Low-temperature alpha-l-rhamnosidase, encoding gene and application thereof

Abstract

The application discloses a low-temperature alpha-L-rhamnosidase, a coding gene and application thereof. The low-temperature alpha-L-rhamnosidase gene is cloned from the whole genome of Alteromonas colwelliana A321 with a preservation number of CCTCC NO:M 2012132, the nucleotide sequence of the low-temperature alpha-L-rhamnosidase gene is shown in SEQ ID No:2, the full length is 2880bp, and the coding 959 amino acids, and the amino acid sequence is shown in SEQ ID NO:1. The enzyme activity of the low-temperature alpha-L-rhamnosidase 5L in a fermentation tank reaches 11000U / mL, the low-temperature alpha-L-rhamnosidase has higher catalytic activity in a low-temperature range of 4-10 DEG C, can catalyze rutin and naringin to be degraded at low temperature, and achieves the purpose of removing bitterness of fruit juice, and has a good application prospect in a fruit juice processing industry.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a low-temperature α-L-rhamnosidase, its encoding gene, and its applications. Background Technology

[0002] α-L-rhamnosidase (EC 3.2.1.40) is widely distributed in nature and has been reported in animal tissues, plants, yeasts, fungi, and bacteria. Based on its degradation characteristics, it can be classified into the glycoside hydrolase 13 family, glycoside hydrolase 28 family, glycoside hydrolase 78 family, and glycoside hydrolase 106 family. As a glycoside hydrolase, α-L-rhamnosidase can specifically cleave the terminal non-reducing L-rhamnose from a large number of natural products, including many natural glycosides containing terminal L-rhamnose such as naringin, rutin, quercetin, hesperidin, and terpenoid compounds. This enzyme has important biotechnological value in processes such as debittering citrus juice, hydrolysis of natural glycosides to produce α-L-rhamnose, enzymatic hydrolysis of terpenoid glycosides for flavor enhancement, elimination of hesperidin crystals in orange juice, and derhamnosylation of various steroidal α-L-rhamnose compounds such as ginsenosides.

[0003] In fruit juice debittering applications, such as FC (concentrated solubles), NFC (not from concentrate), and HPP (high-pressure pressed) fresh juice, the juice must be processed and stored at a low temperature of 4-10℃ throughout the entire process to prevent protein denaturation and nutrient loss. This limits the practical application of high-temperature α-L-rhamnosidases in fruit juice debittering. Currently, most α-L-rhamnosidases discovered are high-temperature glycoside hydrolases. The optimal temperature for most fungal-derived α-L-rhamnosidases is 50-60℃, while the optimal temperature for different bacterial-derived α-L-rhamnosidases is generally 35-60℃. Most α-L-rhamnosidases exhibit low activity at 10℃. CN111676206B discloses an α-L-rhamnosidase gene obtained from elephant excrement, which modifies the properties of α-L-rhamnosidase by shortening its structural domains. This enzyme has a molecular weight of approximately 120 kDa, but its activity is low at low temperatures, maintaining only 20% of its activity at 10℃. Jingcong Xie et al. disclosed an α-L-rhamnosidase with an enzyme activity of 11 U / mL at 10 °C.

[0004] Therefore, most studies focus on the determination of α-L-rhamnosidase activity and thermal stability at higher temperatures, with few researches exploring its low-temperature performance from a practical application perspective. This necessitates higher requirements for the activity of α-L-rhamnosidase at lower temperatures. Although research on the enzymatic properties of α-L-rhamnosidase is becoming increasingly mature, its overall low activity at low temperatures makes large-scale application in industrial production processes requiring lower reaction temperatures difficult. Therefore, the development of novel low-temperature α-L-rhamnosidases is needed to meet the application requirements for debittering in fruit juice processing. Summary of the Invention

[0005] To address the shortcomings and deficiencies of existing technologies, this invention provides a low-temperature α-L-rhamnosidase, its encoding gene, and its applications. The low-temperature α-L-rhamnosidase described in this invention is a novel enzyme that maintains excellent activity at low temperatures and exhibits good low-temperature stability, showing promising application prospects in the fruit juice processing industry.

[0006] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0007] This invention provides a low-temperature α-L-rhamnosidase, the amino acid sequence of which is shown in SEQ ID NO:1.

[0008] The present invention also provides a gene encoding the low-temperature α-L-rhamnosidase described above, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0009] The present invention also provides a recombinant vector containing the aforementioned coding gene.

[0010] Furthermore, the recombinant vector plasmid is the Bacillus subtilis plasmid pP43NMK.

[0011] The present invention also provides a recombinant cell containing the aforementioned encoding gene.

[0012] Furthermore, the recombinant cells are Bacillus subtilis WB800.

[0013] The present invention also provides a method for preparing the aforementioned low-temperature α-L-rhamnosidase, which comprises the following steps:

[0014] (1) The genome of Alteromonas colwelliana A321 strain with preservation number CCTCC NO:M 2012132 was extracted. Based on the comparison analysis of the genome sequence and functional genes, primers were designed and the low-temperature α-L-rhamnosidase gene was amplified using the extracted genomic DNA as a template.

[0015] (2) The low-temperature α-L-rhamnosidase gene and plasmid obtained in step (1) are ligated after double enzyme digestion, and the ligation product is transformed into competent cells to obtain a recombinant vector containing the low-temperature α-L-rhamnosidase gene.

[0016] (3) The recombinant vector from step (2) is transformed into host cells to obtain low-temperature α-L-rhamnosidase recombinant cells;

[0017] (4) The recombinant cells of low-temperature α-L-rhamnosidase from step (3) are fermented and cultured to induce expression, and the expression products are collected and purified to obtain low-temperature α-L-rhamnosidase.

[0018] Furthermore, the primers in step (1) are:

[0019] F: atcggatccgaattcgagctcatgttggttataaacaaagcattattaaca;

[0020] R: gtggtggtggtggtgctcgagtaaattaataacaccttcaaaagtatattgc.

[0021] Furthermore, the amplification reaction conditions in step (1) are 95℃ for 3 min; 95℃ for 15 s; 55℃ for 15 s; 72℃ for 3 min, 35 cycles; 72℃ for 3 min; reaction stopped, and kept warm at 4℃.

[0022] The present invention also provides the application of the aforementioned low-temperature α-L-rhamnosidase in the catalytic degradation of natural glycosides.

[0023] Furthermore, the natural glycosides include naringin, rutin, quercetin, and hesperidin.

[0024] The present invention also provides the application of the aforementioned low-temperature α-L-rhamnosidase in the preparation of fruit juice debittering additives.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1. This invention utilizes designed primers for PCR amplification to obtain the low-temperature α-L-rhamnosylase gene from *Alteromonas colwelliana* A321 (accession number CCTCC NO: M 2012132). The shallow sea area where this *Alteromonas* originates has a temperature consistently below 24°C, laying the foundation for the discovery of low-temperature enzymes. The coding region of the low-temperature α-L-rhamnosylase gene is 2880 bp long, encoding a low-temperature α-L-rhamnosylase with 959 amino acids, belonging to the 78 family of glycoside hydrolases. Its amino acid sequence has the highest similarity (75.58%) to existing α-L-rhamnosylases, representing a novel low-temperature α-L-rhamnosylase.

[0027] 2. This invention enables the construction of the recombinant vector for low-temperature α-L-rhamnosidase and its overexpression in Bacillus subtilis, achieving large-scale production of low-temperature α-L-rhamnosidase. The activity of the low-temperature α-L-rhamnosidase reached 11000 U / mL after fermentation in a 5L fermenter, significantly higher than the activity in shake flasks (150 U / mL). Furthermore, the enzyme exhibits high purity and excellent physicochemical properties. The obtained α-L-rhamnosidase retains high activity even at low temperatures. Low-temperature enzymatic hydrolysis results show that the enzyme activity at 10℃ is 80% of the highest activity achieved during fermentation in the fermenter, approximately 8800 U / mL. This also avoids the activity loss caused by prolonged exposure to high temperatures, demonstrating high research and application value.

[0028] 3. The low-temperature α-L-rhamnosidase provided by this invention can efficiently degrade flavonoids such as rutin and naringin, and can be widely used in the debittering of fruit juice and the production of rhamnose, isoquercitrin, etc., promoting their application in fruit juice processing and biomedicine. Attached Figure Description

[0029] Figure 1 : Agarose gel electrophoresis image of the target gene; where M is the marker and 1 is the low-temperature α-L-rhamnosidase gene;

[0030] Figure 2 Recombinant plasmid map;

[0031] Figure 3 : SDS-PAGE protein electrophoresis pattern; where M is the protein molecular weight marker, and 1 is the purified low-temperature α-L-rhamnosidase protein;

[0032] Figure 4 Temperature-enzyme activity curve;

[0033] Figure 5 Temperature stability of α-L-rhamnosidase at low temperatures;

[0034] Figure 6 pH-relative enzyme activity curve;

[0035] Figure 7 Results of rutin degradation by α-L-rhamnosidase at low temperature;

[0036] Figure 8 Results of low-temperature α-L-rhamnosidase degradation and conversion of naringin. Detailed Implementation

[0037] The technical solution of the present invention will be further described in detail with reference to the following specific examples.

[0038] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0039] (I) Culture medium

[0040] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride. Add 20 g / L agar powder to prepare LB solid medium.

[0041] Fermentation medium: glucose 5g / L, peptone 12g / L, yeast extract 24g / L, potassium dihydrogen phosphate 2.31g / L, dipotassium hydrogen phosphate 12.54g / L.

[0042] SP-A salt solution: (NH4)2SO4 4g / L, K2HPO4·3H2O 28g / L, KH2PO4 12g / L, sodium citrate 2g / L.

[0043] SP-B salt solution: MgSO4·7H2O 0.4g / L.

[0044] 100×CAYE solution (100mL): 20g / L casein hydrolysate, 100g / L yeast extract.

[0045] SPI medium (10 mL): 4.9 mL SP-A salt solution, 4.9 mL SP-B salt solution, 100 μL glucose (50% w / v), 100 μL 100×CAYE.

[0046] SPII medium (10 mL): 9.8 mL SPI medium, 100 μL 50 mM CaCl2, 100 μL 250 mM MgCl2.

[0047] 100×EGTA solution: 10mM EGTA solution, a small amount of NaOH needs to be added to bring the pH to 8.0 during dissolution.

[0048] (II) Method for determining rhamnosidase activity: The reaction system consisted of 1 mL of 50 mmol / L sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (pH 7.0), followed by 200 μL of 1 mmol / L p-nitrobenzene α-L-rhamnoside (pNPR), and then 200 μL of enzyme supernatant. The reaction was carried out in a 30℃ water bath for 10 min. Finally, 1 mL of 1 mol / L sodium carbonate solution was added to terminate the reaction. The absorbance was measured at 405 nm.

[0049] An enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 μmol of p-nitrophenol per minute under the specified assay conditions.

[0050] The depositary institution for Alteromonas colwelliana A321 is the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Wuhan, China; deposit date: April 23, 2012; the accession number for Alteromonas colwelliana A321 is CCTCC NO: M 2012132.

[0051] Example 1: Cloning and Analysis of Low-Temperature α-L-Rhamnosidase Gene

[0052] DNA was extracted from the bacterial culture of Alteromonas colwelliana A321 in the logarithmic growth phase. Using the extracted total DNA from Alteromonas colwelliana A321 as a template, primers were designed based on the specific nucleotide sequences obtained from sequencing. The primers are as follows:

[0053] F: atcggatccgaattcgagctcatgttggttataaacaaagcattattaaca (SEQ ID NO: 3);

[0054] R: gtggtggtggtggtgctcgagtaaattaataacaccttcaaaagtatattgc (SEQ ID NO: 4).

[0055] PCR amplification was then performed. The PCR reaction system (50 μL) consisted of: 1 μL template DNA, 2 μL each of the primers, 1 μL dNTP, 25 μL 2×PhantaMax Buffer, 1 μL DNA polymerase, and sterile water to a final volume of 50 μL. The PCR reaction conditions were: 95 °C for 3 min; 35 cycles (95 °C, 15 s; 55 °C, 15 s; 72 °C, 3 min); 72 °C for 3 min; after which the reaction was stopped, the mixture was incubated at 4 °C.

[0056] The obtained PCR products were subjected to agarose gel electrophoresis to verify a single band, and then sequenced (see electrophoresis pattern). Figure 1 According to the sequencing results, the gene is 2880 bp in length, and its sequence is shown in SEQ ID NO:2. It encodes a protein composed of 959 amino acids, the amino acid sequence of which is shown in SEQ ID NO:1. Based on the BLAST database alignment, the protein encoded by this gene belongs to the glycoside hydrolase 78 family, and its amino acid sequence shows the highest similarity (75.58%) to other reported α-L-rhamnosylases, indicating that this protein is a novel, low-temperature α-L-rhamnosylase.

[0057] Example 2: Construction of a low-temperature α-L-rhamnosidase recombinant vector

[0058] The PCR amplification products were purified using the Cycle-Pure Kit to obtain the low-temperature α-L-rhamnosylase gene with the nucleotide sequence shown in SEQ ID NO:2. The pP43NMK plasmid and the purified product were double-digested with restriction endonucleases Sac I and Xho I at 37°C for 12 h. After electrophoresis, the digested products were extracted using the Gel-Extraction Kit. The obtained PCR amplification products were ligated into the pP43NMK vector at 37°C for 30 min to obtain the recombinant vector ALT3646-pP43NMK containing the low-temperature α-L-rhamnosylase gene (recombinant plasmid image shown). Figure 2 ).

[0059] Example 3: Heterologous expression of α-L-rhamnosidase at low temperature

[0060] The recombinant vector was heat-shocked into E. coli DH5α, and the resulting product was plated on LB plates and incubated at 37°C for 12 h. Positive transformants were picked and inoculated into LB liquid medium and incubated for 10 h. The recombinant plasmid was then extracted using the Plasmid Mini Kit plasmid extraction kit.

[0061] To prepare competent Bacillus subtilis cells, a single circular loop of Bacillus subtilis WB800 glycerol culture was streaked onto an LB agar plate and incubated upside down at 37°C for 12 h. A single colony was picked and transferred to 5 mL of LB medium and incubated at 37°C and 220 rpm for 12 h. 200 μL of the seed culture was transferred to 10 mL of fresh SPI medium and incubated at 37°C and 250 rpm until the end of the logarithmic growth phase (approximately 4-5 h). Then, 400 μL of the culture that had reached the end of the logarithmic growth phase was transferred to 4 mL of SPII medium and incubated at 37°C and 100 rpm for 90 min. 20 μL of 10 mM EGTA was added to the bacterial cells in the SPII medium, and the culture was incubated at 37°C and 100 rpm for 10 min. The treated bacterial culture was aliquoted into 0.5 mL tubes, and 10 μL of the expression vector was added to each tube. The tubes were incubated at 37°C and 170 rpm for 90 min. The sample was plated on LB agar plates containing 100 μg / mL kanamycin sulfate and incubated at 37°C for 12 h. Positive transformants were picked and sequenced to obtain the positive clone strain ALT3646-WB800.

[0062] Shake-flask fermentation: The positive clone strain ALT3646-WB800 was inoculated into fermentation medium (100 μg / mL kanamycin sulfate) and fermented at 37°C and 200 rpm for 48 hours. The fermentation broth was ultrasonically disrupted under ice bath conditions. The disrupted bacterial solution was centrifuged at 8000 rpm for 10 min at 4°C, the precipitate was discarded, and the supernatant was collected to obtain the crude enzyme solution. The enzyme activity was determined according to the enzyme activity assay method, and the enzyme activity was found to be 150 U / mL.

[0063] Fermentation in a fermenter: The positive clone strain ALT3646-WB800 was further fermented in a 5L fermenter. 750 μL of recombinant bacteria was taken from a glycerol storage tube and added to 150 mL of LB liquid medium, and cultured at 37°C for 10-12 h. The seed culture grown for 10-12 h was inoculated at a rate of 5%-10% into a 5L fermenter containing fermentation medium (100 μg / mL kanamycin sulfate). After the pH and dissolved oxygen levels in the fermenter recovered, a variable-speed feedstock strategy was used to promote rapid cell growth. When the OD600 value of the cells reached 50, the feeding method was adjusted to dissolved oxygen feedback feeding. The dissolved oxygen level was maintained between 20% and 30% by controlling the stirring speed and feeding rate. After 48 h of fermentation, the fermentation broth was sonicated under ice bath conditions to disrupt the cells. The disrupted bacterial solution was centrifuged at 8000 rpm for 10 min at 4°C, the precipitate was discarded, and the supernatant was collected to obtain the crude enzyme solution. The enzyme activity was determined according to the enzyme activity assay method, and the measured enzyme activity was 11000 U / mL. The rhamnosinase activity in the crude enzyme solution after high-density fermentation in the fermenter reached 11000 U / mL, which is about 73 times higher than that of the starting bacteria in the shake flask, showing a significant advantage.

[0064] Example 4: Isolation and purification of α-L-rhamnosidase at low temperature

[0065] Because the low-temperature α-L-rhamnosidase produced by the fermentation-induced recombinant engineered bacteria carries a His tag, it is compatible with Ni 2+ Due to its high specific binding ability, a nickel ion affinity chromatography column was chosen to purify and concentrate the protein. The specific steps were as follows: First, 5 column volumes of ultrapure water were added to rinse the column with ethanol. Then, 5 column volumes of equilibration buffer were added to equilibrate the column packing material. Next, the filtered and sterilized crude enzyme solution was loaded onto the column, and the enzyme solution was passed through the column three times. 5 column volumes of elution buffer (20 mM imidazole) were added to wash away contaminating proteins. 2 column volumes of elution buffer (250 mM imidazole) were added to elute the target protein to obtain the pure enzyme solution. 4 column volumes of elution buffer (500 mM imidazole) were added to wash the nickel column, followed by 10 column volumes of ultrapure water. Then, 5 column volumes of 20% ethanol were added to rinse the column. Finally, the column was preserved with 20% ethanol. The nickel column was stored at 4°C, and the obtained pure enzyme solution was stored at 4°C and analyzed by SDS-PAGE.

[0066] like Figure 3 As shown, the weight-average molecular weight of the purified protein is around 120 kDa, which is consistent with the predicted protein molecular weight.

[0067] Example 5 Enzymatic properties of recombinant low-temperature α-L-rhamnosidase

[0068] 1. The effect of temperature on enzyme activity:

[0069] Enzyme activity was measured according to the enzyme activity assay method within the range of 4-30℃, at 4℃, 10℃, 15℃, 20℃, 25℃, and 30℃ respectively. The control group underwent the same enzyme reaction using recombinant enzyme inactivated at 100℃. Enzyme activity data were plotted for comparison. Results are as follows: Figure 4 As shown in the figure, the recombinant α-L-rhamnosidase exhibits high enzyme activity in the low-temperature range of 4-30℃. Furthermore, the figure shows that under low-temperature conditions of 4℃ and 10℃, the enzyme activity is 69% and 80% of the highest enzyme activity at 30℃, respectively, with specific enzyme activity data of 7600 U / mL and 8800 U / mL, indicating good low-temperature performance.

[0070] 2. Determination of temperature stability:

[0071] Within the temperature range of 4-40℃, enzymes were incubated for different times at 4℃, 10℃, 20℃, 30℃, and 40℃. Enzyme activity was measured after 1h, 2h, 3h, 4h, 5h, and 6h of incubation. The enzyme activity of the untreated enzyme solution (0min) was defined as 100%. Relative enzyme activities were plotted for comparison. The results are shown below. Figure 5As shown, the recombinant low-temperature α-L-rhamnosidase exhibits good temperature stability below 40℃, retaining 70% enzyme activity after 6 hours at 40℃ and 100% enzyme activity after 6 hours at 4℃.

[0072] 3. Determination of the optimal reaction pH:

[0073] Enzyme activity was measured at 25°C under different pH conditions (4.0-6.0, 50 mmol / L citrate-sodium citrate buffer; 6.0-8.0, 50 mmol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer; 8.0-9.0, 50 mmol / L Tris-HCl buffer). Relative enzyme activities were plotted for comparison (highest enzyme activity was 100%). Results are shown below. Figure 6 As shown, the optimal reaction pH for recombinant α-L-rhamnosidase is 6.5.

[0074] Example 6: Application of low-temperature α-L-rhamnosidase in the conversion of rutin

[0075] Rutin was dissolved in an appropriate amount of methanol and then prepared to a final concentration of 6 mg / mL with 50 mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer. 400 μL of substrate was mixed with 40 U of recombinant low-temperature α-L-rhamnosidase enzyme solution and reacted in water baths at 10℃, 15℃, 20℃, 25℃, and 30℃ for 4 h. The reaction was terminated by adding 100 μL of methanol and then analyzed by HPLC. The conversion rate of rutin was calculated.

[0076] The conversion rate is calculated as follows: rutin conversion rate % = (initial amount of rutin - remaining amount of rutin) / initial amount of rutin × 100%.

[0077] HPLC detection conditions for rutin and isoquercitrin: detection wavelength 360 nm, column temperature 35 ℃, injection volume 10 μL, mobile phase acetonitrile: 0.02% phosphoric acid = 20:80 (v / v); mobile phase flow rate 1.0 mL / min; detection time 40 min.

[0078] Conversion rate results are shown below Figure 7 When the reaction temperature is 25℃, the conversion rate of rutin is as high as 95%, and when the reaction temperature is 10℃, the conversion rate of rutin is as high as 85%, which indicates that the low-temperature α-L-rhamnosidase of the present invention can still exert high catalytic activity under the low temperature condition of 10℃.

[0079] Example 7: Application of low-temperature α-L-rhamnosidase in the conversion of naringin

[0080] Naringin was dissolved in an appropriate amount of methanol and then prepared to a final concentration of 6 mg / mL with 50 mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer. 400 μL of substrate was mixed with 40 U of recombinant low-temperature α-L-rhamnosidase enzyme solution and reacted in water baths at 10℃, 15℃, 20℃, 25℃ and 30℃ for 4 h. The reaction was terminated by adding 100 μL of methanol and then analyzed by HPLC. The conversion rate of naringin was calculated.

[0081] The conversion rate is calculated as follows: Conversion rate of naringin % = (Initial amount of naringin - Remaining amount of naringin) / Initial amount of naringin × 100%.

[0082] HPLC detection conditions for naringin and propranolol: detection wavelength 280 nm, column temperature 30 ℃, injection volume 10 μL, mobile phase water:methanol = 50:50, mobile phase flow rate 1.0 mL / min, detection time 25 min.

[0083] Conversion rate results are shown below Figure 8 When the reaction temperature is 20℃, the conversion rate of naringin is the highest at 97%, and when the reaction temperature is 10℃, the conversion rate of naringin is 91%. This indicates that the low-temperature α-L-rhamnosidase described in this invention can still exert high catalytic activity under low-temperature conditions of 10℃, and has good application prospects in debittering of low-temperature fruit juice processing.

[0084] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A low-temperature α-L-rhamnosidase, characterized in that, The amino acid sequence of the low-temperature α-L-rhamnosidase is shown in SEQ ID NO:

1.

2. The encoding gene for the low-temperature α-L-rhamnosidase according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO:

2.

3. A recombinant vector containing the coding gene of claim 2.

4. A recombinant cell containing the encoding gene of claim 2.

5. The method for preparing low-temperature α-L-rhamnosidase according to claim 1, characterized in that, Includes the following steps: (1) Extraction of accession number CCTCC NO: M 2012132 Alteromonas colwelliana The genome of strain A321 was compared with that of functional genes. Primers were designed and the extracted genomic DNA was used as a template to amplify the low-temperature α-L-rhamnosidase gene. (2) The low-temperature α-L-rhamnosidase gene and plasmid obtained in step (1) are ligated after double enzyme digestion, and the ligation product is transformed into competent cells to obtain a recombinant vector containing the low-temperature α-L-rhamnosidase gene. (3) The recombinant vector from step (2) is transformed into host cells to obtain low-temperature α-L-rhamnosidase recombinant cells; (4) The low-temperature α-L-rhamnosidase recombinant cells from step (3) are fermented and cultured to induce expression, and the expression products are collected and purified to obtain low-temperature α-L-rhamnosidase.

6. The preparation method according to claim 5, characterized in that, The primers used in step (1) are: F: atcggatccgaattcgagctcatgttggttataaacaaagcattattaaca; R: gtggtggtggtggtgctcgagtaaattaataacaccttcaaaagtatattgc.

7. The preparation method according to claim 5, characterized in that, The amplification reaction conditions in step (1) are: 95℃ for 3 min; 95℃ for 15 s; 55℃ for 15 s; 72℃ for 3 min, 35 cycles; 72℃ for 3 min; reaction stopped, and kept warm at 4℃.

8. The application of the low-temperature α-L-rhamnosidase according to claim 1 in the catalytic degradation of natural glycosides, characterized in that, The natural glycosides mentioned are naringin and rutin.

9. The application of the low-temperature α-L-rhamnosidase according to claim 1 in the preparation of fruit juice debittering additives, characterized in that, The low-temperature α-L-rhamnosidase catalyzes the degradation of naringin and rutin in the fruit juice.

Images