Candida rugosa g5 and application thereof in degrading odor of kitchen waste

Abstract

The application discloses a Candida rugosa G5 and application thereof in degrading kitchen waste odor, and separates a high-efficiency deodorization Candida rugosa CCTCC NO:M20231018 from sludge in a garbage disposal station, wherein the Candida rugosa has strong environmental adaptability, simple nutrition requirement, can survive in kitchen waste and efficiently degrade hydrogen sulfide, ammonia and VOCs and other odors, reduces emission of foul gas and solves the pollution problem caused by kitchen waste, wherein the hydrogen sulfide removal rate can reach more than 90%, and the ammonia and VOCs removal rates are more than 70%. The strain has high deodorization efficiency, the biological deodorization bacterial agent prepared from the Candida rugosa has obvious degradation effect on the odor generated by the kitchen waste, and has good application potential.

Description

(I) Technical Field

[0001] This invention relates to a Candida foldii G5 strain and its application in degrading the odor of kitchen waste. (II) Background Technology

[0002] Odor pollution falls under the category of air pollution and is one of the world's seven major environmental hazards. It has become a hot topic of environmental pollution and an increasingly prominent social problem in public life. Food waste is a major component of urban residents' daily lives and a primary source of organic matter in urban solid waste. Its easy decomposition, high water content, and high organic matter content generate large amounts of strongly pungent odorous gases during collection, transportation, and disposal, directly or indirectly impacting the surrounding environment and human health.

[0003] Currently, there are three main methods for deodorization: physical methods, chemical methods, and biological methods. Physical and chemical methods are suitable for situations with high concentrations of odor pollutants and have advantages such as high odor treatment efficiency, short treatment residence time, and fast start-up; however, they also have disadvantages such as being prone to causing secondary pollution, high equipment costs, and high operational requirements.

[0004] Compared to physical and chemical methods, biological deodorization does not require the addition of chemicals and can be carried out at normal temperatures (10℃~40℃) and pressures. It is also more cost-effective and simpler to operate. Furthermore, microbial degradation typically involves oxidation reactions, with the final products of odor being carbon dioxide, water, sulfates, and nitrates, thus avoiding secondary pollution. The microbial deodorization methods used in landfills, waste compression stations, and waste compactors are similar to those used in livestock farms, primarily employing live bacteria sprays.

[0005] Patent document CN112159775A discloses the application of a bacterial strain in biological deodorization, specifically using a mixture of *Sphingomonas zeylans* cells and carriers such as diatomaceous earth, wheat straw, or corn cobs at a mass ratio of 1:0.8 to 1.2 for deodorizing kitchen waste.

[0006] Patent document CN114395495A discloses a compound microbial deodorizing agent, comprising *Pichia pastoris*, *Pichia pastoris ferment*, and *Bacillus buddingus*, wherein the addition ratio of *Pichia pastoris*, *Pichia pastoris ferment*, and *Bacillus buddingus* is 1:1:1, and the total effective bacterial content of *Pichia pastoris*, *Pichia pastoris ferment*, and *Bacillus buddingus* is ≥100 million CFU / g or ≥100 million CFU / ml. This invention provides a deodorizing microbial agent and related application processes and technologies applicable to the field of waste treatment. Repeated treatment of kitchen waste materials thoroughly mixes the bacterial strains with the waste materials, resulting in more thorough deodorization of the kitchen waste materials and significantly reducing the impact of odors from kitchen waste during transportation and transfer on pedestrians.

[0007] Therefore, in order to solve the pollution caused by the treatment of kitchen waste and reduce the emission of malodorous gases, developing more efficient deodorizing strains from the microbial-rich natural world is a technical problem that needs to be solved by those skilled in the art. (III) Summary of the Invention

[0008] The purpose of this invention is to provide a new strain of Candida fragrans G5 with highly efficient deodorization capabilities and its application in degrading the odor of kitchen waste, providing a new and highly efficient deodorizing strain for solving the pollution caused by kitchen waste and reducing the emission of malodorous gases.

[0009] The technical solution adopted in this invention is:

[0010] This invention provides a novel strain of Candida rugosa G5 with highly efficient deodorizing ability, which is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M20231018, deposit date: June 14, 2023, deposit address: Wuhan University, Wuhan, China, 430072, China.

[0011] The *Candida flavum* G5 strain obtained by this invention, which can be used for biological deodorization, was cultured on a modified Martin plate at 30°C for 2 days. The colonies were milky white, round, moist, easy to pick up, with a smooth surface, neat edges, and larger and thicker than bacterial colonies.

[0012] This invention also provides an application of the aforementioned Candida pleurisy G5 in degrading the odor of kitchen waste. The application involves mixing the biological deodorizing agent with the kitchen waste to be treated and placing it at a constant temperature of 30°C to achieve the purpose of degrading the odor of the kitchen waste. The biological deodorizing agent is a fermentation broth obtained by fermenting and culturing Candida pleurisy G5 or a bacterial suspension of wet cells in deionized water after centrifugation of the fermentation broth.

[0013] Furthermore, the odor from the food waste includes hydrogen sulfide, volatile organic compounds (VOCs), or ammonia.

[0014] Furthermore, the number of live bacteria in the biological deodorizing agent is greater than 1×10⁻⁶. 8 CFU / mL, preferably 5.0–7.0 × 10⁻⁶. 8 CFU / mL; the volumetric dosage of the biological deodorizing agent is 0.05-0.15 mL / g based on the weight of the kitchen waste to be treated, preferably 0.1 mL / g.

[0015] Furthermore, the food waste includes food waste from canteen waste dumping areas, waste transfer stations, etc.

[0016] Furthermore, the fermentation broth is prepared as follows: Candida fold G5 is inoculated into modified Martin liquid medium and cultured at 37°C and 150-200 rpm for 24-48 h to obtain the fermentation broth; the modified Martin liquid medium consists of 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, and 1 g / L KH2PO4, with tap water as the solvent and a pH of 7.0-7.5.

[0017] Furthermore, before fermentation, the *Candida flavum* G5 is first activated by slant culture and then seed culture is carried out. The seed culture is then inoculated into modified Martin liquid medium at a volume concentration of 1-3% (preferably 1%). The seed culture is prepared according to the following steps: *Candida flavum* G5 is inoculated into modified Martin solid medium and cultured at 37°C for 2 days. Single colonies are picked and inoculated into modified Martin liquid medium and cultured at 37°C and 200 rpm for 15-18 hours to obtain the seed culture. The modified Martin solid medium contains: 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, 1 g / L KH2PO4, and 15-20 g / L agar. The solvent is tap water, and the pH is 7.0-7.5.

[0018] The present invention also provides a biological deodorizing agent prepared from the aforementioned Candida folding G5, wherein the biological deodorizing agent is a fermentation broth obtained by fermentation culture of Candida folding G5 or a bacterial suspension of wet cells in deionized water after centrifugation of the fermentation broth.

[0019] Furthermore, the biological deodorizing agent is a kitchen waste odor remover, which is a kitchen waste odor remover, and the kitchen waste odor includes hydrogen sulfide, VOCs, or ammonia.

[0020] Furthermore, the food waste includes food waste from canteen waste dumping areas, waste transfer stations, etc.

[0021] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following: This invention isolates a highly efficient deodorizing Candida albicans strain CCTCC NO:M20231018 from sludge in waste treatment plants. This strain exhibits strong environmental adaptability and simple nutritional requirements, enabling it to survive in food waste and efficiently degrade odorous gases such as hydrogen sulfide, ammonia, and VOCs, reducing the emission of malodorous gases and solving the pollution problem caused by food waste. The removal rate of hydrogen sulfide can reach over 90%, and the removal rates of ammonia and VOCs are over 70%. This strain has high deodorization efficiency, and the biological deodorizing agent made from Candida albicans has a significant degradation effect on the odor generated by food waste, showing good application potential. (iv) Description of the attached drawings

[0022] Figure 1 The images show the morphology of the front (A) and back (B) of strain G5 colonies.

[0023] Figure 2 The images are SEM scans of strain G5. A shows the surface structure of the strain at 5000x magnification, and B shows the surface structure of the strain at 10000x magnification.

[0024] Figure 3 This is the phylogenetic tree of strain G5. (V) Detailed Implementation

[0025] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0026] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Martin's liquid medium: peptone 5 g / L, glucose 10 g / L, KH₂PO₄ 1 g / L, MgSO₄·7H₂O 0.5 g / L, solvent: tap water, pH 7.0–7.5. Before use, add 3 mL of 1% Bengal red aqueous solution per 1000 mL of Martin's liquid medium, and add 0.3 mL of 1% streptomycin solution per 100 mL of Martin's liquid medium. Bengal red and streptomycin are mainly inhibitors of bacteria and actinomycetes, but have no inhibitory effect on fungi.

[0028] Martin's Solid Medium: Peptone 5 g / L, Glucose 10 g / L, KH₂PO₄ 1 g / L, MgSO₄·7H₂O 0.5 g / L, Agar 15-20 g / L, solvent: tap water, pH 7.0-7.5. Before use, add 3 mL of 1% Bengal Red aqueous solution per 1000 mL of Martin's Solid Medium, and add 0.3 mL of 1% Streptomycin solution per 100 mL of Martin's Solid Medium.

[0029] Modified Martin's solid medium: 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, 1 g / L KH2PO4, 15-20 g / L agar, with tap water as the solvent, pH 7.0-7.5.

[0030] Modified Martin liquid medium: 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, 1 g / L KH2PO4, with tap water as the solvent, pH 7.0–7.5.

[0031] Example 1: Screening of strain G5

[0032] (1) Sampling and enrichment: Weigh 5g of sludge (wet weight) from a waste treatment plant in Wuhan and inoculate it into a 250mL Erlenmeyer flask containing 50mL Martin liquid medium (containing 300μg / mL Bengal red and 30μg / mL streptomycin) and incubate on a shaker at 37℃ and 200rpm for 24h.

[0033] (2) Dilution and coating: Take 1 mL of the acclimated bacterial culture from step (1) and perform serial dilution in 9 mL of physiological saline. Take 10 mL of each dilution and apply it to the plate. 3 -10 6 100 μL of the diluted solution was spread onto Martin's solid culture medium plates and incubated in a 37°C incubator for 2 days.

[0034] (3) Purification and preservation: Use an inoculation loop to pick single colonies with obvious morphological differences from those in step (2) and inoculate them onto modified Martin solid medium. Incubate at 37°C for 2 days. After single colonies have grown, inoculate them again onto modified Martin solid medium and incubate at 37°C for 2 days to purify and ensure that pure single colonies are obtained. Record them as strain G5. Pick single colonies G5 and inoculate them into test tubes of modified Martin liquid medium. Incubate at 37°C and 200 rpm for 15-18 hours. Then preserve them in glycerol at -80°C. 30% glycerol is mixed 1:1 and placed into sterile glycerol preservation tubes.

[0035] Example 2: Identification of strain G5

[0036] 1. Colony morphology observation:

[0037] Using an inoculation loop, pick up strain G5 preserved in Example 1, streak it onto a modified Martin solid medium plate, and incubate at 37°C for 2 days. The colony morphology is shown in [Figure 1]. Figure 1 The colonies are milky white, round, moist, easy to pick up, with a smooth surface and neat edges, and are larger and thicker than bacterial colonies.

[0038] 2. SEM (Scanning Electron Microscopy) observation:

[0039] Scanning electron micrograph of strain G5 is shown below. Figure 2 The cells are oval-shaped and reproduce by budding.

[0040] 3. Molecular identification

[0041] Single colonies of strain G5 were picked and boiled in 10 μL sterile ddH2O PCR tubes for 10 min as DNA templates. NL1 (5'-TGCGTTGATTACGTCCCTGC-3') and NL4 were used as templates.

[0042] (5'-GGTCCGTGTTTCAAGACGG-3') were used as the forward and reverse primers for PCR amplification.

[0043] The PCR amplification system was (20 μL): 0.5 μL each of primers NL1 and NL4, 1 μL of DNA template, 8 μL of ddH2O, and 10 μL of 2*Rapidtaq master mix.

[0044] PCR reaction conditions: pre-denaturation 98℃ for 5 min, denaturation 98℃ for 30 s, annealing 57℃ for 30 s, extension 72℃ for 30 s, 30 cycles, 72℃ for 10 min, and storage at 4℃.

[0045] The obtained sequence (nucleotide sequence as shown in SEQ ID NO.1) was searched using BLAST on the NCBI website. rDNA sequences with high similarity to this sequence were selected and automatically analyzed using MEGA7 software Align by ClusterW. A neighbor-to-neighbor phylogenetic tree (NJ phylogenetic tree) was generated with 1000 repetitions. Figure 3 The results showed that strain G5 had the closest homology (98.14%) to the partial sequence of the large subunit ribosomal RNA gene of KY107668.1 Diutina rugosaculture CBS:2016.

[0046] SEQ ID NO.1:

[0047] gtcgctacta ccgattgaat ggcttagtga ggcatcggga gtggccggcc cagagggcga60cctctcagct ggctgcaaac cttgtcaaac ttggtcattt agaggaagta aaagtcgtaa120caggtttcc gtaggtgaact ctcattagcaagg atcagccaagg acattgtgtc180agagcaataa catctaaaac cgatcatcaa ttaattatatt caaaactttc aacaacggat240ctctaggttc tcgcatcgat gagaacgca gcgaaatgcg atacgtagta cgaaacgctca300gtcgtcagctatttgaacgaatc tgaacgatc atc tggcattcca cacagcatgc360ctgtttgagc atattctc tctcgcaagg tgttgggcac cacgccggca ggcgtctgcc420agaaacgaaa tgtctaaaa cagttaagct tgttacagac tcttgatctt attccaatgaatgactcattactacccagg ggaggaaaag aaaccaaccg540ggattgcctc agtaacggcg agtgaagcgg caacagctca aatttgaag cccgcggcg600ttgtaatttg caggcggatg tttggggg gggggatgtct acgttccttg gaacaggacgaccgcc60 gcctctaacc gcgtaaaact ccgccgacga720gtcgagttgt ttgggaatgc agctccaagt gggtggtaaa ttccatctaa agctaatac780tggcgagaga ccgatagcga acagtacag tgatggaag atgaaaagca ct4agacagaagcagca ct4agacagaagcagca attgttgaaa gggaaggtatgcgattagc ggccagcagg900aggtgccttc tcgtgaaaag gccgtgcacc gtcttcggac accgtgcgcg aaaatgccaa960gggggcgcct gaggtctgcg aactcgaggt gcg 993

[0048] 4. Biolog microbial physiological and biochemical identification

[0049] The metabolic activity of strain G5 to 95 different carbon sources was investigated using the Biolog (GENⅢ) automated microbial identification system. Strain G5 was inoculated into modified Martin's medium in test tubes and cultured at 37°C for 2 days. After centrifugation, bacterial cells were collected and mixed with inoculum (FF-IF) using a sterile cotton swab to prepare a bacterial suspension. The suspension was adjusted to 75% T / FF using a turbidimeter. 100 μL of the bacterial suspension was added to each well of an 8-well Biolog FF microplate using an 8-well electric dispenser. The microplate was incubated at 37°C for 24 h, 48 h, 72 h, 96 h, 168 h, and 240 h before being read using a Biolog reader.

[0050] Metabolic fingerprint analysis using a Biolog reader revealed that strain G5 could utilize 27 carbon sources with relatively strong capabilities, but could not utilize or had weak utilization capabilities for the other 68 carbon sources. The Biolog system provided the identification results after 48 hours, as shown in Table 1.

[0051] Table 1. Utilization capacity of strain G5 of 95 carbon sources on Biolog FF plates

[0052]

[0053]

[0054]

[0055] Notes:+,positive;-,negative;B,borderline

[0056] Based on morphological identification, molecular biology, and Biolog microbial physiological and biochemical identification, strain G5 was preliminarily identified as *Diutina rugosa*, and named *Diutina rugosa* G5. This strain has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20231018 and deposit date of June 14, 2023.

[0057] Example 3: Preparation and application of biological deodorizing agents

[0058] Preparation of inoculum: The glycerol-preserved strain G5 was streaked onto modified Martin's solid medium (same as in Example 1) and cultured at 37°C for 2 days. A single colony was picked and inoculated into a test tube containing 5 mL of modified Martin's liquid medium, and cultured at 37°C and 200 rpm for 15-18 hours to obtain the seed culture. 1 mL of the seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of modified Martin's liquid medium and cultured at 37°C and 200 rpm for 24 hours to obtain the fermentation broth (Candida flavum colony count 5.0–7.0 × 10⁻⁶). 8 (CFU / mL) is a deodorizing agent.

[0059] Experimental setup: Take kitchen waste from the swill storage area of ​​the school cafeteria. The sample should be uniform. Remove bones manually, crush and divide into 500mL shake flasks, 50±2g per flask. Add 5mL of bacterial agent to each shake flask, seal, and place in a constant temperature room at 30℃ for static fermentation. Add an equal amount of purified water to the control group. Measure the gas after 16 hours.

[0060] Hydrogen sulfide and VOCs were measured using the Yiyuntian PTM-600 portable multi-gas analyzer.

[0061] Ammonia determination method: Refer to standard HJ533-2009 Determination of ammonia in ambient air and exhaust gas - Nessler's reagent spectrophotometric method.

[0062] Removal rate calculation: (Control gas volume - Experimental group gas volume) / Control gas volume × 100%

[0063] The test results are shown in Table 2. The test results show that the bacterial solution has an excellent degradation effect on hydrogen sulfide, and also has a certain degree of degradation effect on ammonia and volatile organic compounds.

[0064] Table 2. Degradation effect of strain G5 on hydrogen sulfide, etc.

[0065]

[0066] Three parallel experiments showed that 16 hours after inoculation with the biological deodorizing agent, the degradation rate of ammonia in kitchen waste was 79.08%, the degradation rate of hydrogen sulfide was 92.81%, and the degradation rate of volatile organic compounds was 86.05%. The experimental results show that the biological deodorizing agent made from Candida albicans G5 has a significant degradation effect on the odor generated by kitchen waste and has good application potential.

[0067] Example 4: Small-scale deodorization test using kitchen waste as substrate

[0068] Preparation of inoculum: The fermentation broth obtained in Example 3 was transferred at an inoculum concentration of 2% (v / v) to a 2000mL Erlenmeyer flask containing 1000mL of modified Martin liquid medium. The flask was incubated at 37°C and 200rpm for 48 hours to obtain the fermentation broth (Candida flavum colony count between 5.0 and 7.0 × 10⁻⁶). 8 (CFU / mL) is a deodorizing agent.

[0069] Experimental setup: Fresh kitchen waste was crushed using a blender and divided into 3L garbage bins, each containing 1kg (wet weight) of fresh kitchen waste. Each experiment was conducted in triplicate. The prepared microbial agent was then added at a dosage of 0.1mL / g, while the control group received an equal volume of purified water. The mixture was placed in a 30℃ constant-temperature laboratory, and the gas content changes were measured over two days.

[0070] Using the method in Example 3, the concentrations of hydrogen sulfide, volatile organic compounds, and ammonia were measured every 24 hours. The results are shown in Table 3.

[0071] The results showed that inoculation with Candida albicans G5 effectively reduced the production of odorous gases. On the second day, ammonia emissions were reduced by 73.98%, hydrogen sulfide by 91.40%, and volatile organic compounds by 81.58%.

[0072] Table 3. Degradation effect of strain G5 on hydrogen sulfide, etc.

[0073]

Claims

1. Candida rugosa ( Diutina rugosa G5, deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M20231018, deposit date: June 14, 2023, deposit address: Wuhan University, Wuhan, China, 430072, China.

2. The application of Candida pleurisyrifos G5 as described in claim 1 in the degradation of odor from kitchen waste, characterized in that, The odor from the kitchen waste is hydrogen sulfide, VOCs, or ammonia.

3. The application as described in claim 2, characterized in that, The application is as follows: the biological deodorizing agent is mixed with the kitchen waste to be treated and placed at a constant temperature of 30°C to achieve the purpose of degrading the odor of the kitchen waste; the biological deodorizing agent is the fermentation broth obtained by fermentation culture of Candida albicans G5 or the wet bacterial suspension of the fermentation broth after centrifugation in deionized water.

4. The application as described in claim 3, characterized in that, The biological deodorizing agent contains more than 1×10⁻⁶ live bacteria. 8 The volumetric dosage of the biological deodorizing agent is 0.05-0.15 mL / g, calculated based on the weight of the kitchen waste to be treated.

5. The application as described in claim 3, characterized in that, The fermentation broth was prepared as follows: Candida albicans G5 was inoculated into modified Martin liquid medium and cultured at 37°C and 150-200 rpm for 24-48 h to obtain the fermentation broth; the modified Martin liquid medium consisted of: 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, and 1 g / L KH2PO4, with tap water as the solvent and pH 7.0-7.

5.

6. The application as described in claim 5, characterized in that, Before fermentation, *Candida flavum* G5 is activated by slant culture and then seed culture is carried out. The seed culture is then inoculated into modified Martin liquid medium at a volume concentration of 1-3%. The seed culture is prepared as follows: *Candida flavum* G5 is inoculated into modified Martin solid medium and cultured at 37°C for 2 days. Single colonies are picked and inoculated into modified Martin liquid medium and cultured at 37°C and 200 rpm for 15-18 hours to obtain the seed culture. The modified Martin solid medium consists of: 5 g / L peptone, 2 g / L yeast extract, 20 g / L glucose, 0.5 g / L MgSO4, 1 g / L KH2PO4, and 15-20 g / L agar. The solvent is tap water, and the pH is 7.0-7.

5.

7. A biological deodorizing agent prepared from Candida albicans G5 as described in claim 1, characterized in that, The biological deodorizing agent is a fermentation broth obtained by fermenting Candida albicans G5, or a bacterial suspension of wet cells in deionized water after centrifugation of the fermentation broth.

8. The biological deodorizing agent as described in claim 7, characterized in that, The biological deodorizing agent is an odor remover for kitchen waste.

9. The biological deodorizing agent as described in claim 8, characterized in that, The food waste odor remover is a food waste odor remover, and the food waste odor is hydrogen sulfide, VOCs or ammonia.

Images