Genetically engineered bacteria for producing echinocandins and application thereof

Abstract

The application discloses a genetically engineered bacterium for producing echinocandins and application thereof. The genetically engineered bacterium comprises a gene combination, wherein the gene combination comprises a gene coding P450 monooxygenase CEP450-3 and a gene coding sulfonyl transferase CESUL from a filamentous fungus Coleophoma empetri. The application also discloses an echinocandin compound, wherein the echinocandin compound is modified with a sulfonyloxy group at a homotyrosine of a cyclic lipopeptide. The application further discloses a method for preparing the echinocandin compound by culturing the genetically engineered bacterium, and application of the gene combination, a recombinant expression vector and the genetically engineered bacterium in production of the echinocandin compound. The genetically engineered bacterium can produce new compounds PBS and EcBS with a sulfonyloxy group, and the water solubility and antibacterial activity of the new compounds are superior to those of original compounds PB0 and EcB without a sulfonyloxy group.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a genetically engineered bacterium for producing echinocandin drugs and its applications. The genetically engineered bacterium includes the gene combinations CEp450-3 and CEsul. This invention also relates to the production of novel echinocandin compounds PBS and EcBS with sulfonyloxy groups modified using the aforementioned genetically engineered bacterium. Background Technology

[0002] Micafungin is an echinocandin antibiotic, approved by the FDA in 2006, primarily used to treat deep fungal infections. Echinocandins also include caspofungin and anidulafungin; these drugs inhibit fungal cell wall synthesis through non-competitive inhibition of cell wall 1,3-β-glucan synthase activity, exhibiting good antifungal activity.

[0003] FR901379 is a key precursor for the synthesis of micafungin, produced by the filamentous fungus *Coleophoma empetri* F-11899, and its structural formula is as follows:

[0004] Its biosynthetic mechanism has not yet been reported.

[0005] Pneumocandin B0 (PB0) is a key precursor for the synthesis of caspofungin, produced by the filamentous fungus Glarea lozoyensis, and its structural formula is as follows:

[0006] Its biosynthetic pathway has been reported.

[0007] EcB (Echinocandin B) is a key precursor for the synthesis of anidoxuridine, produced by the filamentous fungus *Aspergillus pachycristatus* NRRL11440, and its structural formula is as follows:

[0008] Its biosynthetic pathway has also been reported.

[0009] However, both PB0 and EcB have poor water solubility, so it is necessary to improve their water solubility. Summary of the Invention

[0010] To address the problem of low water solubility of echinococcins in existing technologies, a genetically engineered bacterium for producing echinococcins and its application are provided.

[0011] The inventors speculate that the better water solubility of FR901379 compared to PB0 and EcB may be due to the sulfonyloxy group modification at the high tyrosine residues of the cyclic lipopeptide in its chemical structure. However, the gene responsible for this modification is unclear. Since PB0 and EcB lack this modification, it cannot be determined through gene alignment analysis. Therefore, this invention knocked out the gene responsible for FR901379 synthesis in the filamentous fungus *Coleophoma empetri* F-11899, and ultimately screened out genes related to the sulfonyloxy group modification of FR901379: CEp450-3 and CEp450-3. These genes were then heterologously expressed in the PB0-producing strain *Glarealozoyensis* and the EcB-producing strain *A. pachycristatus*, respectively. The resulting genetically modified strains produced a series of new echinocandins through fermentation, exhibiting superior antibacterial activity compared to the original unmodified compounds.

[0012] To solve the above-mentioned technical problems, one of the technical solutions provided by the present invention is: a gene combination, wherein the gene combination includes a gene encoding P450 monooxygenase CEP450-3 and a gene encoding sulfonyltransferase CESUL from the filamentous fungus Coleophoma empetri.

[0013] In some preferred embodiments of the present invention, the filamentous fungus *Coleophoma empetri* is *Coleophomaempetri* F-11899; and / or, the amino acid sequence of the CEP450-3 is as shown in SEQ ID NO:28; and / or, the amino acid sequence of the CESUL is as shown in SEQ ID NO:30.

[0014] In some preferred embodiments of the present invention, the nucleotide sequence encoding the CEP450-3 is shown in SEQ ID NO:29, and / or the nucleotide sequence encoding the CESUL is shown in SEQ ID NO:31.

[0015] To solve the above-mentioned technical problems, the second technical solution provided by the present invention is: a recombinant expression vector, wherein the recombinant expression vector comprises the gene combination as described in the first technical solution.

[0016] In some preferred embodiments of the present invention, the CEP450-3 and CESUL are on the same recombinant expression vector.

[0017] In some preferred embodiments of the present invention, the backbone plasmid of the recombinant expression vector is pAg1-H3.

[0018] To solve the above-mentioned technical problems, the third technical solution provided by the present invention is: a genetically engineered bacterium, wherein the genetically engineered bacterium includes the gene combination as described in the first technical solution, or the recombinant expression vector as described in the second technical solution.

[0019] In some preferred embodiments of the present invention, the genetically engineered bacteria are derived from echinococcal compounds.

[0020] In some preferred embodiments of the present invention, the echinococcal compound producing bacteria are Glarealozoyensis or Aspergillus pachycristatus.

[0021] To solve the above-mentioned technical problems, the fourth technical solution provided by the present invention is: an echinocandin compound, the structure of which is shown in Formula I:

[0022]

[0023] Where R1 is C 1-20 Alkyl or C 2-20 alkenyl;

[0024] R2 is H or C 1-6 alkyl;

[0025] R3 is C 1-6 Alkyl or Replacement C 1-6 alkyl;

[0026] X + It is a monovalent cation;

[0027] Carbon atoms marked with an asterisk (*) are either chiral or achiral. When they are chiral, they are in the R configuration and / or S configuration.

[0028] In one scheme, X in Equation I + for Na + K + or NH4 + For example, Na + .

[0029] In one scheme, in R1, the C 1-20 Alkyl group is C 10-20 Alkyl, for example

[0030] In one scheme, in R1, the C 2-20 The alkenyl group is C 10-20 alkenyl, for example

[0031] In one scheme, in R2, the C 1-6 The alkyl group is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, or tert-butyl; preferably methyl.

[0032] In one scheme, in R3, the C 1-6 Alkyl and Replacement C 1-6 C in alkyl 1-6 The alkyl group is independently methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or tert-butyl; preferably methyl.

[0033] In one embodiment, the echinococcal compound is:

[0034]

[0035] To solve the above-mentioned technical problems, the fifth technical solution provided by the present invention is: a method for preparing echinocandin compounds as described in the fourth technical solution, the method comprising culturing genetically engineered bacteria as described in the third technical solution in a fermentation medium to express and produce the echinocandin compounds.

[0036] In some specific embodiments of the present invention, the pH value of the fermentation medium is 6.0-7.0, and / or the fermentation medium contains 80-120 g / L mannitol, 4-6 g / L cottonseed meal, 8-12 g / L soybean meal, 3-5 g / L K2HPO4 and 0.8-1.2 g / L CaCO3; and / or the culture temperature is 23-27°C, and / or the culture rotation speed is 200-240 rpm, and / or the culture time is 8-12 days.

[0037] In some preferred embodiments of the present invention, the pH value of the fermentation medium is 6.5; the concentration of mannitol is 100 g / L, the concentration of cottonseed meal is 5 g / L, the concentration of soybean meal is 10 g / L, the concentration of K2HPO4 is 4 g / L, the concentration of CaCO3 is 1 g / L; the temperature is 25°C; the rotation speed is 220 rpm; and the time is 10 days.

[0038] To solve the above-mentioned technical problems, the sixth technical solution provided by the present invention is: the application of the gene combination as described in the first technical solution, or the recombinant expression vector as described in the second technical solution, or the genetically engineered bacteria as described in the third technical solution in the production of the echinococin-like compounds as described in the fourth technical solution.

[0039] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0040] The reagents and raw materials used in this invention are all commercially available.

[0041] The positive and progressive effects of this invention are as follows:

[0042] Knockout experiments identified a gene potentially associated with sulfonyloxy group modification during the synthesis of FR901379. This gene was then heterologously expressed in PB0 and EcB producing strains, yielding novel compounds PBS and EcBS with sulfonyloxy group modification. The water solubility and antibacterial activity of the new compounds PBS and EcBS were superior to those of the unmodified compounds PB0 and EcB. Attached Figure Description

[0043] Figure 1 HPLC chromatograms of fermentation products from control strain Ce-PC and knockout strain Ce (ΔCEp450-3).

[0044] Figure 2 HPLC chromatograms of fermentation products from control strain Ce-PC and knockout strain Ce(ΔCEsul).

[0045] Figure 3 HPLC chromatograms of PB0 and PBS fermentation.

[0046] Figure 4 The above are HPLC chromatograms of EcB and EcBS fermentation. Detailed Implementation

[0047] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0048] Construction of the knockout strain of this invention:

[0049] First, the plasmid pDHt / sk-PC containing the Cas9 gene was introduced into the starting strain *Coleophoma empetri* F-11899 via Agrobacterium-mediated transformation (AMT) to obtain the engineered strain Ce-PC. Based on the plasmid pAgG, an sgRNA expression cassette for gene knockout was constructed using molecular cloning methods. This cassette uses 5S rRNA as a promoter to guide the transcription of N20 and sgRNA. N20 is a 20bp target gene sequence for knocking out the target gene. The designed N20 sequences for different target genes are shown in Table 1 below.

[0050] Table 1

[0051] CEp450-3 1 AAGTTCTGCGCAAGACTAGA CEsul 2 tgcctaggactatgtcgaac e20_02930 3 TCCCAAGTCTCACAGAGCAA

[0052] The constructed knockout plasmid was introduced into the engineered strain Ce-PC, transformants were selected, and the transformants were verified and screened by PCR. The obtained knockout strain was fermented, the fermentation products were detected by HPLC, and the molecular weight of the products was analyzed by LC-MS.

[0053] Finally, all compounds in this patent were tested for antifungal activity.

[0054] The strains, plasmids, reagents, instruments, and HPLC detection methods used in this invention are as follows:

[0055] The strains *Aspergillus pachycristatus* NRRL11440 and *Glarea lozoyensis* ATCC20868 were purchased from the NRRL and ATCC Culture Collections, respectively. *Agrobacterium tumefaciens* LBA4404 competent cells used for AMT were purchased from Weidi Biotechnology Co., Ltd. The plasmid pAg1-H3 was obtained from the Institute of Microbiology, Chinese Academy of Sciences. pDHt / sk-PC was obtained from the Synthetic Biology Elements and Database Research Group, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0056] The DNA gel recovery and purification kit and plasmid extraction kit used in this invention were purchased from Shanghai Sangon Biotech. The reverse transcription kit, PCR enzyme and all restriction endonucleases were purchased from Takara Biotech. The homologous recombination kit (ClonExpress II One Step Cloning Kit) was purchased from Vazyme Biotech. Chromatographically pure acetonitrile was purchased from Amethyst Chemicals. Other conventional reagents were either domestically produced analytical grade or imported and repackaged.

[0057] The constant temperature fermentation shaker used in this invention was purchased from Shanghai Shiping Experimental Equipment Co., Ltd., and the 1200 high performance liquid chromatograph was purchased from Agilent Technologies.

[0058] The culture medium used in this invention

[0059] 1. Liquid LB medium (1L)

[0060] 10g peptone, 5g yeast extract, 10g NaCl, 1L distilled water; sterilize at 121℃ for 20 minutes.

[0061] 2. Solid LB medium (1L)

[0062] 10g peptone, 5g yeast extract, 10g NaCl, 20g agar powder; sterilize at 121℃ for 20 minutes.

[0063] 3. PPY medium (1L): 20g of peptone, 20g of yeast extract, and 20g of potato broth medium.

[0064] 4. Induction liquid culture medium (IM): 0.8 mL K buffer, 20 mL MN buffer, 1 mL 1% CaCl2·2H2O, 10 mL 0.01% FeSO4·7H2O, 5 mL trace elements, 2.5 mL 20% ammonium nitrate, 10 mL 50% glycerol, 40 mL 1M MES, 10 mL 20% glucose, plus 905.7 mL sterile water.

[0065] The solutions used in the culture medium:

[0066] 1% CaCl2·2H2O: Weigh 1g of CaCl2·2H2O, add water to make up to 100mL, and sterilize before use.

[0067] 0.01% FeSO4·7H2O: Weigh 0.01g FeSO4·7H2O, add water to make up to 100mL, and filter to sterilize before use.

[0068] 20% glucose: Weigh 20g of glucose, add water to make up to 100mL, and sterilize before use.

[0069] 50% Glycerin: Measure 50 mL of glycerin and mix it with 50 mL of water. Sterilize before use.

[0070] 20% Ammonium Nitrate: Weigh 20g of ammonium nitrate, add water to make up to 100mL, and sterilize before use.

[0071] K buffer: Add 1.25M K2HPO4·3H2O to 1.25M K2HPO4 until the pH is 4.8. Sterilize before use.

[0072] MN buffer: Weigh 3g MgSO4·7H2O and 1.5g NaCl, add water to make up to 100mL, and sterilize before use.

[0073] Trace elements: Weigh 10mg ZnSO4·7H2O, 10mg CuSO4·5H2O, 10mg H3BO3, 10mg MnSO4·H2O, and 10mg NaMoO4·2H2O, add water to a final volume of 100mL, and sterilize before use.

[0074] 1M MES: Weigh 10.66g of MES, dissolve it in water, adjust the pH to 5.3, and bring the volume to 50mL. Store in a -20℃ refrigerator and filter to sterilize before use.

[0075] 0.2M AS: Weigh 785mg of AS, dissolve it in DMSO, bring the volume to 20mL, store it in a refrigerator at 20℃ protected from light, and filter it for sterilization before use.

[0076] 5. Induction solid culture medium: Add 0.8 mL K buffer, 20 mL MN buffer, 1 mL 1% CaCl2·2H2O, 10 mL 0.01% FeSO4·7H2O, 5 mL trace elements, 2.5 mL 20% ammonium nitrate, 10 mL 50% glycerol, 40 mL 1M MES, and 10 mL 20% glucose to sterile water containing 2% agar powder.

[0077] 6. Seed culture medium formula (1L):

[0078] 20g glucose, 10g soybean meal powder, 2g KH2PO4, pH 6.5; sterilize at 121℃ for 20 minutes.

[0079] 7. Fermentation medium formula (1L):

[0080] Mannitol 100g, cottonseed meal powder 5g, soybean meal powder 10g, K2HPO4 4g, CaCO3 1g, pH value 6.5; sterilize at 121℃ for 20 minutes.

[0081] The HPLC detection method in this invention is as follows:

[0082] HPLC liquid chromatography detection method:

[0083] Mobile phase: 50% acetonitrile and 50% water (containing 0.5% NaH2PO4);

[0084] Column: C18 4.6×250nm;

[0085] Flow rate: 1 mL / min;

[0086] Detection wavelength: 210nm;

[0087] Column temperature: 30℃;

[0088] Injection volume: 20 μL.

[0089] The base sequences of the primers used in this invention are shown in Table 2 below, where -F represents the upstream primer and -R represents the downstream primer.

[0090] Table 2

[0091]

[0092] Example 1: Gene knockout of CEp450-3 and product analysis

[0093] The amino acid sequence of the gene CEP450-3 knocked out in this embodiment is shown in SEQ ID NO:28, and its nucleotide sequence is shown in SEQ ID NO:29.

[0094] 1. Plasmid construction:

[0095] (1) Construction of pAgG and pAgG-sgRNA-CEp450-3

[0096] Using pAg1-H3 as a template, PCR was performed with primers Ptrpc-F / R (the base sequences of the primers used in this example are shown in Table 2) to obtain the trpC promoter fragment (fragment 1). Using plasmid pEGFP-N2 as a template, PCR was performed with primers NeoR-F / R to obtain the G418 resistance gene Neo fragment (fragment 2). Using pAg1-H3 as a template, PCR was performed with primers Ttrpc-F / R to obtain the trpC terminator fragment (fragment 3). Using PCR fragments 1, 2, and 3 as templates, overlap PCR was performed with primers Ptrpc-F and Ttrpc-R to obtain the G418 resistance gene expression cassette. This expression cassette was ligated into the HindIII / SpeI linearized pAg1-H3 vector to obtain the plasmid pAg1-HG. pAg1-HG was self-ligated after single digestion with EcoRI to obtain pAgG.

[0097] Using the *Coleophoma empetri* F-11899 genome as a template and 5S-F / R primers, a 5S rRNA fragment was obtained by PCR. Using N20-CEp450-3-F and sgRNA-R primers, an sgRNA fragment specifically recognizing *CEp450-3* was obtained by PCR. Using the 5S rRNA and sgRNA fragments as templates, overlap PCR was performed using 5S-F and sgRNA-R primers to obtain an sgRNA expression cassette. This expression cassette was ligated into a BglII / EcoRI-digested pAgG linear vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit) to obtain the knockout plasmid pAgG-sgRNA-CEp450-3.

[0098] 2. Construction of knockout strains

[0099] Using AMT, the plasmid pAgG-sgRNA-CEp450-3 was introduced into the Ce-PC strain, and the engineered strain Ce(ΔCEp450-3) was obtained by screening.

[0100] 3. Fermentation of engineered strain Ce (ΔCEp450-3)

[0101] To detect the fermentation products of engineered strain Ce (ΔCEp450-3), it was inoculated into 20 mL of seed culture medium and cultured at 25 °C and 220 rpm for 4 days. Then, it was inoculated into 30 mL of fermentation culture medium at a 10% inoculation rate and cultured at 25 °C and 220 rpm for 10 days.

[0102] 4. HPLC detection

[0103] Detection of fermentation products using reverse HPLC (Agilent): Take 2 mL of fermentation broth, add 8 mL of acetone, mix thoroughly, sonicate for 30 min, filter, and then analyze the filtrate. The results are as follows: Figure 1 As shown.

[0104] The results showed that the molecular weight of compound 6, a fermentation product of the engineered strain Ce (ΔCEp450-3), was 1126. The structure of compound 6 was analyzed as follows:

[0105]

[0106] It is speculated that the enzyme encoded by this gene is involved in the synthesis of FR901379 sulfonyloxy group.

[0107] 5. Antifungal activity: The results of the antibacterial activity of compound 6 are shown in Table 3. The results show that compound 6 has antifungal activity.

[0108] Example 2: Gene knockout of CEsul and product analysis

[0109] The amino acid sequence of the CEsul gene knocked out in this embodiment is shown in SEQ ID NO:30, and its nucleotide sequence is shown in SEQ ID NO:31.

[0110] 1. Plasmid construction:

[0111] (1) Construction of pAgG-sgRNA-CEsul

[0112] Using the *Coleophoma empetri* F-11899 genome as a template and 5S-F / R primers, a 5S rRNA fragment was obtained by PCR. Using N20-CEsul-F and sgRNA-R primers, an sgRNA fragment specifically recognizing *CEsul* was obtained by PCR. Using the 5S rRNA and sgRNA fragments as templates, overlap PCR was performed using 5S-F and sgRNA-R primers to obtain an sgRNA expression cassette. This expression cassette was ligated into a BglII / EcoRI-digested pAgG linear vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit) to obtain the knockout plasmid pAgG-sgRNA-CEsul.

[0113] 2. Construction of knockout strains

[0114] Using AMT, the plasmid pAgG-sgRNA-CEsul was introduced into the Ce-PC strain, and the engineered strain Ce(ΔCEsul) was obtained by screening.

[0115] 3. Fermentation of engineered strain Ce(ΔCEsul)

[0116] To detect the fermentation products of the engineered strain Ce(ΔCEsul), it was inoculated into 20 mL of seed culture medium and cultured at 25 °C and 220 rpm for 2 days. Then, it was inoculated into 30 mL of fermentation culture medium at a 10% inoculation rate and cultured at 25 °C and 220 rpm for 10 days.

[0117] 4. HPLC detection

[0118] Detection of fermentation products using reverse HPLC (Agilent): Take 2 mL of fermentation broth, add 8 mL of acetone and mix thoroughly, sonicate for 30 min, filter and obtain the filtrate for detection.

[0119] The results showed that the fermentation product of the engineered strain Ce(ΔCEsul) did not produce FR901379, suggesting that the enzyme encoded by this gene is a sulfonyltransferase involved in the synthesis of FR901379 sulfonyloxy group. Figure 2 As shown.

[0120] Comparative Example 1: Knockout of sulfonylurea transferase gene e20_02930 and product analysis

[0121] The amino acid sequence of the gene e20_02930 that was knocked out in this embodiment is shown in SEQ ID NO:32, and its nucleotide sequence is shown in SEQ ID NO:33.

[0122] 1. Plasmid construction:

[0123] (1) Construction of pAgG-sgRNA-02930

[0124] Using the *Coleophoma empetri* F-11899 genome as a template and 5S-F / R primers, a 5S rRNA fragment was obtained by PCR. Using N20-02930-F and sgRNA-R primers, an sgRNA fragment specifically recognizing e20_02930 was obtained by PCR. Using the 5S rRNA and sgRNA fragments as templates, overlap PCR was performed using 5S-F and sgRNA-R primers to obtain an sgRNA expression cassette. This expression cassette was ligated into the BglII / EcoRI-digested pAgG linear vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit) to obtain the knockout plasmid pAgG-sgRNA-02930.

[0125] 2. Construction of knockout strains

[0126] Using AMT, plasmid pAgG-sgRNA-02930 was introduced into Ce-PC strain, and engineered strain Ce(Δ02930) was obtained by screening.

[0127] 3. Fermentation of engineered strain Ce(Δ02930)

[0128] To detect the fermentation products of engineered strain Ce(Δ02930), it was inoculated into 20 mL of seed culture medium and cultured at 25 °C and 220 rpm for 4 days. Then, it was inoculated into 30 mL of fermentation culture medium at a 10% inoculation rate and cultured at 25 °C and 220 rpm for 10 days.

[0129] 4. HPLC detection

[0130] Detection of fermentation products using reverse HPLC (Agilent): Take 2 mL of fermentation broth, add 8 mL of acetone and mix thoroughly, sonicate for 30 min, filter and obtain the filtrate for detection.

[0131] The results showed that the fermentation products of the engineered strain Ce(Δ02930) were no different from those of the originating strain, and FR901379 was still produced. It is speculated that the sulfonyltransferase encoded by this gene did not participate in the synthesis of sulfonyloxy groups in FR901379.

[0132] Example 3: Heterologous expression and application of CEP450-3 and CESUL in PBO-producing strain Glarea lozoyensis

[0133] 1. Construction of expression plasmids:

[0134] Using the *G. lozoyensis* genome as a template, PCR was performed using primers Pgpd-F / R and Tgpd-F / R to obtain the glgpd promoter and terminator fragments. Using *C. empetri* cDNA as a template, PCR was performed using CEP450-3-F / R to obtain the CEP450-3 fragment. Using the three obtained fragments as templates, overlap PCR was performed using primers Pgpd-F and Tgpd-R to obtain Pglgpd-CEP450-3-Tglgpd. This fragment was ligated into the PvuII / EcoRI linearized pAg1-H3 vector using a homologous recombination kit to obtain pAg1-H3-Pglgpd-CEp450-3.

[0135] Using the *Coleophoma empetri* genome as a template, PCR was performed using primers Pcegpd-F / R and Tcegpd-F / R to obtain the cegpd promoter and terminator fragments. Using *C. empetri* cDNA as a template, PCR was performed using CESUL-F / R to obtain the CESUL fragment. Using the two obtained fragments as templates, overlap PCR was performed using primers Pcegpd-F and Tcegpd-R to obtain Pcegpd-CESUL-Tcegpd. This fragment was then ligated into the SalI / SpeI linearized pAg1-H3 vector using a homologous recombination kit to obtain pAg1-H3-Pcegpd-CESUL.

[0136] The constructed pAg1-H3-Pcegpd-CESUL was double-digested with SalI / SpeI, and the 3438 bp fragment was recovered. The constructed pAg1-H3-Pglgpd-CEp450-3 was double-digested with SalI / SpeI, and the 10459 bp fragment was recovered. The two recovered fragments were ligated using T4 ligase to obtain pAg1-H3-CEP450-3+CESUL.

[0137] 2. Construction of engineered strains

[0138] Three plasmids, pAg1-H3-Pcegpd-CESUL, pAg1-H3-Pglgpd-CEp450-3, and pAg1-H3-CEP450-3+CESUL, were introduced into the G. lozoyensis strain using AMT to obtain engineered strains Gl-CEP450-3, Gl-CESUL, and Gl-CEP450-3+CESUL.

[0139] 3. Analysis of products from engineered strains:

[0140] The strain was inoculated into 20 mL of seed culture medium and cultured at 25°C and 220 rpm for 4 days. Then, it was inoculated into 30 mL of fermentation culture medium at a 10% inoculation rate and cultured at 25°C and 220 rpm for 10 days. 2 mL of the fermentation broth was taken, mixed thoroughly with 8 mL of anhydrous ethanol, and sonicated for 30 min. The filtrate was then filtered and analyzed.

[0141] A new compound, PBS, was detected in strain Gi-CEP450-3+CESUL. Its fermentation yield is shown in Table 4, and its structure is as follows:

[0142]

[0143] HPLC chromatograms of PB0 and PBS produced by fermentation of the original strain G. lozoyensis and the engineered strain Gl-CEP450-3+CESUL are shown below. Figure 3 As shown.

[0144] 4. Antifungal activity:

[0145] The antibacterial activity results of caspofungin, PB0 and the new compound PBS are shown in Table 3. As can be seen from Table 3, the antibacterial activity of PBS is better than that of PB0.

[0146] 5. Solubility: The solubility of PB0 and the new compound PBS is shown in Table 4. As can be seen from Table 4, the solubility of PBS is better than that of PB0.

[0147] Example 4. Heterologous expression and application of CEP450-3 and CESUL in EcB-producing strain A. pachycristatus NRRL11440

[0148] 1. Construction of engineered strains

[0149] Three plasmids, pAg1-H3-Pcegpd-CESUL, pAg1-H3-Pglgpd-CEp450-3, and pAg1-H3-CEP450-3+CESUL, were introduced into A. pachycristatus strain using AMT to obtain engineered strains Ap-CEP450-3, Ap-CESUL, and Ap-CEP450-3+CESUL.

[0150] 3. Analysis of products from engineered strains:

[0151] The strain was inoculated into 20 mL of seed culture medium and cultured at 25°C and 220 rpm for 2 days. Then, it was inoculated into 30 mL of fermentation culture medium at a 10% inoculation rate and cultured at 25°C and 220 rpm for 10 days. 2 mL of the fermentation broth was taken, mixed thoroughly with 6 mL of acetone, and sonicated for 30 min. The filtrate was then filtered and analyzed.

[0152] A new compound, EcBS, was detected in strain Ap-CEP450-3+CESUL. Its fermentation yield is shown in Table 4, and its structure is as follows:

[0153]

[0154] HPLC chromatograms of EcB and EcBS produced by fermentation of the original strain A. pachycristatus and the engineered strain Ap-CEP450-3+CESUL are shown below. Figure 4 As shown.

[0155] 4. Antifungal activity:

[0156] The antibacterial activity results of anidoxane, EcB and the new compound EcBS are shown in Table 3. As can be seen from Table 3, the antibacterial activity of EcBS is better than that of EcB.

[0157] 5. Solubility: The solubility of EcB and the new compound EcBS is shown in Table 4. As can be seen from Table 4, EcBS has better solubility than EcB.

[0158] Table 3 Results of antibacterial activity detection

[0159]

[0160] Table 4. Fermentation yield and solubility of compounds

[0161] EcB 1g / L 0.5g / L EcBS 0.6g / L 10g / L <![CDATA[PB0]]> 2g / L 1g / L PBS 1.8g / L 20g / L SEQUENCE LISTING <110> Shanghai Pharmaceutical Industry Research Institute Co., Ltd. China National Pharmaceutical Industry Research Institute Co., Ltd. <120> A genetically engineered bacterium for producing echinocandins and its applications <130> P22010843C <160> 33 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CEp450-3 N20 <400> 1 aagttctgcg caagactaga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CEsul N20 <400> 2 tgcctaggac tatgtcgaac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> e20_02930 N20 <400> 3 tcccaagtct cacagagcaa 20 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Ptrpc-F <400> 4 acccaagctt gggaatcgat gatcaggcct cgac 34 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Ptrpc-R <400> 5 aatccatctt gttcaatcat ttggatgctt gggtagaata 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NeoR-F <400> 6 tattctaccc aagcatccaa atgattgaac aagatggatt <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NeoR-R <400> 7 gatcccggtc ggcatctact tcagaagac tcgtcaaga <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Ttrpc-F <400> 8 ttcttgacga gttcttctga buygcc gaccgggatc <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Ttrpc-R <400> 9 ctggactagt ccttcgtccg gcgtagagga tcct 34 <210> 10 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> sgRNA-R <400> 10 gactagtcgg gggatcctct agatcttctg caggtcgact ctagag <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5S-F <400> 11 gttgtaaaac gacggccagt gaaacgttgg acgcgccgct 40 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5S-R <400> 12 ggtgtttcgt cctttcatac aaca 24 <210> 13 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Pgpd-F <400> 13 gttgtaaaac gacggccagt actatctcct cgagtgtcac ttcgcgtctt tgtc 54 <210> 14 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Pgpd-R <400> 14 gcagcacatc cccctttcgc caggtatccc gggagcgctg tgagtcgatg gcgaaatc 58 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Tgpd-F <400> 15 gaatacttgt ggaagcataa ggtcttcacc actcatttct ca 42 <210> 16 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Tgpd-R <400> 16 cccctttcgc caggtatccc gggagcgctg tgagtcgatg gcgaaatcg 49 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CEP450-3-F <400> 17 aatcttcacc agaaaacaat atgataaatc ttgcaagtcc 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CEP450-3-R <400> 18 gaaatgagtg gtgaagacct tatgcttcca caagtattct 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> N20-CESUL-N20-F <400> 19 tctcgcgaga ggagatatcg gttttagagc tagaaatagc 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> N20-CEP450-3-N20-F <400> 20 aagttctgcg caagactaga gttttagagc tagaaatagc 40 <210> 21 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> N20-02930-F <400> 21 tatgaaagga cgaaacacct cccaagtctc acagagcaag ttttagagct agaaatagc 59 <210> 22 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> CESUL-F <400> 22 tactaacaag caatcagaat catggcttta gaccgccaga atgcgaa 47 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CESUL-R <400> 23 tcggtaagga agagaagacc ctacttccta gctagccaaa 40 <210> 24 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Pcegpd-F <400> 24 ggagaattaa gggagtcacg aagcttgtcg acgcacttgt ggtatgaata ga 52 <210> 25 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Pcegpd-R <400> 25 actaacaagc aatcagaatc atggctttag accgccagaa tgcgaa 46 <210> 26 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Tcegpd-F <400> 26 gtttagaggt aatccttctt actagtaagg gggggtttat gttggt 46 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Tcegpd-R <400> 27 tttggctagc taggaagtag ggtcttctct tccttaccga 40 <210> 28 <211> 500 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CEP450-3 <400> 28 Met Ile Asn Leu Ala Ser Pro Leu Phe Ala Thr Thr Ala Val Leu Val 1 5 10 15 Trp Leu Ser Ser Leu Ile Ile Tyr Arg Leu Tyr Leu Ser Pro Leu Ser 20 25 30 Arg Phe Pro Gly Pro Lys Leu Ala Ala Leu Thr Gly Trp Tyr Glu Thr 35 40 45 Tyr Phe Asp Leu Phe Lys Arg Gly Arg Tyr Trp Ile Glu Ile Glu Arg 50 55 60 Met His Glu Val Tyr Gly Pro Ile Ile Arg Ile Asn Pro Asn Glu Leu 65 70 75 80 His Val Asn Asp Pro Glu Trp Asn Glu Pro Tyr Lys Ile Ser Gly Arg 85 90 95 Val Asp Lys Tyr Asp Trp Tyr Tyr Thr Phe Val Gly Ser Ser Gly Ser 100 105 110 Ser Ser Ala Phe Gly Thr Ile Asp His Asp Val His Arg Gly Arg Arg 115 120 125 Lys Ala Gln Gln Gly Tyr Phe Thr Thr Asp Ala Ile Thr Arg Phe Glu 130 135 140 Pro His Leu Glu Thr Leu Thr Ala Lys Phe Cys Ala Arg Leu Asp Gly 145 150 155 160 Phe Lys Gly Thr Gly Lys His Val Asn Leu Ser Asp Ala Phe Arg Ser 165 170 175 Ile Ala Val Asp Val Ala Ala Met Phe Thr Leu Asn Gln Ser Tyr Gly 180 185 190 Phe Ile Asp Asp Pro Asp Phe Lys Ala Glu Val His Gln Gly Ile Arg 195 200 205 Ala Phe Pro Asp Ile Gly Val Leu Asn Arg His Phe Thr Gly Leu Phe 210 215 220 Val Val Leu Glu Ser Ile His Arg Trp Val Leu Ser Val Ile Asn Pro 225 230 235 240 Ser Glu Glu Asp Asn Gly Leu Leu Thr Ser Arg Ile Asn Leu His Cys 245 250 255 Lys Ala Ile Ile Ala Asp Tyr Ala Ser Lys Lys Gly Asp Val Lys Pro 260 265 270 Asn Ile Ile His Arg Met Leu Asp Ala Pro Glu Leu Ser Met Lys Asp 275 280 285 Lys Thr Ala Trp Arg Leu Gln Leu Glu Ala Arg Thr Leu Ile Gly Ala 290 295 300 Gly Thr Glu Thr Thr Gly His Thr Leu Ala Val Ile Ala Phe His Leu 305 310 315 320 Leu Ala Asn Pro Glu Lys Ala Lys Arg Leu Lys Glu Glu Ile Leu Ala 325 330 335 Thr Lys Glu Gly Arg Glu Lys Pro Leu Thr Tyr Gln Glu Leu Gln Met 340 345 350 Leu Pro Tyr Leu Ser Ser Val Val Leu Glu Gly His Arg Ile Ser Ser 355 360 365 Val Val Ser Gly Arg Leu Pro Arg Val Asn Thr Lys Glu Pro Leu Arg 370 375 380 Tyr Gly Asp Tyr Ser Ile Pro Ile Gly Thr Pro Val Ser Thr Thr Gln 385 390 395 400 Arg Leu Thr His Tyr Asn Ala Thr Ile Phe Pro Ser Pro Asn Thr Phe 405 410 415 Leu Pro Glu Arg Trp Leu Gln Pro Ser Glu Arg Lys Arg Leu Glu Lys 420 425 430 Tyr Ile Gln Pro Phe Gly Arg Gly Ser Arg Ser Cys Ile Gly Met His 435 440 445 Leu Ala Asn Ala Glu Ile Tyr Lys Thr Leu Ala Glu Met Phe Ala Arg 450 455 460 Phe Asp Met Lys Leu Tyr Asp Thr Glu Phe Glu Asp Ile Met Gln Val 465,470,475,480 His Asp Phe Phe Thr Ser Phe Pro Ser Ser Glu Arg Gly Leu Arg Ile 485 490 495 Leu Val Glu Ala 500 <210> 29 <211> 1802 <212> DNA <213> Artificial Sequence <220> <223> CEp450-3DNA Synthesis <400> 29 atgataaatc ttgcaagtcc cctcttcgca acaacagcag ttctagtctg gctcagcagt 60 ctcataatct atcgcctata tctcttcca ctatctcgat ttcccggccc aaactcgct 120 gctctaacag gatggtacga gacatacttc gacctcttta aacggggtcg ctactggatc 180 gagattgaac gcatgcacga agtctatggt aagttttgtat tttcttcaat aaaaagcgga 240 tatattttga caccagccag gccctatcat ccgcatcaat cccaatgagc tacatgttaa 300 tgacccagaa tggaatgagc cctacaagat cagcggccgc gttgacaagt atgactggta 360 ctacaccttt gttggtagtt ccggatcctc atctgcattc ggaaccatag accacgacgt 420 tcatcgtggc cgccggaaag ctcaacaggg ctatttcacc accgacgcca tcacgcgctt 480 tgaaccacat ttagaaaccc tgacagcaaa gttctgcgca agactagacg gcttcaaggg 540 gacgggaaag catgttaatc tctccgatgc gttccgatca atcgcggtgg atgtggccgc 600 gatgtttaca ttgaatcaat cgtatggttt catcgatgac ccggatttca aggccgaggt 660 ccatcaaggg atccgggcat ttccggatat tggagtgctg aatcgccatt ttacgggttt 720 gttcgtggtt ttggagtcaa tccatagatg ggtgttgagt gttatcaacc cgtcagaaga 780 agataatggg ttactcacaa gtgtacgtat ctttccacta atactgcttt ccccgagatc 840 ctaatgcgtg atagagaata aacctgcatt gtaaagctat tattgccgac tacgccagta 900 agaaaggcga cgtcaagccc aatatcattc acagaatgct agacgcacca gaactatcga 960 tgaaagataa gacagcgtgg cgccttcaat tggaggcgcg cacccttata ggagctggaa 1020 ctgaaacgac aggacacaca ttagccgtca tagcattcca tctgctagca aatccggaga 1080 aggcaaagag gttgaaggag gagatcttag ctacgaaaga agggcgggaa aagcctttaa 1140 cttatcagga gttacaaatg cttccgtatt tagtgagtgt attgttatgg tctgcagagc 1200 atggctaatg aaagcagtct tctgtggtcc ttgaaggtca tcggtaggga gttgattttt 1260 acttttcaga agatgaggct aataacctgt agcatttcta gtgttgtatc aggtcgtctg 1320 ccacgggtca atacaaaaga gccgctcaga tatggtgact atagtatccc tattggcgca 1380 agttttcctc tcctttcgct ctctttctat aactgacgga ttagacagac acccgtcagc 1440 accacccaac ggttaacaca ctacaatgcc accatattcc cctccccaaa cacattcctc 1500 cccgaacgtt ggcttcagcc ctcggaacga aagcgcctgg agaaatacat ccagccgttc 1560 gggcgtggct caagatcttg tataggcatg footagtct cgtcccctat tcgagtgtga 1620 ctaaaatgac taatgagaga agtcttgcaa atgcagagat ttacaaaaca ttggcggaga 1680 tgtttgcaag gtttgacatg aagttatatg atacggagtt cgaggatatt atgcaagtgc 1740 atgacttttt tactcgttt ccatcgagcg agaggggttt aagaatactt gtggaagcat 1800 aa 1802 <210> 30 <211> 282 <212> PRT <213> Artificial Sequence <220> <223> CESUL Amino Acid Sequence <400> 30 Met Ala Leu Asp Arg Gln Asn Ala Lys Val Thr Thr Phe Gly Leu Ser 1 5 10 15 Lys Pro Lys Thr Asn Ile Asp Arg Arg Ser Cys Gln Arg Thr Val Pro 20 25 30 Met Lys Val Leu Cys Leu Gly Leu Cys Arg Thr Gly Thr Ser Ser Leu 35 40 45 Arg Ala Ala Leu Phe Glu Leu Gly Leu Asp Asp Val Tyr His Met Cys 50 55 60 Ser Val Thr Glu Glu Asn Pro Leu Asp Ser Lys Leu Trp Lys Glu Ala 65 70 75 80 Phe Asp Ala Lys Tyr Glu Gly Ile Gly Lys Pro Tyr Gly Arg Ala Glu 85 90 95 Phe Asp Ala Leu Leu Gly His Cys Met Ala Thr Ser Asp Phe Pro Ser 100 105 110 Val Ala Phe Ala Pro Glu Leu Ile Ala Ala Tyr Pro Glu Ala Lys Ile 115 120 125 Ile Leu Thr Val Arg Asp Asn Ala Asp Val Trp Tyr Asp Ser Val Leu 130 135 140 Asn Thr Ile Trp Arg Val Ser Asn Phe Leu Arg Ala Pro Pro Arg Thr 145 150 155 160 Leu Thr Gln Arg Val Val Gln Ala Ile Leu Pro Lys Pro Asp Phe Asn 165 170 175 Ile Phe Lys Tyr Ser Pro Leu Gly Asn Phe Pro Glu Glu Gly Cys Gln 180 185 190 Trp Tyr Ser Asp Trp Asn Glu Glu Ile Arg Thr Leu Ala Lys Gly Arg 195 200 205 Asp Phe Leu Glu Phe Asn Val Lys Glu Gly Trp Gly Pro Leu Cys Arg 210 215 220 Phe Leu Glu Val Glu Gln Pro Glu Thr Pro Phe Pro Arg Val Asn Asp 225 230 235 240 Ser Asn Thr Phe Lys Glu Phe His Asp Lys Gly Leu Glu Gln Asp Ile 245 250 255 Gln Arg Leu Val Gly Ile Ser Thr Lys Leu Val Ala Ala Val Gly Val 260 265 270 Leu Gly Leu Ala Val Trp Leu Ala Arg Lys 275 280 <210> 31 <211> 965 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of CEsul (including intron) <400> 31 atggctttag accgccagaa tgcgaaagtt acaactttcg gtctgtcaaa gccgaaaacc 60 aatatagatc gccgatcatg tcagagaact gtccccatga aggttctctg cctaggacta 120 tgtcgaaccg gcacttcctg ttcgtatcaa accatatctc tcacattgct actctcgcta 180 accattcaac agcattgcgt gcggctctct ttgagcttgg ccttgatgat gtctatcaca 240 tgtgtagtgt gacggaagag aatcccctcg actccaagtt gtggaaagag gccttcgacg 300 cgaaatatga agggatcggc aagccctacg gaagagctga atttgacgca ctcttgggtc 360 attgcatggt aagaatcacc tgatcccaac tcttaacgtc caaagtatct gtattactaa 420 caatgcacta ggcaacctcg gatttcccca gcgttgcctt cgctccagaa ctcatcgccg 480 cttaccccga ggcaaagata attctcactg tacgagataa cgccgatgtc tggtatgact 540 ccgttctcaa cacgatctgg agagtctcca acttccttcg cgctcctccg agaactttaa 600 cccaacgagt cgttcaagcg attcttccca agccggattt caacatattc aagtacagcc 660 cccttggcaa ctttcctgag gaaggctgtc agtggtatag tgactggaat gaagagatta 720 gaactctagc caaagggagg gacttcttgg aattcaatgt aaaggagggga tggggtccac 780 tctgtagatt cttggaggtg gagcagccgg agacgccatt tccaagagtc aatgattcaa 840 atacattcaa ggaatttcat gataagggtt tggagcagga tattcaaaga ctggtaggca 900 taagtactaa gcttgtcgcc gctgttggtg tattgggttt ggctgtttgg ctagctagga 960 distribute 965 <210> 32 <211> 455 <212> PRT <213> Artificial Sequence <220> <223> e20_02930 <400> 32 Met Phe Arg Ser Glu Asn Ser Gln Val Ser Gln Ser Lys Gly Ala Phe 1 5 10 15 Lys Pro Arg Thr Phe Ser Phe Ser Pro Gln Thr Pro Ser Leu Ser Ser 20 25 30 Cys Asn Ser Phe Tyr Leu Tyr Ile His Gly Val Ser Lys Arg Val Pro 35 40 45 Ala Gly Glu Glu Ser Glu Ser Arg Leu Thr Ala Gln Asn Leu Val Trp 50 55 60 Ser Gly Tyr Asn Ala Ala Phe Gly Asn Asp Val Ala Trp Asp Phe Lys 65 70 75 80 Val Val Gln Leu Asn Thr Thr Ala Gln Gly Leu Ala Phe Phe Arg Gly 85 90 95 Ser Met Ala Arg Gly His Gly Ser Gly Gln Ile Ile Leu Leu Asp Glu 100 105 110 Ser Tyr Lys Leu His Arg Thr Ile Ser Ala Glu Ile Glu Gly Ala Ser 115 120 125 Leu Asp Ala His Asp Phe Gln Leu Leu Asp Asn Gly Arg Val Ala Ile 130 135 140 Val Val Met Tyr Thr Ala Val Gln Arg Asp Leu Ser Ser Arg Asp Tyr 145 150 155 160 Thr Ala Gly Leu Gly Trp Leu Ile Ser His Glu Asp Ser Ser Ile Ile 165 170 175 Trp Arg Leu Gly Gly Pro Arg Ser Asp Phe Glu Leu Glu Asp Phe Thr 180 185 190 Phe Ser Ala Gln His Asp Val Arg Ile Val Gln Glu Ser Asp Asp Lys 195 200 205 Glu Gln Ile Ser Leu Phe Asn Asn Gly Trp Asn Gly Ala Thr Gln Thr 210 215 220 Arg Phe Asp Ser Val Ala Met Val Leu Glu Leu Asp Ile Gln Glu Lys 225 230 235 240 Lys Ala Arg Val Leu Lys Glu Trp Ser Pro Leu Asn Gly Gly Leu Ala 245 250 255 Leu His Glu Gly Ser Ile Arg Phe Leu Glu Asn Gly Asn Thr Leu Val 260 265 270 Ser Trp Gly Gly Leu Pro Gln Phe Ser Glu Phe Ala Pro Asp Gly Glu 275 280 285 Arg Val Leu Asp Val Lys Phe Glu Arg His Thr Val Ala Thr Tyr Arg 290 295 300 Thr Ile Lys His Gly Trp Val Gly Arg Pro Asp Thr Leu Pro Asp Leu 305 310 315 320 Tyr Ile Tyr Ser Arg Ser Glu Val Asp Pro Ser Tyr Val Tyr Met Ser 325 330 335 Trp Asn Gly Ala Thr Glu Val Val Ser Trp Lys Val Tyr Gly Val Gly 340 345 350 Asn Asp Ala Ser Thr Ala Pro Glu Phe Leu Gly Ser Ile Asp Arg Gln 355 360 365 Gly Phe Glu Thr Gln Tyr Ile Ala Pro Gln Thr Ile Val Ser Gly Tyr 370 375 380 Val Glu Ala Ile Asp Lys His Gly Glu Ile Leu Ala Thr Ser Val Val 385 390 395 400 Thr Thr Thr Thr Ile Pro Pro Glu Asn Leu Arg Pro Gln Cys Glu Ile 405 410 415 Trp His Cys Ser Ala Gln Ala Asp Glu Asn Ala Pro Asp Ser Asp Phe 420 425 430 Asn Asp Gly Gln Lys Pro Pro Gln Phe Met Asn Val Lys Glu Pro Val 435 440 445 Leu Gln Ala Thr Lys Glu Asp 450 455 <210> 33 <211> 2055 <212> DNA <213> Artificial Sequence <220> <223> e20_02930 DNA sequence <400> 33 atgtttcgtt ccgagaactc ccaagtctca cagagcaagg gcgcctttaa acctcgtaca 60 ttctcattct ctccgcaaac cccctcgctt agctcctgta attcattcta cctatacata 120 cagtagaact ttctatgtcg aaaggttctt cacggtcgta atgctatctt gaacctaact 180 taatgctatc atgagagttg ttctgctcct aaaactgtcc atcctgaatt ggatgtcaag 240 accatatgct tctgctctgt cttttttatc agtacgtgcc tctgagatcg gtacttaacc 300 tgcagaagtg actcttttcc agagacccga cttgaatata cctactttca ttattcgtat 360 acacgaagaa caacgatgtg ctcccggata ctggtttgtg gcaccatgga cgggcccaca 420 ccaacacgca ccatacatct acgataacag tggtgtaagt aaaagagtcc ctgcgggaga 480 ggaaagtgaa agtcggttaa cagcacagaa tcttgtctgg tctggttaca atgctgcctt 540 tggcaatgac gtggcgtggg acttcaaggt tgtccagctc aacacgactg cccagggact 600 cgctttcttt cgcggatcga tggcgcgtgg acacggctcg ggtcagatca ttcttctcga 660 cgagtcgtac aaattgcacc ggacgattag tgcggagata gaaggagctt cacttgatgc 720 acatgacttt caactgcttg ataatggacg cgtcgccatt gtagttatgt atactgcggt 780 tcaaagagac ctctcatcga gagattatac agctgggttg ggttggttgt acgattgtag 840 cttcaaggaa tacgagcttg agacggggaa tgtactgttc gagtggaatt cgctagatca 900 tgtacctatc gacgaatcag ttttggagat aaatctcatt caaggagttg gaagttcaac 960 tctgaagccg tgggattat tgtaaggata tgtcattatc cgctattgga cattgctaac 1020 ttctctcagc cacatcaact cagtcgagaa gtacaaaat ggagattatc ttatctctgc 1080 aagacacacc gatacaatct ataggatctc tcacgaggat tcatcaatca tatggagact 1140 gggaggacct cgttcagact ttgagcttga agacttcacg ttctcggcac agcacgacgt 1200 acgaatcgtc caagaaagtg acgacaagga gcaaatttca ctgtttaaca acggctggaa 1260 tggagcaaca caaacccgct ttgattcggt agcaatggtt ctcgagctag atatccaaga 1320 gaaagcg agggtactga aagagtggtc accgctgaac ggcgggttgg ctctgcatga 1380 gggaagcata agattcctcg agaacggtaa tactttggtg agctggggag gacttccaca 1440 gttcagcgag ttcgcaccag atggcgagcg ggttctggac gtgaaattcg aacgtcacac 1500 ggtagcgacg tatcgaacca tcaaacatgg ttgggttggc agaccagaca cactcccaga 1560 tctttacatt tattcgcgct cggaagtcga ccccagctat gtctacatga gttggaacgg 1620 agccaccgag gtagtgagtt ggaagtgta cggggtaggg aatgacgcct cgacggcacc 1680 1740 tatcgtctcc ggatacgtcg aggccattga taagcatggc gaaattctcg caacttccgt 1800 tgtgacgacg acgaccatcc cacctgaaaa tctacggcca cagtgtgaga tctggcactg 1860 ttcagcccaa gctgaatgaaa acgcaccaga ttctgacttt aacgatggcc agaaaccacc 1920 ccagtttatg aatgtgaagg aaccggtcct gcaagccacg aaaggatt caaaatgtca 1980 aatgaatagg aggcttttat tgataattgc tggtgtcgtg ttatgggta tcggctttta 2040 cgctggtagg attag 2055

Claims

1. A gene combination, characterized in that, The gene combination includes those derived from filamentous fungi. Coleophoma empetri F-11899 contains the gene encoding the P450 monooxygenase CEP450-3 and the gene encoding the sulfonyltransferase CESUL; the amino acid sequence of CEP450-3 is shown in SEQ ID NO: 28, and the amino acid sequence of CESUL is shown in SEQ ID NO:

30.

2. The gene combination as described in claim 1, characterized in that, The nucleotide sequence encoding the CEP450-3 is shown in SEQ ID NO: 29, and / or the nucleotide sequence encoding the CESUL is shown in SEQ ID NO:

31.

3. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the gene combination as described in claim 1 or 2.

4. The recombinant expression vector as described in claim 3, characterized in that, The CEP450-3 and CESUL are on the same recombinant expression vector.

5. The recombinant expression vector as described in claim 4, characterized in that, The backbone plasmid of the recombinant expression vector is pAg1-H3.

6. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria include the gene combination as described in claim 1 or 2, or the recombinant expression vector as described in any one of claims 3-5.

7. The genetically engineered bacteria as described in claim 6, characterized in that, The origin of the genetically engineered bacteria is Glarea lozoyensis or Aspergillus pachycristatus .

8. A method for preparing echinococcal compounds, characterized in that, The method includes culturing the genetically engineered bacteria as described in claim 7 in a fermentation medium to induce it to express and produce the echinocandin-like compound, wherein the echinocandin-like compound is: or .

9. The method as described in claim 8, characterized in that, The fermentation medium has a pH of 6.0–7.0, and / or the fermentation medium contains 80–120 g / L mannitol, 4–6 g / L cottonseed meal, 8–12 g / L soybean meal, 3–5 g / L K₂HPO₄, and 0.8–1.2 g / L CaCO₃; and / or, The culture temperature is 23~27 ℃, and / or the culture rotation speed is 200~240 rpm, and / or the culture time is 8~12 days.

10. The method as described in claim 9, characterized in that, The pH value of the fermentation medium is 6.5; The mannitol is 100 g / L, the cottonseed meal is 5 g / L, the soybean meal is 10 g / L, the K2HPO4 is 4 g / L, and the CaCO3 is 1 g / L; The temperature is 25 ℃; the rotation speed is 220 rpm; and the time is 10 days.

11. The gene combination as described in claim 1 or 2, or the recombinant expression vector as described in any one of claims 3-5, or the use of the genetically engineered bacteria as described in claim 7 in the production of echinocandin compounds, wherein the echinocandin compounds are as defined in claim 8.

Images