1) Place the leaves of the purple bamboo into a sterilized mortar and grind them into powder. Weigh 300 mg of the sample into a 1.5 mL RNA-free centrifuge tube, add 600 μL of Buffer RCT with added β-mercaptoethanol, and vortex to dissolve it completely.

[0022] (2) Add 600 μL of BufferEX to the 1.5 mL RNA-free centrifuge tube from step (1), shake thoroughly to mix evenly, and centrifuge at 12,000 rpm for 5 min.

[0023] (3) Take 400 μL of the supernatant from step (2) and transfer it into a new 1.5 mL RNA-free centrifuge tube.

[0024] (4) Add 400 μL Buffer K to the supernatant from step (3) and mix well. Transfer the entire mixture to the filter column, cover the tube, and centrifuge at 13500 rpm for 2 min.

[0025] (5) Discard the filter column from step (4), add 700 μL of 70% ethanol to the filtrate and mix it evenly with a pipette tip.

[0026] (6) Take 700 μL of the mixture from step (5) and add it to the nucleic acid purification column, and centrifuge at 13,000 rpm for 1 min.

[0027] (7) Discard the filtrate in the 2 mL centrifuge tube, put the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube, take the remaining mixture and add it to the nucleic acid purification column, and centrifuge at 13,000 rpm for 1 min.

[0028] (8) Discard the filtrate in the 2 mL centrifuge tube, put the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube, add 500 μL Buffer WA (with anhydrous ethanol added) to the nucleic acid purification column, cap the tube, and centrifuge at 13,000 rpm for 1 min.

[0029] (9) Discard the filtrate in the 2 mL centrifuge tube, put the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube, add 600 μL Buffer WBR (with anhydrous ethanol added) to the nucleic acid purification column, cap the tube, and centrifuge at 13,000 rpm for 1 min.

[0030] (10) Discard the filtrate in the 2 mL centrifuge tube, put the nucleic acid purification column back into the 2 mL centrifuge tube, and centrifuge at 14,000 rpm for 1 min.

[0031] (11) Discard the 2 mL centrifuge tube, place the nucleic acid purification column in a clean 1.5 mL RNA-free centrifuge tube, add 40 μL RNase-free Water to the center of the membrane of the purification column, cap the tube, let it stand at room temperature for 1 min, and centrifuge at 13,000 rpm for 1 min.

[0032] 3. RNA reverse transcription All reactions were performed on ice, following the instructions of the NovoScriptv Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) kit.

[0033] (1) Genomic DNA removal. All reagents were prepared on ice, centrifuged and mixed, and reacted at 42°C for 5 min.

[0034] gDNA Purge 1μL template RNA 500ng <![CDATA[RNase Free ddH2O]]> up to 10μL (2) RNA reverse transcription to cDNA. Add the following reaction mixture to the PCR tube in step one, mix thoroughly, centrifuge, react at 50℃ for 15 min, react at 75℃ for 5 min, and cool on ice.

[0035] Step (1) Reaction solution 10μL 2*NovoScript Plus 1st Strand cDNA Synthesis SuperMix 10μL (3) After the cDNA is reverse transcribed, it is diluted 10 times and stored at -20℃ for subsequent experiments.

[0036] 4. Gene cloning (1) Design using Oligo 7.0 software PnF3H Specific PCR primers, synthesized by Hangzhou Youkang Biotechnology Co., Ltd., have the following sequences: PnF3H -cds-F:ATGGCGGACCAGCTCATCTCCAC (as shown in SEQ ID NO.3) PnF3H -cds-R: CTAGGTTCTGAAGAACTCCAAACAGTGCTC (as shown in SEQ ID NO.4) (2) PCR amplification Using DNA from *Phyllostachys edulis* leaves as a template, PCR amplification was performed using appropriate primers. The reaction program was: 95℃ for 5 min; 95℃ for 5 s, 60℃ for 30 s, 72℃ for 60 s, 32 cycles; 72℃ for 10 min. The amplification instrument was a CFX96. TM The amplification system for a real-time PCR instrument is shown below: .

[0037] (3) Prepare 1.2% agarose gel and perform agarose gel electrophoresis experiment. The voltage is set to 125 V and the time is set to 20 min. Check whether the size of the target gene fragment meets the expectations. If the target fragment meets the expectations, cut the gel and purify it.

[0038] (4) Gel recovery and purification: The gel recovery product was purified using the SanPrep column DNA gel recovery kit from Shanghai Sangon Biotech Co., Ltd.

[0039] (5) Connection reaction Referencing Takara pMD TM The 18-T Vector Cloning Kit manual states that the connection time is 3-10 hours, and the connection system is as follows: .

[0040] (6) Transformation of ligation product into competent E. coli DH5α cells Referring to the E. coli DH5α transformation instructions from Shanghai Weidi Biotechnology Co., Ltd., the specific steps are as follows: ① Place the purchased competent E. coli cells DH5α on ice for 5 min to freeze and thaw, add 10 μL of ligation product, gently tap the bottom of the tube to mix, and let stand on ice for 30 min.

[0041] ② After 45 seconds at 42℃, let stand on ice for 2 minutes.

[0042] ③ Add 300 μL of antibiotic-free LB medium, and incubate at 220 rpm and 37°C for 1 h with shaking.

[0043] ④ Take about 100 μL of culture medium and spread it evenly on Luria-Bertani (LB) medium (containing ampicillin), and incubate at 37°C for 12 h.

[0044] ⑤ Select single colonies and place them in a centrifuge tube containing 1 mL of liquid culture medium with the corresponding antibiotic. Incubate at 37°C and 220 rpm for 6 h until the bacterial solution becomes turbid. Then perform bacterial PCR identification.

[0045] ⑥ Send the positive bacterial cultures identified correctly in step 5 to Shanghai Sangon Biotech Co., Ltd. for sequencing. Select more than 3 single clones for each sequence to reduce the impact of mismatched gene sequence confirmation during PCR.

[0046] The gene for flavonoid synthesis was finally cloned. PnF3H The nucleotide sequence is shown in SEQ ID NO.1, and the gene related to flavonoid synthesis... PnF3H The amino acid sequence encoding the protein is shown in SEQ ID NO.2.

[0047] Key enzyme genes in the flavonoid synthesis pathway F3H-like Expression heatmap as follows Figure 1 As shown, Figure 1 The depth of color represents the level of expression. PnF3H Gene cloning, such as Figure 2 As shown in the figure, M: DL2000Marker, and its bars represent 2000, 1000, 750, 500, 250, and 100bp from top to bottom.

[0048] Example 2: Genetic transformation of tobacco and Malayan sweet bamboo 1. Genetic transformation of tobacco (1) Pre-culture Tobacco seeds were disinfected with 75% alcohol for 30 seconds, rinsed with sterile water for 1 minute, and then disinfected with 84 disinfectant for 3-5 minutes, followed by rinsing with sterile water 3 times, 1 minute each time. The disinfected tobacco seeds were sown on germination medium and cultured at 23℃ for 16h / 8h (light / dark) for 4-5 weeks. Sterile tobacco leaves were cut into small pieces with a scalpel and inoculated onto the medium.

[0049] (2) Agrobacterium infection, co-culture, induction Agrobacterium bacterial suspension stored at -80℃ was shaken extensively, and colonies were collected in tobacco infection solution to prepare Agrobacterium resuspension with OD600=0.2. Tobacco leaves pre-cultured for 2-3 days were inoculated into the Agrobacterium suspension for 10-15 min. The infected tobacco leaves were then inoculated onto filter paper, dried, and then inoculated onto co-culture medium and cultured in the dark for 48-72 h. After 2 days of co-culture, the leaves were transferred to induction medium to induce callus formation, which took about 10 days to allow callus tissue to grow.

[0050] (3) Screening for resistant callus Select callus tissue that meets the standards, inoculate it on the corresponding resistance selection medium, and culture for 15-30 days at a temperature of 21-25℃.

[0051] (4) Differentiation and rooting Vigorous, resistant callus tissue selected from the second screening was inoculated onto differentiation medium, 4-5 callus per dish, and cultured at 23℃ for 16h / 8h (light / dark) for 15-30 days. During differentiation, once seedlings formed from the callus tissue, they were inoculated onto seedling growth medium and grown for 7-10 days.

[0052] 2. Genetic transformation of Malayan sweet bamboo Select several uniform callus tissues from *Dendrobium nobile* embryogenesis. Allow the callus tissues to divide into individual calluses approximately 0.5-1 cm in size. Infect the callus tissues with *Agrobacterium tumefaciens* (EHA105) bacterial suspension containing 100 μL of acetylsyleugenol, ensuring the callus tissues are completely submerged. Gently agitate the suspension. Infect for 15 minutes. After infection, remove excess suspension and place the callus tissues on a co-culture medium for callus infection. Incubate in the dark at 25°C for 2-3 days. After dark incubation, use sterile water (containing termethin) to desterecize the infected callus. Then, place the callus tissues on a selection medium for screening resistant callus (dark incubation).

[0053] Example 3: 35S:: PnF3H Construction of overexpression vectors RNA was extracted from the leaves of one-year-old purple bamboo grown at Zhejiang Agricultural and Forestry University in Lin'an District, Hangzhou City, Zhejiang Province, as described in Example 1. The RNA was reverse transcribed into cDNA and cloned. PnF3H The CDS sequence was obtained, then ligated into the pC-1300GFP vector and sequenced. After confirmation that the sequence was correct, the overexpression vector 35S:: was constructed. PnF3H .

[0054] Example 4: PnF3H Application of heterologous transformation of tobacco and Malayan sweet bamboo callus in increasing flavonoid synthesis 1. Screening and determination of callus-positive plants transformed from transgenic tobacco and Malayan sweet bamboo. (1) Extraction of DNA and RNA from positive plants and PCR identification of transgenic materials ① Add liquid nitrogen to 300–500 mg of young leaves from positive plants and quickly grind them into powder. Pre-cool a 1.5 mL centrifuge tube with liquid nitrogen, weigh out 100 mg of the sample, and grind it into powder.

[0055] ② Add 500 μL of preheated 65℃ Buffer PL to the ground sample, vortex for 30 s to mix, and then bathe in a 65℃ water bath for 10 min. Shake the sample once every 3 min to ensure complete lysis.

[0056] ④ Add 350 μL of Buffer K, cap the tube, shake vigorously for 15 seconds, and vortex for 30 seconds. Centrifuge at 13,000 rpm for 5 minutes.

[0057] ④ Pour the supernatant obtained from centrifugation in step 3 into the nucleic acid purification column, then place the nucleic acid purification column into a 2 mL centrifuge tube, cap the tube, and centrifuge at 12,000 rpm for 30 s.

[0058] ⑤ Discard the filtrate in the 2 mL centrifuge tube, place the nucleic acid purification column back into the 2 mL centrifuge tube, add 500 μL of Buffer WB (already containing anhydrous ethanol) to the nucleic acid purification column, cap the tube, and centrifuge at 12,000 rpm for 30 s. Discard the filtrate in the 2 mL centrifuge tube, place the nucleic acid purification column back into the 2 mL centrifuge tube, add 600 μL of Buffer WB (already containing anhydrous ethanol) to the nucleic acid purification column, and centrifuge at 12,000 rpm for 30 s.

[0059] ⑥ Discard the filtrate in the 2 mL centrifuge tube, place the nucleic acid purification column back into the 2 mL centrifuge tube, and cap the tube. Centrifuge at 500 rpm for 2 min.

[0060] ⑦ Discard the 2 mL centrifuge tube, place the nucleic acid purification column into a 1.5 mL centrifuge tube, add 20 μL of preheated 65℃ Buffer TE to the purification column, cap the tube, incubate at room temperature for 2 min, and centrifuge at 12,000 rpm for 30 s. Store the eluted DNA at -20℃ for subsequent experiments.

[0061] ⑧ RNA was extracted from positive plants according to the RNA extraction method in Example 1.

[0062] 9. Use PnF3H CDS primers were used to identify the DNA and RNA levels of the selected transgenic seedlings. The PCR reaction program was: 95℃ 5 s, 60℃ 30 s, 72℃ 60 s, 26 cycles.

[0063] (2) Overexpression PnF3H Analysis of gene expression levels in callus tissues of tobacco and Malayan sweet bamboo To explore PnF3H Regarding gene function, we constructed 35S:: PnF3H The overexpression vector was transformed into callus tissues of wild-type tobacco (K326) and *Phyllostachys pubescens*. DNA and RNA were extracted from the leaves of transgenic plants and from the callus tissues of *Phyllostachys pubescens*, respectively. Then, PCR amplification and sequencing of the target fragments were performed to identify transgenic positive lines. qRT-PCR analysis was conducted using cDNA from transgenic tobacco leaves, wild-type tobacco leaves, ordinary *Phyllostachys pubescens* callus tissues, and transgenic *Phyllostachys pubescens* callus tissues as templates. PnF3H Gene expression levels, such as Figure 3 As shown. Figure 3 As shown in (A), PnF3H The overexpressing tobacco strains were named respectively. OE1 , OE2 , OE3 , OE4 , OE5 .like Figure 3 As shown in (B), PnF3H The overexpression lines of Malayan sweet bamboo were named respectively. D.asper-OE1, D.asper-OE2, D.asper-OE3, D.asper-OE4, D.asper- OE5 .

[0064] (3) PnF3H Quantitative determination of genes related to the flavonoid synthesis pathway in genetically modified tobacco and Malayan sweet bamboo ① Referring to relevant literature reports, the expression levels of genes related to the flavonoid synthesis pathway in tobacco were detected. The main genes selected are as follows: C4L, CHS, CHI, C4H, F3H, F3´H, FLS, ANR, DFR and UFGT .

[0065] ② Expression levels were analyzed by reverse transcription using RNA from transgenic tobacco and *Phyllostachys pubescens* leaves as templates. Real-time quantitative PCR was performed according to the SYBR Premix (Novoprotein) kit instructions. The reaction system was as follows: PCR program: 95℃ 30 s; 95℃ 5 s, 60℃ 30 s, 39 cycles; 65℃ 5 s, 95℃ 5 s. Melting curves were measured from 60℃ to 95℃. Each reaction was performed in triplicate.

[0066] .

[0067] (4) Determination of flavonoid content in transgenic plants Referring to the instructions for the plant flavonoid content detection kit from Beijing Solarbio Biotechnology Co., Ltd., the flavonoid content of transgenic plants was determined. The specific steps are as follows: ① Sample preparation: Dry the sample to constant weight, pulverize it using a pulverizer, pass it through a 30-50 mesh sieve, weigh approximately 0.1 g, add 1 mL of 60% ethanol, and extract using ultrasonic extraction. The ultrasonic power is 300 W, pulverization time is 5 s with an 8 s interval, the temperature is set to 60℃, and extraction time is 30 min. Then centrifuge (12000 rpm, 25℃, 10 min), collect the supernatant, and dilute the supernatant to 1 mL with 60% ethanol solution for analysis.

[0068] ② Steps for determining flavonoid content: A. Preheat the visible light photometer for at least 30 minutes, adjust the wavelength to 470 nm, and zero it.

[0069] B. Preparation of standard solutions: Dilute the 10 mg / mL rutin standard solution with standard to 1.5, 1.25, 0.625, 0.3125, 0.15625, 0.078, 0.039 and 0.02 mg / mL for later use.

[0070] C. The operation table is as follows: .

[0071] ③ Calculation of flavonoid content: a. Standard curve plotting: Plot the standard curve y=kx+b with rutin concentration as the x-axis and △A′ as the y-axis. Substitute △A into the curve to calculate x (mg / mL). b. Flavonoid content (mg / g) = x × V / W (V: extraction liquid volume, W: sample mass).

[0072] 2. Functional verification (1) PnF3H Determination of flavonoid content in transgenic tobacco and *Phyllostachys pubescens* callus: by analyzing five overexpressing... PnF3H Genetically modified tobacco and three overexpressions PnF3H The flavonoid content in the callus tissue of genetically modified Malayan sweet bamboo was determined, and the results are as follows: Figure 4 As shown. By analyzing the changes in flavonoid content in transgenic tobacco and wild-type tobacco, we found that in five overexpression... PnF3H The synthesis of flavonoids in tobacco was significantly increased. Figure 4 (B) It can be seen that the overexpression of the three selected Malayan sweet bamboos... PnF3H In the callus tissue, the content of flavonoids in the overexpressed callus tissue was increased, especially in the strains. D.asper-OE2 The synthesis of flavonoids was significantly increased.

[0073] (2) PnF3H Expression analysis of genes related to flavonoid synthesis pathway in transgenic tobacco and Malayan sweet bamboo: F3H Enzyme genes are key enzyme genes in the flavonoid synthesis pathway. To verify... PnF3H To investigate the specific roles of genes involved in the flavonoid synthesis pathway in tobacco, RNA was extracted from overexpressing and wild-type tobacco, as well as from callus tissue of *Dendrobium nobile* and overexpressing *Dendrobium nobile*. The expression levels of related genes in the flavonoid synthesis pathway were detected by RT-qPCR. The results are as follows: Figure 5 and Figure 6 As shown. (Through) Figure 5 As we can see, we found that in overexpression PnF3H In the transgenic lines, the expression levels of most genes in the tobacco flavonoid synthesis pathway were upregulated, but not significantly. F3H downstream genes of enzyme genes DFR In overexpression PnF3H The effect was significantly enhanced in all three strains. CHI The gene expression level was significantly increased in all overexpression lines, suggesting that... PnF3HIt may play a certain role in the synthesis of tobacco flavonoids, from Figure 5 It can be seen that in overexpression PnF3H Genetically modified callus of Malayan sweet bamboo, F3′H and UFGT Gene expression levels are increased. CHS Significance increased, inference PnF3H It may play a certain role in the synthesis of flavonoids in bamboo.

Claims

1. A gene related to the synthesis of flavonoid compounds in purple bamboo. PnF3H Its features are: The nucleotide sequence of this gene is shown in SEQ ID NO.

1.

2. The gene related to the synthesis of flavonoid compounds from *Purple Bamboo* as described in claim 1. PnF3H The encoded protein is characterized by: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Contains the gene related to the synthesis of the purple bamboo flavonoid compound as described in claim 1. PnF3H The carrier.

4. The gene related to the synthesis of flavonoid compounds in *Purple Bamboo* as described in claim 1. PnF3H Or the application of the carrier according to claim 3 in regulating the synthesis of flavonoid compounds in tobacco, characterized in that, The regulation is to enable the expression of tobacco genes. PnF3H, To increase the content of flavonoids in tobacco.

5. A method for improving the synthesis of plant flavonoids, characterized in that: To enable plants to express the gene of claim 1 PnF3H The plant in question is tobacco.

6. The method as described in claim 5, characterized in that: Specifically, the following steps are included: 1) Collect leaves of one-year-old purple bamboo, extract RNA, reverse transcribe it into cDNA, and clone it. PnF3H The CDS sequence was obtained, then ligated into the pC-1300GFP vector and sequenced. After confirmation, a 35S:: vector was constructed. PnF3H Overexpression vector; 2) Construct 35S:: PnF3H The overexpression vector was transferred into tobacco callus tissue, enabling the expression of the tobacco gene. PnF3H .

Images