Use of hepatocyte growth factor for the preparation of a medicament for the treatment of inflammatory pain

Abstract

The application discloses a role of hepatocyte growth factor in preparation of a medicine for treating inflammatory pain. The application selects B6 mice, constructs two kinds of inflammatory pain models by injecting capsaicin or formalin on the sole, firstly selects DRG tissue to extract total mRNA, and detects expression changes of HGF mRNA in the inflammatory process, and secondly detects the role of HGF and PHA (HGF blocking agent) in the inflammatory pain through two different administration modes (administration on the sole and intrathecal administration). The experimental results show that HGF participates in the inflammatory pathological process and has a role in relieving pain, and can provide a theoretical basis for future researches on the occurrence and development of inflammation and the like.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the role of hepatocyte growth factor in the preparation of drugs for treating inflammatory pain. Background Technology

[0002] Hepatocyte growth factor (HGF) is an important multifunctional protein involved in various cellular physiological activities, including regulating angiogenesis, cell survival, migration, and anti-inflammation. Studies have reported that HGF can also act as a neurotrophic factor, exerting direct or indirect regulatory effects in the central and peripheral nervous systems. In the early stages of peripheral nerve development, HGF not only promotes the survival and axonal regeneration of motor neurons but also induces neurite elongation in sensory neurons. Following peripheral nerve injury, the expression level of endogenous HGF increases in the injured tissue, interacting with c-MET receptors in Schwann cells to induce Schwann cell proliferation and migration, activate the ERK signaling pathway, and increase the expression of inflammatory factors GDNF and LIF.

[0003] Peripheral nerve injury often triggers an inflammatory response, leading to intense pain. Literature reports indicate that hemoglobin (HGF) participates in the peripheral nerve inflammatory process; however, the specific role of HGF in inflammatory pain remains unclear. This application uses two inflammatory pain models—capsaicin and formalin—and administers HGF via both plantar and intrathecal routes to investigate the effects and influences of HGF on peripheral inflammatory pain. Summary of the Invention

[0004] The purpose of this invention is to provide the role of hepatocyte growth factor in the preparation of medicaments for the treatment of inflammatory pain.

[0005] This invention uses B6 mice to establish two inflammatory pain models by injecting capsaicin or formalin into the sole of the foot. First, total mRNA was extracted from DRG tissue to detect changes in HGF mRNA expression during the inflammatory process. Second, the roles of HGF and PHA (HGF blocker) in inflammatory pain were investigated using two different administration routes (sole administration and intrathecal administration). During the inflammatory response, HGF mRNA expression levels were significantly increased compared to the control group. Both sole and intrathecal administration of HGF significantly alleviated the inflammatory pain response compared to the control group. After administration of the PHA blocker, mice regained pain sensation. HGF mRNA expression levels were significantly upregulated; HGF administration effectively alleviated the inflammatory pain response. All these results demonstrate that HGF participates in and regulates the inflammatory pain process.

[0006] This invention demonstrates through experiments that HGF participates in the inflammatory pathological process and has a pain-relieving effect; this provides a theoretical basis for future research on the occurrence and development of inflammation. Attached Figure Description

[0007] Figure 1 The results show the changes in HGF mRNA expression levels during inflammation. A represents the changes in HGF mRNA expression levels in the experimental and control groups; B represents statistical analysis, with **P < 0.01 and ***P < 0.001 compared to the control group.

[0008] Figure 2 The results show the inhibition of inflammatory pain response after intrathecal administration of HGF. A is a diagram illustrating the experimental groups, intrathecal administration time, capsaicin modeling time, and behavioral testing time (0-5 min); B is the statistical analysis of the effect of HGF on pain in capsaicin-induced mouse models; C is a diagram illustrating the experimental groups, formalin modeling time, and behavioral testing time (0-1 h); D is the statistical analysis of the effect of HGF on pain in formalin-induced mouse models. n=5-6 / group, **P<0.01, ns indicates no significant difference.

[0009] Figure 3 The results of HGF plantar administration inhibiting inflammatory pain response are shown. A is a diagram illustrating the experimental groups, plantar administration time, capsaicin modeling time, and behavioral testing time (0-5 min); B is a statistical analysis of the effect of HGF on pain in capsaicin-induced mouse models; C is a diagram illustrating the experimental groups, formalin modeling time, and behavioral testing time (0-45 min); D is a statistical analysis of the effect of HGF on pain in formalin-induced mouse models. n=5-6 / group, *P<0.05, **P<0.01, ***P<0.001, ns indicates no significant difference. Implementation

[0010] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0011] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0012] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0013] Hemoglobin (HGF) plays a crucial role in nerve injury and neuropathic pain, participating in the regulation of various pathophysiological processes such as Schwann cells, glial cells, and inflammatory factors. The inventors hypothesized that HGF might also regulate inflammatory pain. Based on this hypothesis, they conducted related research. First, two inflammatory pain models (capsaicin-induced and formalin-induced models) were established. Total RNA was extracted from DRG tissues, and PCR was used to detect changes in HGF expression during the inflammatory process. The results showed that the experimental group had a significantly increased HGF mRNA level compared to the control group. Next, the mice were divided into two groups (control group, HGF, and HGF+PHA), and administered HGF via plantar administration and intrathecal administration. Behavioral changes in the two models were then examined. The results showed that both methods of HGF administration significantly alleviated inflammatory pain. The use of a PHA inhibitor blocked the effect of HGF, and the mice regained their pain response. These results indicate that HGF participates in the inflammatory pathological process and has a pain-relieving effect; this can provide a theoretical basis for future research on the occurrence and development of inflammation. Example 1

[0014] I. Materials and Methods 1.1 Main reagents: HGF (Origene, catalog number: TP315593), PHA665752 (Bio-techne, catalog number: 2693), capsaicin (Shanghai Biotech, catalog number: 2444-464), formalin (Solarbio, catalog number: G2160), physiological saline.

[0015] 1.2 Experimental Animals: Male C57BL / 6 mice (6-8 weeks old, 20-25g) were purchased from the Experimental Animal Center of Nantong University School of Medicine. Mice were allowed free access to food and water, followed by a 12-hour diurnal cycle, and kept at 24°C. After acclimatization for 3-5 days, the animal model was established, and drugs were administered and behavioral tests were performed.

[0016] 1.3 Animal Model: 10 μL of capsaicin (1.6 μg per mouse) or 10 μL of formalin (2% concentration) was subcutaneously injected into the center of the left hind limb of a mouse. Each experimental group consisted of 6-8 animals.

[0017] 1.4 Experimental groups: control group (physiological saline, 10 μL), experimental group 1 (HGF, 1 μg / animal, 10 μL), experimental group 2 (HGF 1 μg + PHA 16.5 μg / animal, 10 μL).

[0018] 1.5 Administration methods: (1) Foot administration: 10 μL of drug is injected subcutaneously into the center of the left hind limb; (2) Intrathecal administration: Remove the hair on the back of the mouse, pinch the iliac bone to control the mouse, locate the L5-6 spinous process, use a micro-insulin syringe, slowly insert the needle at a 30° angle and inject 10 μL of drug, and the mouse will reflexively flick its tail to indicate successful administration.

[0019] 1.6 Behavioral Experiments: A model was established and drugs were administered. Animals were placed in transparent plastic boxes, and the cumulative time of pain responses such as paw lifting, licking, and shaking was observed. The observation time for the capsaicin model group was 5 minutes, and for the formalin model group, it was 45 minutes.

[0020] 1.7 RT-PCR experiment: Mouse DRG tissue (L5-6) was isolated, total RNA was extracted using the Trizol method, and then reverse transcribed into cDNA. The expression changes of HGF mRNA were detected, and β-actin was used as an internal control.

[0021] The primer sequences are as follows: HGF: F:5'CTGGTTCCCCTTCAATAGCA3' (seq_1) R: 5'CTCCAGGGCTGACATTTGAT 3' (seq_2); GAPDH: F: 5'TCCATGACAACTTTGGCATTG 3' (seq_3) R: 5' CAGTCTTCTGGGTG GCAGTGA 3' (seq_4).

[0022] 1.8 Statistical methods: Data are expressed as mean ± SEM. Graphpad 8.0 software was used for statistical analysis and graphing. One-way ANOVA was used for comparisons between groups. The results are expressed as follows: *P<0.05; **P<0.01; ***P<0.001.

[0023] II. Experimental Results 1. Changes in HGF mRNA expression levels during inflammation. like Figure 1 As shown, compared with the control group, the mRNA expression level of HGF in the inflammatory model group was significantly increased. This change in HGF expression suggests that it plays a specific role in the inflammatory response.

[0024] 2. Intrathecal administration of HGF significantly inhibits inflammatory pain response. In mice, 10 μL of HGF was administered intrathecally (control group, HGF group, HGF+PHA group), followed by a plantar injection of capsaicin or formalin 5 minutes later to induce inflammatory pain. The cumulative time of pain response in the mice was recorded. Behavioral results showed that intrathecal administration of HGF effectively relieved pain caused by capsaicin (…). Figure 2 (as shown in A and B) and formalin-induced inflammatory pain ( Figure 2 (As shown in C and D); PHA (HGF blocker) can block the function of HGF, and the mice once again felt intense pain ( Figure 2 (As shown in AD).

[0025] 3. HGF plantar administration significantly inhibits inflammatory pain response. Mice were administered 10 μL of HGF via paw bolus injection (control group, HGF group, HGF+PHA group), followed by capsaicin or formalin injection 5 minutes later to induce inflammatory pain. The cumulative time of pain response was recorded. Behavioral results indicated that HGF paw bolus administration could also effectively alleviate capsaicin (…). Figure 3 (as shown in A and B) and formalin-induced inflammatory pain ( Figure 3 (As shown in C and D); PHA (HGF blocker) can block the function of HGF, and the mice can feel pain again. Figure 3 (As stated in A and D).

[0026] The above results indicate that HGF participates in the inflammatory pathological process and has a pain-relieving effect; this can provide a theoretical basis for future research on the occurrence and development of inflammation.

Claims

1. Application of substances used to detect hepatocyte growth factors in the preparation of diagnostic reagents for inflammatory pain.

2. The application according to claim 1, characterized in that: The substance used to detect hepatocyte growth factor is a substance used to detect the expression level of hepatocyte growth factor and / or a substance used to detect the concentration of hepatocyte growth factor.

3. Application of hepatocyte growth factor in screening drugs for the treatment of inflammatory pain.

4. Application of hepatocyte growth factor in the preparation of drugs for treating inflammatory pain.

Images