Monoclonal antibody specifically binding to an epitope of porcine circovirus type 3 antigen and use thereof

Abstract

The application discloses a monoclonal antibody specifically combined with an epitope of a porcine circovirus type 3 antigen and an application thereof, a prokaryotic expression vector for the two epitopes is respectively constructed by predicting a B cell epitope of a PCV3 Cap protein, protein expression is induced, and a monoclonal antibody is prepared by using the expressed protein as an immunogen to immunize mice, and the two antibodies have no cross reaction. A double antibody sandwich ELISA method is established by using the two epitope antibodies of the PCV3 Cap protein, and has the advantages of simultaneously recognizing the PCV3 pathogen, high specificity, no cross reaction with other viruses, low cost, simple operation, short time period, high specificity, large flux, etc. The double antibody sandwich detection method can also be used to accurately quantify the antigen content in a PCV3 subunit vaccine, provides a technical means for current PCV3 diagnosis and epidemiological investigation, provides technical support for the development of a related detection ELISA kit of the PCV3 pathogen, and provides new data for the diagnosis of related diseases.

Description

Technical Field

[0001] This invention belongs to the field of veterinary biotechnology; it relates to monoclonal antibodies that specifically bind to porcine circovirus type 3 antigenic epitopes and their applications. Background Technology

[0002] Porcine circovirus (PCV) is a member of the genus *Circovirus* in the family *Circoviridae*. Porcine circovirus disease is a general term for a series of infectious diseases caused by porcine circoviruses that infect pigs. To date, four types have been identified: PCV1, PCV2, PCV3, and PCV4. PCV1 has not yet been found to be pathogenic to pigs; PCV2 is highly pathogenic and can cause immunosuppression in the host, leading to weakened immune function; PCV4 is a new strain of circovirus discovered in Hunan Province, my country in 2019, and its prevalence and pathogenicity are still uncertain; PCV3, as a newly emerging virus, was first reported in the United States in 2016 and is widely prevalent worldwide. It has been detected in many provinces in China, indicating a trend of its spread within the country. According to relevant studies, PCV3 is more pathogenic than PCV2, and the clinical manifestations of PCV3-infected pigs are similar to those of PCV2, making accurate diagnosis difficult. Therefore, establishing an accurate detection method for PCV3 is of great significance for the detection and prevention of PCV3.

[0003] PCV3 virus particles have an icosahedral morphology and no envelope. Their genome is single-stranded DNA, with ORF2 encoding the major structural protein, the nucleocapsid protein Cap, composed of 214 amino acids. The PCV3 Cap protein shows low amino acid homology to the Cap proteins of PCV1 and PCV2 and does not possess cross-immunoprotective properties, making it a potential target protein for differentiating porcine circovirus infection and in vaccine research. Currently, research on PCV3 detection methods mainly focuses on etiological and serological methods. Etiological detection methods primarily utilize PCR technology, including conventional PCR, duplex PCR, nested PCR, quantitative real-time PCR, loop-mediated isothermal amplification (LAMP), and metagenomic sequencing. Serological detection methods mainly include indirect immunofluorescence (IFA), immunohistochemistry (IHC), and indirect enzyme-linked immunosorbent assay (indirect ELISA). Among them, PCR, indirect immunofluorescence (IFA), and immunohistochemistry (IHC) often require special instruments, are time-consuming to operate, and have a small processing capacity, making them unsuitable for routine infection detection. Indirect ELISA methods cannot accurately quantify the antigens to be tested, have a high probability of cross-reactions, and enzyme-labeled secondary antibodies can only recognize IgG, resulting in low sensitivity and poor specificity.

[0004] Given the high prevalence and infection rates of PCV3 in many provinces and regions of my country, and the huge economic losses it has caused to the pig industry and related sectors, and since there is currently no PCV3 vaccine, epidemiological research on PCV3, especially molecular epidemiological investigations, has received much attention. In previous studies, pathogen detection methods have been limited by small sample sizes, high costs, long time cycles, low sensitivity, low specificity, and limitations imposed by facilities and specialized instruments. Therefore, there is an urgent need to establish a method that is highly sensitive, specific, short in time, and can detect a large number of samples to detect PCV3 infection. Summary of the Invention

[0005] This invention uses bioinformatics software to predict the B-cell antigenic epitope of the PCV3 Cap protein. Based on the prediction results, target sequences are selected, and two prokaryotic proteins targeting different PCV3 epitopes are constructed and expressed. Two monoclonal antibodies targeting different epitopes are prepared, and a double-antibody sandwich ELISA method for detecting porcine PCV3 pathogen is established using these two monoclonal antibodies. This method is simple, rapid, and allows for high-throughput sample processing. It also has good specificity and can be used for the quantification of Cap protein in subunit vaccines and the detection of PCV3 pathogen in pig farms. This provides technical support for investigating the prevalence and infection status of PCV3 in China and lays the foundation for the development of related PCV3 virus detection kits.

[0006] Specifically, this invention constructs and expresses prokaryotic expression vectors containing PCV3 sequences 1-106aa and 107-214aa. The expressed and purified proteins are used as immunogens, added as adjuvants, emulsified, and then used to immunize Balb / c mice. Spleen cells from these immunized mice are then fused with SP2 / 0 cells. Using monoclonal antibody preparation technology, two hybridoma cell lines secreting different epitopes of the Cap protein are screened through subcloning, immunofluorescence, indirect ELISA, and Western blotting. These cells are then expanded into large-scale cultures to prepare monoclonal antibodies and establish a double-antibody sandwich ELISA detection method.

[0007] This invention relates to a mouse monoclonal antibody against Cap that specifically binds to the antigenic epitope of porcine circovirus type 3. 107-214 The variable region sequence, wherein the monoclonal antibody Cap 107-214 The light chain variable region is the amino acid sequence encoded by the sequence shown in SEQ ID No. 1 or its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications through conserved mutations; the heavy chain variable region of the monoclonal antibody is the amino acid sequence encoded by the sequence shown in SEQ ID No. 2 or its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications through conserved mutations.

[0008] This invention relates to antibodies that specifically bind to porcine circovirus type 3 antigenic epitopes, wherein the light chain variable region of the antibody is the sequence shown in SEQ.ID No. 1 or an amino acid sequence encoded by its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications; and the heavy chain variable region of the antibody is the sequence shown in SEQ.ID No. 2 or an amino acid sequence encoded by its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications; the antibody is a monoclonal antibody anti-Cap. 107-214 The antibody retains its ability to specifically bind to amino acid sequences 107–214 expressed in the PCV3 ORF2 gene.

[0009] The monoclonal antibody against Cap 107-2146 The variable region of the light chain is encoded by SEQ ID No. 1 or its degenerate sequence, and the variable region of the heavy chain is encoded by SEQ ID No. 2 or its degenerate sequence.

[0010] The monoclonal antibody against Cap 107-214 The potency is not less than 1:10 6 .

[0011] This invention relates to a mouse monoclonal antibody against Cap that specifically binds to the antigenic epitope of porcine circovirus type 3. 1-106 The variable region sequence, wherein the monoclonal antibody Cap 1-106 The light chain variable region is the amino acid sequence encoded by the sequence shown in SEQ ID No. 3 or its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications through conserved mutations; the heavy chain variable region of the monoclonal antibody is the amino acid sequence encoded by the sequence shown in SEQ ID No. 4 or its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications through conserved mutations.

[0012] This invention relates to antibodies that specifically bind to porcine circovirus type 3 antigenic epitopes, wherein the light chain variable region of the antibody is the sequence shown in SEQ.ID No. 3 or an amino acid sequence encoded by its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications; and the heavy chain variable region of the antibody is the sequence shown in SEQ.ID No. 4 or an amino acid sequence encoded by its degenerate sequence, or a conserved variant obtained by one or more amino acid additions, deletions, substitutions, or modifications; the antibody is a monoclonal antibody anti-Cap. 1-106 The antibody retains its ability to specifically bind to amino acid sequences 1-106 expressed in the PCV3 ORF2 gene.

[0013] The monoclonal antibody against Cap 1-106 The variable region of the light chain is encoded by SEQ ID No. 3 or its degenerate sequence, and the variable region of the heavy chain is encoded by SEQ ID No. 4 or its degenerate sequence.

[0014] The monoclonal antibody against Cap 1-106 The potency is not less than 1:10 7 .

[0015] Furthermore, the antibody that specifically binds to the porcine circovirus type 3 antigenic epitope is characterized in that the monoclonal antibody Cap... 107-214 The amino acid sequence of the light chain variable region is shown in SEQ ID No. 7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID No. 8.

[0016] Furthermore, the antibody that specifically binds to the porcine circovirus type 3 antigenic epitope is characterized in that the monoclonal antibody Cap... 1-106 The amino acid sequence of the light chain variable region is shown in SEQ ID No. 9, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID No. 10.

[0017] The present invention also relates to a hybridoma cell line 4-1, which secretes a monoclonal antibody against Cap. 107-214 .

[0018] The present invention also relates to a hybridoma cell line 17-2, which secretes a monoclonal antibody against Cap. 1-106 .

[0019] This invention also relates to a PCV3 double-antibody sandwich ELISA kit, wherein the kit contains a monoclonal antibody anti-Cap. 107-214 The enzyme-linked reaction plate coated with antigen, positive control serum, negative control serum, and enzyme-labeled secondary antibody are used. The enzyme-labeled secondary antibody is a horseradish peroxidase-labeled monoclonal antibody against Cap. 1-106 The positive control serum was porcine serum collected after immunization with porcine circovirus type 3 inactivated virus; the negative control serum was porcine serum free of porcine circovirus type 3.

[0020] The monoclonal antibody against PCV3 Cap 107-214 The content of the enzyme is 1-10 μg / ml, and the content of the enzyme-labeled secondary antibody is 0.1-0.2 μg / ml.

[0021] Preferably, the monoclonal antibody against PCV3 Cap 107-214 The content of the enzyme is 1 μg / ml, and the content of the enzyme-labeled secondary antibody is 0.1 μg / ml.

[0022] This invention also relates to monoclonal antibodies against Cap. 1-106 and the monoclonal antibody anti-Cap 107-214 Or the application of the PCV3 double antibody sandwich ELISA antibody kit in the detection of porcine circovirus type 3 for non-diagnostic purposes.

[0023] Preferably, the kit is used for non-diagnostic studies of porcine circovirus type 3 epitope identification; the kit can also be used for non-diagnostic purposes such as epidemiological analysis and detection of isolated tissues.

[0024] The PCV3 indirect ELISA antibody kit described above detected a minimum concentration of PCV3 protein of 7.8125 ng / mL.

[0025] This invention also relates to the monoclonal antibody against Cap. 1-106 Cap 107-214 Application in identifying and testing compositions containing porcine circovirus type 3 antigen and other antigens, wherein the other antigens are selected from one or more of porcine circovirus type 2 antigen, classical swine fever virus antigen, porcine pseudorabies virus antigen, porcine reproductive and respiratory syndrome virus antigen, porcine parvovirus antigen, porcine epidemic diarrhea virus antigen, and porcine transmissible gastroenteritis virus antigen.

[0026] This invention predicts the B-cell epitopes of the PCV3 Cap protein, constructs prokaryotic expression vectors targeting these two epitopes, and induces protein expression. The expressed proteins are then used as immunogens to immunize mice to prepare monoclonal antibodies. Two monoclonal antibodies with high specificity and titer targeting different epitopes of the PCV3 Cap protein were screened, and these two antibodies showed no cross-reactivity. A double-antibody sandwich ELISA method was established using these two epitope monoclonal antibodies, which has the advantages of simultaneously recognizing the PCV3 pathogen, high specificity, no cross-reactivity with other viruses, low cost, simple operation, short time cycle, and high throughput. The established double-antibody sandwich detection method can also be used to accurately quantify the antigen content in PCV3 subunit vaccines, providing technical means for current PCV3 diagnosis and epidemiological investigation, providing technical support for the development of related PCV3 pathogen detection ELISA kits, and providing new data for the diagnosis of related diseases. Attached Figure Description

[0027] Figure 1 gel electrophoresis images of cloned DNA with tag sequence Sumo and two different epitope sequences;

[0028] Figure 2 After ligating the tag sequence Sumo to two different epitope sequences into DNA and running gel images;

[0029] Figure 3The image shows a gel image of the pET28a vector linearized by BamHI and HindIII digestion.

[0030] Figure 4 For Sumo-Cap 1-106 gel electrophoresis of cloned DNA;

[0031] Figure 5 For Sumo-Cap 107-214 Epitope cloned DNA gel electrophoresis;

[0032] Figure 6 The results of SDS-PAGE analysis of protein expression in recombinant bacterial cell lysate were obtained.

[0033] Figure 7 The protein expression results of the recombinant expression bacterial cell lysate were verified by Western Blot.

[0034] Figure 8 The specificity and cross-reactivity of monoclonal antibodies from strains 4-1 and 17-2 were validated using Western Blot.

[0035] Figure 9 OD values ​​of PCV3 protein at various dilutions detected by the double antibody sandwich assay. 630 nm value results. Detailed Implementation

[0036] The present invention will be further described below with reference to the embodiments and accompanying drawings, but this is not intended to limit the scope of the invention.

[0037] The term "conservative variant" refers to a variant that essentially retains the characteristics of its parent polypeptide, such as basic immunobiological, structural, regulatory, or biochemical properties. Generally, the amino acid sequence of a conservative variant of a polypeptide differs from that of the parent polypeptide, but the difference is limited to ensure that the sequence of the parent polypeptide and the conservative variant is generally very similar and identical in many regions. Differences in the amino acid sequence between the conservative variant and the parent polypeptide can be, for example, substitutions, additions, and deletions of one or more amino acid residues and any combination thereof. The substituted or inserted amino acid residues may or may not be encoded by the genetic code. Conservative variants of polypeptides can arise naturally or can be unnaturally occurring variants. Unnaturally occurring conservative variants of polypeptides can be produced through mutagenesis or direct synthesis.

[0038] The term "substrate colorimetric solution A" is as follows: Weigh 200 mg of TMB powder, 100 mL of anhydrous ethanol, and add triple-distilled water to a final volume of 1000 mL.

[0039] The term "substrate colorimetric solution B" is as follows: Weigh 14.6g of Na2HPO4, 9.33g of citric acid, and 6.4mL of 0.75% hydrogen peroxide urea. Adjust the pH to 5.0-5.4 and add triple-distilled water to 1000mL.

[0040] This invention constructs and expresses prokaryotic expression vectors containing PCV3 sequences 1-106aa and 107-214aa. The expressed and purified proteins are used as immunogens, added as adjuvants, emulsified, and then used to immunize Balb / c mice. Spleen cells from these immunized mice are then fused with SP2 / 0 cells. Using monoclonal antibody preparation technology, two hybridoma cell lines secreting different epitopes of the Cap protein are screened through subcloning, immunofluorescence, indirect ELISA, and Western blotting. These cells are then expanded into large-scale cultures to prepare monoclonal antibodies, and a double-antibody sandwich ELISA detection method is established.

[0041] Example 1

[0042] I. Construction, Expression and Purification of Recombinant Plasmids

[0043] 1. Porcine circovirus 3 (PCV3) Cap protein epitope Cap 1-106 Cap 107-214 Plasmid construction, expression and detection

[0044] Epitope analysis of the PCV3 Cap protein sequence was performed using software. The Cap protein was divided into 1-106 aa and 107-214 aa for prokaryotic expression, and the sequences of two epitopes were artificially synthesized: PCV3 Cap 1-106 PCV3 Cap 107-214 (As shown in SEQ ID No. 5 and SEQ ID No. 6 respectively), specific primers were designed and synthesized based on the sequences of these two epitopes. Simultaneously, Sumo tag primers (to increase protein expression and promote soluble protein expression) were designed and synthesized. BamHI and HindIII restriction sites were added to the Sumo forward primer and PCV3Cap reverse primer, respectively. The primer sequences are as follows:

[0045] Cap3 1-106 F:ACAGAGAACAGATTGGCATGCGTCACCGTACCATCTTCCG

[0046] Cap3 1-106 R:TAT AAGCTT GTGACCGAACATGGTCTTGGTCTGCTG

[0047] Cap3 107-214 F:ACAGAGAACAGATTGGCACCGCCATCGACCTGGACGGTG

[0048] Cap3 107-214 R:GC AAGCTT CAGCACGCTCTTGTACCTGATCCACAC

[0049] Sumo-F:GC GGATCC ATGTCGGACTCAGAAGTCAATCAAGAAG

[0050] Sumo-R:GCCAATCTGTTCTCTGTGAGCCTCAATAATATCG

[0051] Using the full-length PCV3 sequence as a template, and primer Cap3... 1-106 F / Cap3 1-106 R was used for PCR to amplify PCV3 Cap 1-106 Using the tag sequence Sumo as a template, PCR was performed with primers Sumo-F / Sumo-R to amplify the Sumo sequence, and PCV3Cap was recovered. 1-106 The amplification results of the sequence and the Sumo sequence are as follows: Figure 1 As shown, with PCV3 Cap 1-106 The sequence and the Sumo sequence share a common template, with Cap3 as the base. 1-106 F and Sumo-R: These are primers for amplification, with sumo respectively amplified by the epitope sequence PCV3 Cap. 1-106 Ligate using overlap PCR;

[0052] Using the full-length PCV3 sequence as a template, and primer Cap3... 107-214 F / Cap3 107-214 R was used for PCR to amplify PCV3Cap. 107-214 Using the tag sequence Sumo as a template, PCR was performed with primers Sumo-F / Sumo-R to amplify the Sumo sequence, and the PCV3 Cap was recovered. 107-214 The amplification results of the sequence and the Sumo sequence are as follows: Figure 1 As shown, with PCV3 Cap 107-214 The sequence and the Sumo sequence share a common template, with Cap3 as the base. 107-214 F and Sumo-R: These are primers for amplification, where sumo is amplified with the epitope sequence PCV3Cap. 107-214 Ligate using an overlap PCR method;

[0053] PCV3 Cap 1-106 PCV3 Cap 107-214 The results of ligation with the Sumo tag via overlap PCR are as follows: Figure 2As shown, the linker product Sumo-PCV3 Cap 1-106 Sumo-PCV3 Cap 107-214 The pET28a vector, which was linearized by digestion with BamHI and HindIII, was respectively used. Figure 3 Ligation was performed at a molar ratio of 1:3 using T4 ligase overnight at 16°C. After ligation, the cells were transformed into *E. coli* DH5α competent cells, and single colonies were picked for colony PCR identification. Figure 4 and Figure 5 Sequencing confirmed the absence of base mutations.

[0054] The correctly identified prokaryotic recombinant plasmid pET28a-Sumo-PCV3-Cap will be used. 1-106 pET28a-Sumo-PCV3-Cap 107-214 Transformed E. coli BL21(DE3), positive clones were selected and cultured on a shaker at 37°C and 200 rpm until OD500 was reached. 600 When the value was 0.6, IPTG was added to a final concentration of 0.5 mM, and the cells were induced and cultured at 25°C and 220 rpm for another 8 h. The cells were collected by centrifugation and reselected with lysis buffer. The cells were homogenized by high pressure, and the supernatant and precipitate were separated by centrifugation. The expression of PCV3-Cap was detected by SDS-PAGE of the uninduced whole cells, induced whole cells, induced supernatant, and induced precipitate. A specific protein band appeared at the expected position of 35 kDa. The expression level in the supernatant was very low, and it was mainly expressed stably in the form of insoluble inclusion bodies. Figure 6 ).

[0055] The uninduced whole cells, induced whole cells, post-induction supernatant, and post-induction precipitate of the two recombinant expression strains were subjected to SDS-PAGE, then transferred to a PVDF membrane. His-tagged antibody was used as the primary antibody, and HRP-labeled goat anti-mouse IgG was used as the secondary antibody. Western blotting was then used to further verify the expression of PCV3 Cap protein. The results are as follows: Figure 7 As shown, the expression levels of PCV3 Cap in both uninduced whole bacteria and induced supernatant were very low, while the target bands appeared clearly at 35 kDa in both induced whole bacteria and precipitated white matter, further confirming that PCV3 Cap... 1-106 Cap 107-214 Expressing success.

[0056] The bacterial cells, after high-pressure disruption, were resuspended and centrifuged at 10,000 rpm for 15 min at 4°C to collect the inclusion body precipitate. The precipitate was resuspended in a buffer (2M urea, 1mM EDTA, 50mM Tris, pH 7.0-8.5), sonicated in ice water (50% level, 4-5 times, 30s / time), and centrifuged at 8,000 rpm for 15 min at 4°C to collect the precipitate. The inclusion bodies were then dissolved in a high-concentration 6M guanidine hydrochloride solution. The dissolved denatured protein was placed in a dialysis bag and dialyzed with different gradient refolding buffers, slowly dialyzing at 4°C for 24-36 h each time. Finally, the protein was dialyzed in the resuspension buffer to obtain stable and soluble protein.

[0057] II. Preparation and Validation of Monoclonal Antibodies Against Porcine Circovirus 3 (PCV3) Cap Protein Epitopes 1-106, 107-214

[0058] 2.1 Mouse Immunization

[0059] Take two epitopes from PCV3 Cap and express the prokaryotic protein Cap. 1-106 Cap 107-214 An equal volume of Freund's complete adjuvant emulsified antigen was used to immunize SPF-grade 6-8 week old female Balb / c mice. Multiple subcutaneous injections of 100 μg / mouse were administered into the back of the mice. Two weeks later, Freund's incomplete adjuvant emulsified antigen was used, with multiple subcutaneous injections of 100 μg / mouse into the back of the mice. Fourteen days after the second immunization, a third immunization was administered, using the same vaccine, method, and dosage as the second immunization. One week after the third immunization, the serum antibody titer of the mice was measured. Mice with the highest titer were selected and given a booster immunization of 50 μg / mouse via intraperitoneal injection three days before fusion.

[0060] 2.2 Activation of SP2 / 0 myeloma cells

[0061] Resuscitation of myeloma cells: Remove the cryopreservation tubes of myeloma cells from the liquid nitrogen tank and place them in a 37°C water bath until completely thawed; centrifuge at 1000 rpm for 3-5 minutes; discard the supernatant, and resuspend the settled cells in nutrient solution (RPMI-1640, with a fetal bovine serum concentration of 10%-20%), then add them to a cell culture flask containing an appropriate amount of nutrient solution and incubate in a 5% CO2 37°C incubator; observe the growth of myeloma cells the next day. If the cells are round, translucent, and slightly adherent, the myeloma cells are growing well. If some cells are dark and floating in the liquid, change the medium and discard the floating dead cells. At this point, most of the surviving cells will adhere and proliferate. After 3-5 days of culture, passage the cells to expand the culture.

[0062] Collect the SP2 / 0 cells cultured in the cell plate and resuspend them in 0.5 ml of 1640 basal solution (0.5 × 10⁻⁶). 6 ~1×106 (Number) BALB / c mice were injected subcutaneously into the back. After 9-10 days, once the tumors had grown, the timing for harvesting tumor cells was determined based on their size.

[0063] 2.3 Preparation of SP2 / 0 tumor cells

[0064] The method for preparing it from a tumor growing on the back of a mouse is as follows:

[0065] Mice were euthanized by cervical dislocation, soaked in 75% alcohol for 5 minutes, and tumors were harvested under sterile conditions in a laminar flow hood. The tumor fragments were first cut off and placed in a homogenizer. 5 ml of 1640 basal solution was added, and the cells were thoroughly homogenized. Then, 10 ml of 1640 basal solution was added, and the mixture was allowed to stand for 2 minutes. After larger tissue clumps settled to the bottom of the tube, the supernatant was aspirated into another centrifuge tube. Another 10 ml of 1640 solution was added, and this process was repeated twice (during the resuspension, only 5 ml should be aspirated the first time, as the homogenizer contains more cells and larger tissue clumps, resulting in faster cell settling). The cells were centrifuged at 1000 rpm for 10 minutes, the supernatant was discarded, and the cells were resuspended in 1640 basal solution, maintaining a cell suspension volume of 30 ml. 15 ml of lymphocyte separation medium was added to another 50 ml centrifuge tube, and the cell suspension was gently added on top of the separation medium (ratio 1:2 to 1:1). The centrifuge was then centrifuged at 1200 rpm. After 15 minutes, use a pipette to aspirate the dense white cell layer at the interface. (The pipette should be placed in the middle of the 50ml centrifuge tube for aspiration. There are some tissues and impurities on the inner wall of the centrifuge tube. If these are aspirated, they will affect the purity of the tumor cells.) Wash twice with 1640 solution, then resuspend the cells in 10ml of 1640 solution, count them, and set them aside for later use.

[0066] 2.4 Preparation of immune spleen cells

[0067] Take one BALB / c mouse that has received boosted immunization, euthanize it by bleeding through the eye socket (collect serum, which is the positive serum), and disinfect it by soaking it in 75% alcohol for 5-10 minutes. Fix the disinfected mouse on a dissecting board, fixing the forelimbs and hindlimbs. Use forceps to grasp the skin of the lower abdomen, make a small incision, tear open the skin to expose the peritoneum, change to a new set of forceps and scissors, cut open the peritoneum to expose the spleen, change to another set of instruments, grasp the spleen with forceps, remove the adipose tissue adhering to the cells with scissors, and cut the spleen membrane (you can make a few small cuts in the spleen to facilitate the separation of spleen cells). Place it in a sterile homogenizer; add 5 ml of 1640 basal solution to the homogenizer, squeeze out the spleen cells, remove the homogenizer stick, add 10 ml of 1640 basal solution, let it stand for 2 minutes, aspirate the upper cell suspension into another sterile 50 ml centrifuge tube, and add another 10 ml of basal solution. 1640 ml of solution was homogenized in a homogenizer and repeated twice as above (during the resuspension process, only 5 ml should be aspirated the first time, because there are more cells and large tissue blocks in the homogenizer the first time, and the cells sink more slowly); centrifuge at 1000 r / min for 10 min, remove the supernatant, resuspend the cells and count them.

[0068] 2.5 Preparation of fed spleen cells

[0069] Take an unimmunized BALB / c mouse, bleed from the orbital cavity (collect serum, which is negative serum), and follow the same steps as above for preparing immune spleen cells.

[0070] 2.6 Cell Fusion

[0071] Prepare 1 to 2 × 10 7 One myeloma cell and 10 8 Mix 10 immune spleen cells (ratio 1:10 to 1:5) thoroughly, centrifuge at 1000 rpm for 10 min, and discard the supernatant. In a 37°C water bath, add 50% PEG4000 to induce cell fusion. Stir gently with a pipette tip while adding the PEG. After fusion, culture the cells in 96-well cell culture plates using HAT medium. Observe for contamination starting the day after fusion. Observe cell colonies starting on the third day. On the fourth day, discard 100 μL of medium and add 100 μL of HAT medium. Change the medium continuously over the next few days. When the fused cell colonies have grown to 1 / 3 of the culture wells and the medium turns slightly yellow, perform antibody detection.

[0072] 2.7 Indirect ELISA identification of PCV3 hybridoma cell lines

[0073] Dilute the full-length prokaryotic expression protein of PCV3 (previously constructed and preserved by our company) to 80 ng / ml with coating buffer, add 0.1 ml to each well, and coat overnight at 4°C. The next day, wash three times with PBST for 3 min each time. Block each well of the reaction plate with 0.2 ml of 5% BSA, incubate at 37°C for 1 h, and wash three times with PBST for 5 min each time. Add 0.1 ml of the test sample (hybridoma cell supernatant) to the above-coated reaction wells, incubate at 37°C for 1 h, and wash three times with PBST for 5 min each time. At the same time, prepare blank, negative (non-immunized mouse serum), and positive well controls (immunized mouse serum). Add 0.1 ml of freshly diluted HRP-labeled goat anti-mouse secondary antibody to the reaction wells, incubate at 37°C for 30-60 minutes, and wash three times with PBST for 3 min each time. Add 50 μl each of substrate A and substrate B to each well, react at 20-25°C for 10 minutes, and add 2M concentrated H2SO4 as the stop solution. Terminate the reaction with 50 μL, and measure the OD of each well using a microplate reader within 5 minutes. 630 nm value; add 0.05 ml of 2M sulfuric acid to each reaction well to stop the reaction; the results can be observed directly with the naked eye against a white background: the darker the color in the reaction well, the stronger the positive degree; the negative reaction is colorless or very light, judged by the intensity of the color. OD value can also be measured: on an ELISA reader, at 630 nm, after zeroing with the blank control well, measure the OD value of each well. If it is greater than 2.1 times the specified negative control OD value, it is considered positive.

[0074] 2.8 Subclonal screening of positive fusion cells (cloning of hybridoma cells (limiting dilution method))

[0075] Before cloning, prepare a mouse feeder cell layer and set it aside. After cloning is complete, spread the feeder cells into the wells of the cell culture plate. Gently blow the hybridoma cells to be cloned from the culture wells and count the number of viable cells using a hemocytometer. Dilute the cells with complete culture medium to 5, 10, and 50 cells / mL. Add the cell suspensions of the above three concentrations to the prepared feeder cells in a 96-well culture plate at 100 μL / well, so that each well contains 0.5, 1, and 5 cells, respectively. Add one drop of culture medium on day 4. Carefully observe and record the growth of cells in each well on days 5 and 6.

[0076] Detection of specific antibodies: On days 7-9 after cloning, when the cell clones have filled 1 / 3-1 / 2 of the field of view, detection can be performed. (If specific antibodies are detected in the cell growth wells, select wells with high antibody titers, showing single-clone growth and good morphology, and continue cloning or expanding the culture using the same method until the hybridoma cell line is very pure, then it can be expanded for further culture). Cells from positive wells can be transferred to 24-well culture plates. When the cells in the 24-well plates are growing well, ascites fluid can be collected by intraperitoneal inoculation of mice, and at least 4 vials of cells can be cryopreserved.

[0077] Cells from the identified positive wells were cloned using a limiting dilution method, with at least three cloning cycles to ensure the final monoclonal cell colonies were obtained. This process also served to screen for cells that would stably secrete antibodies at high expression levels and titers, while discarding cell colonies in poor condition. Ultimately, two cell lines were obtained, each secreting Capsule antibodies targeting different epitopes. 1-106 Cap 107-214 The monoclonal antibody hybridoma cells were named hybridoma cell lines 17-2 and 4-1.

[0078] 2.9 Identification of PCV3 hybridoma cell lines by indirect immunofluorescence assay

[0079] Suspended SF9 cells were then used at a concentration of 2 × 10⁻⁶. 5 ~4×10 5 Cells were seeded at a density of 100 μL / mL in 96-well cell culture plates and incubated statically at 27°C. After the cells grew into a monolayer, they were infected with baculovirus expressing the full-length PCV3 sequence (constructed and preserved by our company and published in patent CN110606873B). A control of uninfected normal cells was also included. After 72 hours of infection, when obvious cytopathic effects appeared, the cells were fixed with 80% acetone (pre-cooled to -20°C for 30 min) for 10 min, then washed three times with PBS for 5 min each time. The cells were then permeabilized with 0.2% Triton X-100 solution for 10 min and blocked with 5% BSA at room temperature for 1 h. The monoclonal antibody sample to be tested (hybridoma culture supernatant diluted 1:100 with ascites fluid) was added, along with positive (hyperimmunized mouse serum diluted 1:1000) and negative (unimmunized blank mouse serum diluted 1:1000) controls. The cells were incubated at 37°C for 30 min, washed three times with PBS, and Alexa Fluor was added. TM 488-labeled goat anti-mouse IgG fluorescent secondary antibody (1:500 dilution) was incubated at 37°C for 30 min, washed three times with PBS, and observed under a fluorescence microscope. If the results of the blank and known negative and positive control wells were valid, the fluorescence detection results of each well were photographed and recorded.

[0080] 2.10 Amplification and sequencing of the variable region sequences of heavy and light chains in hybridoma cell lines

[0081] Based on the sequence characteristics of murine monoclonal antibodies, primer sequences for the light chain variable region were designed:

[0082] LF: 5'-ATGGAGWCACAKWCTCAGGTCTTTRTA-3'

[0083] LR: 5'-CCGTTTCAGCTCCAGCTTGGTCCC-3'

[0084] Design primer sequences for the heavy chain variable region:

[0085] HF: 5'-ATGGRATGSAGCTGKGTMATSCTCTT-3'

[0086] HR: 5'-TGAGGAGACGGTGACTGAGGTCCC-3'

[0087] RNA was extracted from hybridoma cell lines 4-1 and 17-2. Using the extracted RNA as templates, the gene sequences of the light and heavy chain variable regions of monoclonal antibodies 4-1 and 17-2 were amplified using primers for the light and heavy chain variable regions, respectively. The PCR reaction program was: 98℃ for 3 minutes, 58℃ for 30 seconds, 72℃ for 30 seconds, for a total of 35 cycles, followed by 72℃ for 10 minutes. The corresponding amplification products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The Cap of monoclonal antibody was measured. 107-214 Cap 1-106 The gene sequences of the light chain variable region and the heavy chain variable region are shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0088] The prepared monoclonal antibodies were subtyped according to the instructions of the mouse antibody subtype identification kit. The 4-1 monoclonal antibody was classified as heavy chain IgG1 subtype with a Kappa light chain, and the 17-2 monoclonal antibody was also classified as heavy chain IgG1 subtype with a Kappa light chain. The kit used was the Pierce Rapid ELISA Mouse mAblsotyping Kit, purchased from Thermo Fisher Scientific.

[0089] 2.11 Western Blot Identification of Monoclonal Antibody Specificity and Cross-Reactivity Verification

[0090] The main process of Western blotting: Step 1: Capillary expression in prokaryotes 1-106 Cap 107-214 40 μL each of the protein and the prokaryotically expressed PCV2 protein (expressed and preserved by our company) were added to 10 μL of SDS-PAGE Loading Buffer, boiled in water for 10 min, and then subjected to SDS-PAGE electrophoresis. The protein was then transferred to a PVDF membrane via wet transfer, blocked with 5% skim milk for 2 h, and incubated with 1:1000 diluted monoclonal antibodies of strain 4-1 and strain 17-2 for 3 h. The membrane was washed three times with PBST for 10 min each time, and incubated with secondary antibody for 45 min. The membrane was then washed three times with PBST for 10 min each time, and developed using an ECL chemiluminescence analyzer. Results are as follows: Figure 8As shown, these two monoclonal antibodies recognize different epitopes of the PCV3 Cap protein, while monoclonal antibody 4-1 recognizes Cap. 107-214 17-2 monoclonal antibodies recognize Cap 1-106 The two monoclonal antibodies showed no cross-reactivity and neither recognized PCV2, indicating good specificity.

[0091] 2.12 Production and purification of monoclonal antibodies

[0092] After the hybridoma cells were established, they were cultured in a larger volume, and the supernatant was collected. The titer was determined by indirect ELISA.

[0093] Monoclonal antibody production by inducing ascites in mice: 8-10 week old mice were intraperitoneally injected with 0.5 ml of sterile liquid paraffin (or Freund's incomplete adjuvant) per mouse. 7-10 days later, 5 × 10⁶ hybridoma cells obtained in step 2.8 were intraperitoneally injected. 5 -1×10 6 Ascites fluid was collected from mice 7-10 days after birth, with repeat collection every 2-3 days. After removing red blood cells from the ascites fluid at 3000 rpm, the fluid was incubated overnight at 4°C, then centrifuged at 12000 rpm for 10 min to remove lipid precipitates. The supernatant was collected and stored at -80°C for later use, and cells were cryopreserved. Before loading the sample, the collected ascites fluid sample was centrifuged at 8000 rpm for 30 minutes, and the supernatant was filtered through a 0.45 μm filter membrane. Protein A affinity chromatography packing material (purchased from BorgLone (Shanghai) Biotechnology Co., Ltd.) was used. First, 5 column volumes were washed with filtered ultrapure water at a flow rate of 1.0 ml / min to remove ethanol from the packing material. Then, at least 5 column volumes were washed with equilibration buffer (0.01 M PBS, pH 7.4) at a flow rate of 1.0 ml / min. The processed sample was then added from the top of the chromatography column at a flow rate of 1.0 ml / min. Wash at least 5 column volumes with elution buffer (100 mM glycine hydrochloride, pH 2.7) at a flow rate of 1.0 mL / min. Wash at least 5 column volumes with elution buffer (20 mM glycine hydrochloride, pH 2.7) at a flow rate of 1.0 mL / min. Collect the elution buffer in 2 mL tubes, adding 100 μL of neutralization buffer (1 M Tris-HCl, pH 9.0) to each tube beforehand. Analyze the collected samples using SDS-PAGE, mixing the samples with the target bands together and determining their concentration. Finally, wash 2 column volumes with 100 mM glycine hydrochloride, followed by 5 column volumes with ultrapure water. Wash 5 column volumes with 20% ethanol and store at 2–8 °C.

[0094] 2.13 Monoclonal antibody titer determination

[0095] Cap, purified by prokaryotic expression in step 1, was used respectively. 1-106 Cap 107-214(The coating buffer was diluted to a final concentration of 80 ng / mL) as the coating antigen to coat ELISA plates for the determination of purified antibody titers. Add 100 μl of the coating antigen to each well of the ELISA plate and incubate at 2–8 °C for 16 hours. Discard the coating buffer, add 200 μl of 5% BSA blocking buffer to each well, incubate at 37 °C for 2 hours, and blot dry. Wash three times with PBST and blot dry. Serially dilute the purified monoclonal antibodies (3.2 mg / mL and 2.8 mg / mL) of strains 4-1 and 17-2 (1:100, 1:200, 1:400...1:102400) to each well of the ELISA plate. In the plate, positive and negative controls were set up simultaneously (positive control was 1:100 dilution of immunized mouse serum, negative control was SP2 / 0 cell culture supernatant). The plate was incubated at 37°C for 60 minutes, washed three times with PBST, and patted dry. Goat anti-mouse IgG-HRP (1:5000 dilution), 100 μl / well, was added, and incubated at 37°C for 30 minutes. The plate was washed three times with washing buffer and patted dry. 50 μl each of substrate A and substrate B were added to each well, and the reaction was carried out at 20–25°C for 10 minutes. The reaction was stopped by adding 50 μl of 2M concentrated H2SO4. The OD of each well was measured using a microplate reader within 5 minutes. 630 nm value.

[0096] The test results showed that when the purified antibody was diluted more than 10... 7 At that time, Cap 1-106 OD of monoclonal antibodies 630nm Negative controls with a value greater than 3-fold (Table 1); when the purified antibody is diluted more than 10... 6 At that time, Cap 107-214 OD of monoclonal antibodies 630nm The negative control had a value greater than 3 times (Table 2), therefore, Cap 1-106 Monoclonal antibody titer greater than 10 7 Cap 107-214 Monoclonal antibody titer greater than 10 6 Cap 1-106 Monoclonal antibodies have high titers, therefore they were chosen as enzyme-labeled capture antibodies. 107-214 Monoclonal antibodies are used as coating antibodies.

[0097] Table 1. Cap 1-106 Monoclonal antibody titer assay

[0098]

[0099] Table 2. Cap 107-214 Monoclonal antibody titer assay

[0100]

[0101] III. Establishment of a double-antibody sandwich method for detecting PCV3

[0102] 3.1 Modified sodium periodate method for labeling monoclonal antibodies

[0103] Dissolve 5 mg of HRP (horseradish peroxidase) in 0.5 ml of double-distilled water, add 0.5 ml of freshly prepared 60 mmol / L NaIO4 aqueous solution (10 ml double-distilled water + 128 mg NaIO4), mix well, and incubate at 4℃ for 60 min. Afterward, add 0.5 ml of 160 mmol / L ethylene glycol aqueous solution (10 ml H2O + 0.09 ml ethylene glycol) to terminate the oxidation reaction. Dialyze (or overnight) to 50 mmol / L pH 4.5 acetate buffer to remove aldehyde molecules. Add purified acetic acid containing 5 mg of anti-PCV3 Cap 1-106 Mix 1 ml of monoclonal antibody aqueous solution, place in a dialysis bag, and slowly dialyze in 50 mmol / L pH 9.5 carbonate buffer for 6 hours (or overnight) to allow binding. Add 0.2 ml of NaBH4 solution (5 mg / ml), mix well, and incubate at 4°C for 2 hours. Slowly add an equal volume of saturated ammonium sulfate solution to the above solution, mix well, centrifuge at 4°C for 30 minutes, discard the supernatant, dissolve the precipitate in a small amount of 20 mmol / L pH 7.4 PBS, place in a dialysis bag, and dialyze overnight at 4°C with the same solution to remove salt. The next day, centrifuge to remove insoluble matter to obtain the enzyme-antibody (HRP-anti-Cap). 1-106 Antibody conjugates were prepared by adding 20 mmol / L pH 7.4 PBS solution to a final volume of 5 ml; after the titer was determined to be satisfactory, an equal volume of high-quality glycerol was added, and the mixture was dispensed into vials and stored at low temperature.

[0104] 3.2 Establishment of the optimal working concentrations of coating and capture antibodies

[0105] Chessboard titration method for selecting working concentration of coating antigen: Purification of antibody (anti-PCV3 Cap) 107-214 Dilute the protein to concentrations of 10 μg / ml, 1 μg / ml, and 0.1 μg / ml with coating buffer, and coat each well on an ELISA plate overnight at 4°C. Coat three rows for each concentration. Wash three times with PBST for 5 min each time. Dilute strong positive reference serum, weak positive reference serum, and negative reference serum 1:100 with diluent. Add strong positive antigen solution to each well in one row, weak positive antigen solution to another row, and negative control solution to the third row. Incubate at 37°C for 1 h, and wash three times with PBST for 5 min each time. Add PCV3 Cap 1-106The enzyme-labeled antibody was diluted to three concentrations, for example, 1:5000, 1:10000, and 1:15000. Each concentration was added to one column of the antibody, and the mixture was incubated at 37°C for 1 hour. The cells were washed three times with PBST for 5 minutes each time. 50 μl each of substrate A and substrate B were added to each well, and the reaction was carried out at 20–25°C for 10 minutes. The reaction was stopped by adding 50 μl of 2M concentrated H₂SO₄. The OD of each well was measured using a microplate reader within 5 minutes. 630 nm value; the optimal conditions are set at an OD value of around 0.8 for strong positive antigens and an OD value of less than 0.1 for negative references. Based on this, the working concentrations of the coating antibody and enzyme-labeled antibody are selected. As can be seen from Appendix 3, the concentration of the coating antibody can be 1 μg / ml, and the dilution of the enzyme-labeled antibody can be 1:10000.

[0106] Table 3. Selection of Coating Concentration and Enzyme-Labeled Antibody Dilution in Double Antibody Sandwich Coating Method

[0107]

[0108] 3.3 Establishment of PCV3 double-antibody sandwich ELISA method

[0109] The optimal antibody concentration for coating was determined using the checkerboard titration method: 1 μg / mL. A 1:10000 dilution of the enzyme-labeled antibody was found to be the best dilution. Serial dilutions were performed on 500 ng / mL of the full-length prokaryotic expression protein of PCV3 (previously constructed and expressed by our company). The limit of detection for PCV3 protein was found to be 7.8125 ng / mL. The standard curve showed good linearity in the range of 7.8125 ng / mL to 500 ng / mL. (See attached diagram) Figure 9 The antigen content in PCV3 subunit vaccines can be quantified using a double-antibody sandwich method.

[0110] 3.4 Specificity test

[0111] The established double-antibody sandwich ELISA method was used to detect positive sera for porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine parvovirus (PPV), porcine epidemic diarrhea virus (PEDV), and transmissible gastroenteritis virus (TGEV), as well as PCV3 positive and negative sera. The results showed that the double-antibody sandwich ELISA method had high specificity and no cross-reactivity with other viruses (Table 4).

[0112] Table 4. Specificity detection results of PCV3 using the double-antibody sandwich method

[0113]

Claims

1. A mouse monoclonal antibody that specifically binds to the antigenic epitopes at positions 107-214 of the porcine circovirus type 3 (PCV3Cap) protein, characterized in that, The amino acid sequence of the light chain variable region of the monoclonal antibody Cap107-214 is shown in SEQ ID No. 7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID No.

8.

2. A mouse monoclonal antibody that specifically binds to the antigenic epitopes 1-106 of the porcine circovirus type 3 (PCV3Cap) protein, characterized in that... The amino acid sequence of the light chain variable region of the monoclonal antibody Cap1-106 is shown in SEQ ID No. 9, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID No.

10.

3. A PCV3 double-antibody sandwich ELISA detection kit, characterized in that, The kit comprises an enzyme-linked reaction plate coated with the monoclonal antibody Cap107-214 as the antigen of claim 1, a positive control serum, a negative control serum, and an enzyme-labeled secondary antibody, wherein the enzyme-labeled secondary antibody is horseradish peroxidase-labeled monoclonal antibody Cap1-106 of claim 2; the positive control serum is porcine serum collected after immunization with porcine circovirus type 3 inactivated virus; and the negative control serum is porcine serum without porcine circovirus type 3 specific antibodies. The working concentration of the monoclonal antibody against Cap107-214 in the enzyme-linked reaction plate was 1 μg / mL. The working dilution of the monoclonal antibody against Cap1-106 in the enzyme-labeled secondary antibody is 1:10000; The kit uses a sandwich system established by a pair of monoclonal antibodies targeting two completely non-overlapping independent epitopes of the PCV3Cap protein. The two monoclonal antibodies do not cross-react. The kit has a limit of detection of 7.8125 ng / mL for PC3Cap protein and a linear quantification range of 7.8125~500 ng / mL.

4. The use of the monoclonal antibody according to any one of claims 1 and 2 or the kit according to claim 3 in the detection of porcine circovirus type 3 antigen in in vitro samples for non-diagnostic purposes, wherein the use includes non-diagnostic porcine circovirus type 3 epitope identification studies, PCV3 molecular epidemiological analysis, and detection in in vitro tissues.

5. The use of the monoclonal antibody according to any one of claims 1 and 2 or the kit according to claim 3 in the quantitative detection of Cap antigen in PCV3 subunit vaccines for non-diagnostic purposes.

6. The use of the monoclonal antibody according to any one of claims 1 and 2 in the specific identification of PCV3 antigen in non-diagnostic compositions containing porcine circovirus type 3 antigen and other antigens, wherein... The other antigens are selected from one or more of the following: porcine circovirus type 2 antigen, classical swine fever virus antigen, porcine pseudorabies virus antigen, porcine reproductive and respiratory syndrome virus antigen, porcine parvovirus antigen, porcine epidemic diarrhea virus antigen, and porcine transmissible gastroenteritis virus antigen.

Images