Cotton promoter pghper21 induced by chemical defoliant and preparation method and application thereof

Abstract

The application discloses a cotton promoter pGhPER21 induced by a chemical defoliant, and a preparation method and application thereof, and relates to the technical field of plant genetic engineering. The cotton promoter pGhPER21 has a nucleotide sequence as shown in SEQ ID NO. 1. Meanwhile, the application also discloses a preparation method and application of the cotton promoter. The application adds the promoter into cotton, so that transgenic materials can improve the sensitivity of cotton to the defoliant, accelerate the formation of abscission cells, promote the abscission zone fracture of petioles, accelerate the abscission of leaves, and provides an important promoter resource for pGhPER21 in the aspect of helping mechanical cotton breeding.

Description

Technical Field

[0001] This application relates to the field of plant genetic engineering technology, specifically to a cotton promoter pGhPER21 induced by a chemical defoliant, its preparation method, and its application. Background Technology

[0002] Cotton, as one of the world's most important economic crops, is a crucial strategic resource. Xinjiang is one of the world's most important cotton-producing regions. To address numerous industry problems such as labor shortages, low harvesting efficiency, and rising planting costs, mechanized harvesting is being adopted. Cotton chemical defoliant technology aims to promote leaf shedding to improve the convenience of mechanized harvesting and enhance cottonseed quality.

[0003] During machine harvesting, the sensitivity of cotton varieties to defoliants is a key factor determining the subsequent processing quality of machine-harvested cotton. Defoliant-sensitive varieties rapidly form an abscission layer at the petiole after defoliant application, promoting leaf shedding. In contrast, insensitive varieties show no or slow abscission layer formation, resulting in withered but not fallen leaves and a higher impurity content in the machine-harvested cotton. Currently, most varieties promoted in production, after defoliant application during the boll-opening stage, show withered and easily broken leaves that adhere to the cotton fibers or remain on the plant, making them difficult to clean and leading to reduced quality and price. This severely restricts the development of machine-harvested cotton in Xinjiang. Since the effectiveness of chemical defoliation is related to the formation of the abscission layer, accelerating the formation of abscission layer cells and the breakage of the abscission zone is crucial. Inducing the expression of relevant genes in specific tissue sites through tissue-specific expression promoters becomes key.

[0004] Plant promoters are broadly classified into three types based on gene expression patterns: constitutive promoters, inducible promoters, and tissue-specific promoters. Currently, the tobacco cauliflower virus (CAMV) 35S promoter, which exhibits relatively high expression efficiency in dicotyledonous plants, is widely used in cotton as a constitutive promoter, resulting in high-level expression in various plant tissues and organs. However, because certain genes driven by constitutive promoters can lead to alterations in certain traits, affecting normal plant growth and development, inducible and tissue-specific promoters have become the optimal choice for improving crop quality.

[0005] However, to date, there have been no reports on inducible promoters that are specifically expressed in response to cotton defoliants. Summary of the Invention

[0006] The inventors of this application have creatively disclosed a cotton promoter pGhPER21 induced by chemical defoliants, its preparation method, and its application. By adding this promoter to cotton, the transgenic material can improve the cotton's sensitivity to defoliants, accelerate the formation of abscission cells, promote petiole abscission layer breakage, and accelerate leaf abscission, thus providing an important promoter resource for pGhPER21 in assisting in the breeding of machine-harvested cotton.

[0007] Therefore, the embodiments of this application disclose at least the following technical solutions:

[0008] In a first aspect, embodiments of this application disclose a cotton promoter pGhPER21 induced by a chemical defoliant, wherein the promoter pGhPER21 has a nucleotide sequence as shown in SEQ ID NO.1.

[0009] Secondly, embodiments of this application disclose an expression cassette comprising the nucleotide sequence of the cotton promoter pGhPER21 as described in the first aspect.

[0010] Thirdly, embodiments of this application disclose a recombinant vector comprising the nucleotide sequence of the cotton promoter pGhPER21 as described in the first aspect.

[0011] Fourthly, embodiments of this application disclose a transgenic cell line comprising the recombinant vector as described in the third aspect.

[0012] Fifthly, embodiments of this application disclose a recombinant microorganism comprising the recombinant vector as described in the third aspect.

[0013] In a sixth aspect, embodiments of this application disclose a primer pair for amplifying the cotton promoter pGhPER21 as described in the first aspect, the primer pair comprising: a forward primer as described in SEQ ID NO.2 and a reverse primer as described in SEQ ID NO.3.

[0014] In a seventh aspect, embodiments of this application disclose a method for preparing the cotton promoter pGhPER21 as described in the first aspect, comprising the following steps: using cotton whole-genome DNA as a template, performing PCR amplification using primer pairs,

[0015] The primer pair includes: the forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3.

[0016] Eighthly, embodiments of this application disclose the application of the cotton promoter pGhPER21 as described in the first aspect and the transgenic cell line as described in the fourth aspect in the cultivation of cotton that can enhance the response to defoliants.

[0017] Compared with the prior art, this application has at least one of the following beneficial effects:

[0018] This application screened and further confirmed the tissue expression pattern of the gene using qRT-PCR, discovered the difference in the expression pattern of the gene GhPER21 in different tissues, and performed cis-acting element analysis on its promoter, providing a promoter pGhPER21 that can be used in machine-harvested cotton research, providing an important promoter resource for promoting transgenic work and breeding work related to the petiole abscission layer breakage of cotton in response to defoliants.

[0019] This application constructed the pGhPER21::GUS and pGhPER21::GhCKX3 vectors and transformed them into cotton. GUS activity detection of the pGhPER21::GUS transgenic material revealed that pGhPER21 was specifically expressed in the petiole abscission layer after being induced by defoliants. Morphological and cytological examination of the pGhPER21::GhCKX3 transgenic material showed that it could improve the sensitivity of cotton to defoliants, accelerate the formation of abscission cells, promote petiole abscission layer breakage, and accelerate leaf abscission.

[0020] The pGhPER21 gene in this application provides an important promoter resource for assisting in the breeding of machine-harvested cotton, and the GhCKX3 gene provides an important functional gene resource for solving the problem of leaf defoliation in machine-harvested cotton. Attached Figure Description

[0021] Figure 1 The diagram shows the screening and expression pattern analysis of pGhPER21 provided in the embodiments of this application; wherein, A is the expression pattern of the gene shown in different tissues; B is the expression pattern of GhPER21 in the petiole abscission layer before water treatment and defoliant treatment, and on days 1, 3 and 5 after defoliant treatment.

[0022] Figure 2 This document records important time nodes in the pGhPER21::GUS cotton transgenic process provided in the embodiments of this application; wherein, A is the callus tissue after the hypocotyl is transferred into the differentiation medium; B and C are the differentiation of the callus tissue; and D is the obtained transgenic plant.

[0023] Figure 3 The following are PCR positive test results of various transgenic plants provided in the embodiments of this application; wherein,

[0024] A shows the PCR positive results of eight lines (numbered 1-8) of transgenic cotton from pGhPER21::GUS, pGhPER21::CKX3, and 35S::GUS. In the pGhPER21::GUS test results, the individual plants corresponding to bands 1, 2, 3, 4, 5, 7, and 8 were positive and were named pPER-1, pPER-2, pPER-3, pPER-4, pPER-5, pPER-7, and pPER-8, respectively.

[0025] B represents the results of pGhPER21::CKX3 detection. The individual plants corresponding to bands 1, 2, 3, 4, 5, 6, 7, and 8 were positive and were named pOE-1, pOE-2, pOE-3, pOE-4, pOE-5, pOE-6, pOE-7, and pOE-8, respectively.

[0026] In the 35S::GUS detection results, the individual plants corresponding to bands 1, 3, 4, 5, 6, 7, and 8 were positive and were named GUS-1, GUS-3, GUS-4, GUS-5, GUS-6, GUS-7, and GUS-8, respectively.

[0027] Figure 4 The images show the GUS staining results of the seedling stage and 5-leaf stage transgenic and control materials provided in the embodiments of this application before and after defoliant treatment.

[0028] Figure 5 The images show the GUS expression patterns in the leaf and petiole abscission layers of the pGhPER21::GUS transgenic material and the GhCKX3 expression pattern in the petiole abscission layer of the pGhPER21::GhCKX3 transgenic material at different time points after induction with a chemical defoliant, as provided in the embodiments of this application.

[0029] Figure 6 Phenotypic and histological staining images of the pGhPER21::GhCKX3 transgenic material provided in this application at different time points before and after defoliant treatment, as well as the petiole abscission zone.

[0030] Figure 7 Cytological morphology observations of the petiole fracture zone at different time points before and after defoliant treatment of the pGhPER21::GhCKX3 transgenic material provided in this application embodiment. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0032] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence, nor do they substantially limit the technical features thereafter. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion; for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.

[0033] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0034] To address the current lack of research reports on inducible promoters that respond to tissue-specific expression of cotton defoliants in the existing technology, this application discloses a cotton promoter pGhPER21 induced by chemical defoliants, wherein the cotton promoter pGhPER21 has the nucleotide sequence shown in SEQ ID NO.1.

[0035] This application also discloses an expression cassette containing the nucleotide sequence of the cotton promoter pGhPER21 as described above.

[0036] This application also discloses a recombinant vector containing the nucleotide sequence of the cotton promoter pGhPER21 as described above.

[0037] This application also discloses a transgenic cell line comprising the recombinant vector described above.

[0038] This application also discloses a recombinant microorganism comprising the recombinant vector described above.

[0039] This application also discloses a primer pair for amplifying the cotton promoter pGhPER21 as described above, the primer pair comprising: a forward primer as described in SEQ ID NO.2 and a reverse primer as described in SEQ ID NO.3.

[0040] This application also discloses a method for preparing the cotton promoter pGhPER21 as described above, comprising the following steps: using cotton whole-genome DNA as a template, performing PCR amplification using primer pairs,

[0041] The primer pair includes: the forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3.

[0042] Furthermore, embodiments of this application also disclose the application of the cotton promoter pGhPER21 and transgenic cell lines as described above in the cultivation of cotton that can enhance defoliant response.

[0043] In some embodiments, the application specifically includes the following steps:

[0044] The cotton promoter pGhPER21, which is induced by cotton chemical defoliants, was linked into a vector to construct a recombinant expression vector;

[0045] The recombinant expression vector was transformed into Escherichia coli or Agrobacterium GV3101 strain for expression to obtain a bacterial culture containing the promoter pGhPER21 gene;

[0046] The bacterial solution is transferred into cotton cells, tissues, or organs.

[0047] In other embodiments, the promoter pGhPER21 is specifically expressed in the abscission zone of cotton petioles under defoliant induction.

[0048] The following description is based on specific embodiments.

[0049] I. Screening of pGhPER21 and Analysis of GhPER21 Expression Patterns

[0050] Based on the expression profiles of defoliant-sensitive and non-sensitive cotton varieties treated with defoliants, and the expression profiles of various cotton tissues, genes induced to be expressed only in the petiole abscission layer by defoliant treatment were screened, such as... Figure 1As shown in Figure A; and the GhPER21 gene sequence (NCBI accession number NC_053440) was extracted from the upland cotton genome database, and primer pairs designed based on its specific region were used to perform qRT-PCR to verify its expression pattern at different time points before and after defoliant application, as shown in Figure A. Figure 1 As shown in B.

[0051] The steps for qRT-PCR are as follows:

[0052] 1. Planting and sampling of materials

[0053] Using X50, a material sensitive to chemical defoliants, and X33, a material insensitive to chemical defoliants, cotton was planted in a greenhouse. When the plants reached the boll-opening stage, each line and the control were divided into two parts. One part was cultured normally, while the other part was treated with a 1‰ concentration of defoliant (Sinthiabendazole). After 1, 3, and 5 days of treatment, the abscission layer was collected and placed into 2 mL centrifuge tubes, which were then quickly frozen in liquid nitrogen and stored at -80℃ for later use.

[0054] 2. RNA extraction and reverse transcription

[0055] Table 1 Reverse transcription system (25 μL system)

[0056]

[0057]

[0058] The sample stored at -80℃ in step 1 was ground in a mortar with liquid nitrogen. Total RNA was extracted from the plant leaves using the polysaccharide-polyphenol RNA extraction kit from Tiangen Biotech (Cat.#DP441, TIANGEN). Based on the obtained RNA concentration, 2 μg of RNA was used for reverse transcription (reaction system as shown in Table 1). 2 μg of total RNA and 1 μL of Oligo(dT) were added to a 0.5 mL centrifuge tube, and DEPC water was added to a final volume of 15 μL. After mixing, the mixture was denatured at 70℃ for 5 min, then immediately placed on ice for 5 min. The remaining reagents were added to the centrifuge tube, and the mixture was mixed by pipetting. The sample was then briefly centrifuged. The sample was placed in a reverse osmosis apparatus, and the program was set as follows: 42℃, 60 min; 70℃, 15 min. After the reaction, the obtained cDNA was diluted 10-fold with ddH2O and stored at -20℃ for later use.

[0059] 3. RT-PCR and qRT-PCR

[0060] Dilute the cDNA solution obtained in step 2 10-fold. The total RT-PCR reaction volume is 20 μL, with the following components: 10 μL cDNA template, 2 μL 10×EasyTaq buffer, 0.4 μL 10 mM dNTPs, 0.2 μL primers, 0.2 μL EasyTaq (5 U), and add ddH2O to a final volume of 20 μL. Perform the PCR reaction, and detect the products using 1% agarose gel electrophoresis.

[0061] The forward primer sequence is: caccattgatttggtgctcgcc, as shown in SEQ ID NO.4; the reverse primer sequence is: acacaatgaactcgccctaccg, as shown in SEQ ID NO.5.

[0062] Table 2 RT-PCR Program Settings

[0063] Pre-variation 95 300 transsexual 95 30 annealing 58-60 30 extend 72 30

[0064] After obtaining RT-PCR results, a 10-fold diluted cDNA solution was used as a template. The qRT-PCR reaction system consisted of the following components: 7.5 μL cDNA, 0.5 μL Primer-F, 0.5 μL Primer-R, and 9 μL SYBR Green-Mix (Bio-RAD), thoroughly mixed. Quantitative PCR analysis was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, USA). The reaction program was set to 95℃, 30 s, 1 cycle; 95℃, 5 s; 60℃, 35 s, 40 cycles. The cotton endogenous ubiquitin gene was used as the internal control gene, and three technical replicates were set for both the target gene and the internal control gene. The relative expression level was calculated using Excel using the ΔCT method. The forward primer sequence is: caccattgatttggtgctcgcc, as shown in SEQ ID NO.4; the reverse primer sequence is: acacaatgaactcgccctaccg, as shown in SEQ ID NO.5.

[0065] II. Obtaining the promoter pGhPER21 sequence and analyzing its cis-acting elements

[0066] Bioinformatics analysis was performed on a cis-elements approximately 2000 bp upstream of the GhPER21 transcription start site (ATG), the sequence of which is shown in SEQ ID NO.1. The 2 kb sequence was predicted using Plant CARE (http: / / www.dna.affrc.go.jp / PLACE / signalscan.html), a database of plant cis-regulatory elements, enhancers, and repressors. The results showed that the GhPER21 promoter sequence possesses abscisic acid-responsive elements and numerous light-responsive elements (Table 3). Abscisic acid, a plant hormone that can induce leaf abscission, is associated with cotton petiole abscission.

[0067] Table 3 Analysis of cis-acting elements of pGhPER21

[0068]

[0069] III. Construction of pGhPER21 vector

[0070] The specific steps for constructing the pGhPER21::GUS vector are as follows:

[0071] 1. Design primers

[0072] Based on the 2kb promoter region upstream of the GhPER21 gene, primer pairs with attB adapters at both ends were designed using Primer 5.0 software, including the forward primer: ggggacaagtttgtacaaaaaagcaggctgcatcagtctcagcctttagaagaca, as shown in SEQ ID NO.2; and the reverse primer ggggaccactttgtacaagaaagctgggtggttaagagtcatgtccttggattt, as shown in SEQ ID NO.3.

[0073] 2. PCR amplification of promoter sequence

[0074] PCR amplification was performed using the whole genome DNA of cotton Jin668 as a template.

[0075] (1) Prepare the PCR reaction system as shown in Table 4 below.

[0076] Table 4. PCR reaction system (20 μL)

[0077]

[0078]

[0079] (2) PCR program settings

[0080] The PCR instrument reaction program was set as follows: 95℃, 5 min; 95℃, 60 s; 58℃, 30 s; 72℃, 30 s, 29 cycles; 72℃, 5 min. After completion, the samples were stored at 4℃.

[0081] (3) Agarose gel electrophoresis to examine amplification results

[0082] Take 6 μl of PCR product, use 5 kb of Mark as a control, and detect it by 0.8% 1×TBE agarose gel electrophoresis. The number of base pairs corresponding to the positive band is the length of the fragment when the primers were designed.

[0083] 3. BP connection

[0084] The BP reaction system was placed at room temperature for 4–5 h, and the reaction system (5 μl) is shown in Table 5.

[0085] Table 5 BP Reaction System

[0086] <![CDATA[ddH2O]]> 2.5 PCR products 1 carrier PDONR-zeo 1 <![CDATA[BP Clonase TM II enzyme mix]]> 0.5

[0087] 4. Transformation of competent E. coli cells (BP reaction product)

[0088] The BP reaction product was converted into E. coli competent cells TOP10 by heat shock.

[0089] (1) After removing the competent E. coli TOP10 cells, place them on ice and wait for them to thaw. At the same time, turn on the constant temperature water bath and adjust the temperature to 42℃.

[0090] (2) Add 5 μL of the ligation product to the completely melted competent cells, gently mix with a sterile pipette tip, and place on ice for 30 min.

[0091] (3) Place the competent cells in a water bath at 42°C for 90 seconds and then place them on ice for 3 minutes. Add 200 μL of SOC solution and activate the cells by shaking at 37°C for 40 minutes until the bacterial culture is well mixed.

[0092] (4) Take 200 μL of the activated competent cells and spread them evenly on the surface of LB solid medium (containing 50 μg / mL kanamycin) plates. After drying, place them in a 37℃ incubator and incubate in the dark for about 12-16 h.

[0093] (5) Take a 2mL centrifuge tube after sterilization, add 600μL of liquid LB medium (containing 50μg / mL kanamycin), pick a single colony and put it into the centrifuge tube and mix it. Incubate at 37℃ in a shaker for 4-5 hours until the bacterial solution is well mixed.

[0094] (6) Take 1 μL of bacterial culture for each single clone as a template and detect positive results using the upstream primer of the target sequence and the downstream primer of the vector. The upstream primer sequence of the target sequence is: ggggacaagtttgtacaaaaaagcaggctgcatcagtctcagcctttagaagaca, as shown in SEQ ID NO.6; the downstream primer sequence of the vector is: gcgatccagactgaatgccc, as shown in SEQ ID NO.7.

[0095] (7) Select positive recombinant single clones for sequencing (completed by Qingke Company), and select 3 single clones for each vector.

[0096] (8) Compare the sequencing results with the original sequences. Select one positive recombinant clone with a correct sequence for each gene to ensure the accuracy of the adapter and target fragment sequences. If there are errors in the sequences, reselect a positive clone for sequencing. Incubate the bacteria in a 2mL centrifuge tube for 5 hours, preserve the bacterial culture (final glycerol concentration 15%-20%), and extract the plasmid using the Tiangen rapid plasmid mini-prep kit. Refer to the kit instructions (Cat.#DP105, TIANGEN) for specific procedures.

[0097] 5. LR reaction

[0098] The LR reaction system was placed at room temperature for 4–5 h. The reaction system (5 μL) is shown in Table 6.

[0099] Table 6 LR Reaction System

[0100] <![CDATA[ddH2O]]> 2.5 plasmid extracted in the previous step 1 Carrier PKGWFS7 1 <![CDATA[LR Clonase TM II Plus enzyme mix]]> 0.5

[0101] 6. Transformation of E. coli competent cells (LR reaction product)

[0102] The LR reaction product was transformed into *E. coli* competent cells TOP10 via heat shock. The bacterial culture was spread onto LB agar plates containing spectinomycin (Spe, 100 μg / mL). Single clones were selected for detection, and three positive single clones were sequenced. Plasmids were extracted from the bacterial cultures with correct results and the bacteria were preserved.

[0103] 7. Transformation of Agrobacterium tumefaciens using promoter vector

[0104] The plasmid was electroporated into Agrobacterium using the following steps:

[0105] (1) Sterilize pipette tips and centrifuge tubes;

[0106] (2) Turn on the electric generator to preheat and adjust the voltage to 1800V;

[0107] (3) Clean the electric transfer cup with ddH2O and alcohol in sequence, and sterilize the electric transfer cup under ultraviolet light for 10 minutes, and then pre-cool it;

[0108] (4) Mix 2 μL each of competent Agrobacterium and previously extracted plasmid, mix thoroughly with a sterile pipette tip, and then add to the gap of the electroporation cup.

[0109] (5) Place the electro-rotation cup into the instrument and double-click "PLUSE" to complete the electro-rotation;

[0110] (6) Add 400 μL of SOC to an electric centrifuge cup and mix thoroughly. Transfer the well-mixed bacterial solution to a 2 mL sterile centrifuge tube. Activate the bacterial solution by shaking at 28°C for 1 hour. Then, take out 100 μL and plate it (using a Spreader). + LB medium); invert the petri dish and incubate at 28℃ for 2 days, pick single clones, shake the bacteria, detect positive results, and store in glycerol at -80℃ for later use.

[0111] The construction process of the pGhPER21::CKX3 expression vector is as follows:

[0112] The study constructed the pGhPER21::CKX3 vector. The pGhPER21::CKX3 vector was constructed by replacing 35S with pGhPER21 using infusion technology, following the steps outlined below:

[0113] The 1.35S::CKX3 vector was constructed using the BP-LR method, with the following forward primers used:

[0114] ggggacaagtttgtacaaaaaagcaggctgcatggctgtaagcttcccaat, as shown in SEQ ID NO.8;

[0115] The reverse primer is: ggggaccactttgtacaagaaagctgggtgttaattgttattgaaaattc, as shown in SEQ ID NO.9.

[0116] 2. Design enzyme digestion adapters (Stu1 and Spe1) primers to amplify pGhPER21. The forward primer used is: atgtatgataattcgagctcatcagtctcagcctttagaagaca, as shown in SEQ ID NO.10, and the reverse primer is: ttgtgatatcactagtgtccttggatttaatatatttttggt, as shown in SEQ ID NO.11.

[0117] 3. The 35S::CKX3 vector plasmid was digested with Sac1 and Spe1.

[0118] 4. Infusion connection:

[0119] Add the infusion reaction components sequentially to the capped PCR tube and gently mix. Incubate at 37°C for 30 minutes, place on ice for 5 minutes, and store at -20°C for later use.

[0120] Table 7 Infusion System

[0121] PCR products 1 35S::CKX3-3 vector after enzyme digestion 1 Exnase 0.5 5×CE Buffer 1 ddH2O 1.5

[0122] 5. The infusion reaction product was heat-shocked and converted into E. coli competent cells TOP10.

[0123] 6. Positive identification, sequencing, and Agrobacterium-mediated transformation of recombinant vectors.

[0124] IV. Genetic transformation of pGhPER21::GUS and pGhPER21::GhCKX3 in cotton

[0125] The donor material was the upland cotton variety (Jin668). Plump and uniform Jin668 seeds were selected, the seed coat was removed, and the seeds were sterilized with 0.1% mercuric chloride solution for 10-15 minutes, shaking continuously during the process. The seeds were then rinsed three times with sterile water for 3-5 minutes each time, and placed on the surface of MS medium. After incubating in the dark at 30℃ for 1 day, the seedlings were propped up and incubated in the dark for another 4-5 days.

[0126] Agrobacterium GV3101 strain containing pGhPER21::GUS and pGhPER21::GhCKX3 vectors was inoculated into 2 ml of LB medium containing 100 mg / L spectinomycin (Spe+) and 100 mg / L kanamycin (K+), and cultured at 28°C with shaking for 1 day. The activated bacterial solution was then inoculated into 20 ml of fresh LB medium containing 100 mg / L spectinomycin (Spe+) and 100 mg / L kanamycin (K+), and cultured at 28°C with shaking overnight. 1 ml of the turbid bacterial solution was transferred to a 2 ml sterile centrifuge tube, centrifuged at 8000 rpm for 30 s to collect the bacterial cells, and resuspended in 20 ml of MGL medium containing 50 mg / L acetylsyringone (AS) (specific components are described later). The culture was then cultured at 28°C with shaking for 30 min for infecting hypocotyls.

[0127] The specific steps of Agrobacterium-mediated transformation of cotton hypocotyls are as follows:

[0128] In a laminar flow hood, take 30 sterile seedlings. Cut the hypocotyls into 0.7cm segments on sterile filter paper and inoculate them into 50ml sterile Erlenmeyer flasks. Add the activated Agrobacterium bacterial suspension containing the target vectors pGhPER21::GUS and pGhPER21::GhCKX3 to the flasks. Incubate for 3-5 minutes, shaking several times during incubation. Discard the bacterial suspension, blot the hypocotyls dry on sterile filter paper, and place them in the laminar flow hood for 10-15 minutes. Then inoculate them onto antibiotic-free 2,4-D induction medium (specific components described later). Incubate at 21°C. Co-cultured at ℃ in the dark for 36–48 h; after co-culture, hypocotyl segments were inoculated into 2,4-D induction medium containing kanamycin (100 mg / L) and cephalosporin (100 mg / L) (specific components are described later), and cultured at 28℃ under low light; subcultured once a month until embryogenic callus appeared; embryogenic callus was successively inoculated into embryo differentiation medium (specific components are described later), and subcultured once a month until somatic embryos matured; mature cotyledonary embryos were inoculated into rooting medium (specific components are described later) to germinate until complete plants were obtained.

[0129] The culture formula used in this embodiment:

[0130] MGL medium: tryptone 5 g / L, NaCl 5 g / L, MgSO4·7H2O 0.1 g / L, KH2PO4 0.25 g / L, mannitol 5 g / L, glycine 1 g / L, and distilled water to make up to 1 L.

[0131] 2,4-D induction medium: MS medium was used as the basal medium, with the addition of 0.1 mg / L 2,4-D, 0.1 mg / L cytokinin (KT), 30 g / L glucose, and 2.5 g / L Phytagel, and the volume was supplemented with distilled water to 1 L. The pH was adjusted to 5.9.

[0132] Embryo differentiation medium: MS medium was used as the basal medium, with the following added: 1.9 g / L KNO3, 0.1 mg / L KT, 30 g / L glucose, 1.0 g / L Gln, 0.5 g / L Asn, and 2.5 g / L Phytagel. The volume was then adjusted to 1 L with distilled water. The pH was adjusted to 5.9.

[0133] Rooting medium: Use 1 / 2 MS as the basal medium, add 15 g / L glucose and 2.5 g / L Phytagel, and make up to 1 L with distilled water. Adjust the pH to 5.9.

[0134] The basic MS medium formulation described above is as follows: macroelements (KNO3 1.9 g / L, NH4NO3 1.65 g / L, KH2PO4 0.17 g / L, MgSO4·7H2O 0.37 g / L, CaCl2·2H2O 0.44 g / L), microelements (KI 0.83 mg / L, H3BO3 6.2 mg / L, MnSO4·4H2O 22.3 mg / L, ZnSO4·7H2O 8.6 mg / L, Na2MoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2 0.025 mg / L), and iron salts (Na2·EDTA 37.3 mg / L, FeSO4·7H2O). 27.8 mg / L), organic components (inositol 100 mg / L, Gly 2 mg / L, VB1 0.1 mg / L, VB6 0.5 mg / L, VB5 0.5 mg / L).

[0135] V. PCR positive identification of transgenic plants

[0136] The obtained T0 generation transgenic plants were identified as positive by PCR. The specific steps are as follows:

[0137] 1. Extraction of whole-genome DNA from plants (CTAB method).

[0138] (1) Preparation: Take steel balls of equal mass, clean them with alcohol and dry them with paper towels, wrap them in paper towels and put them in a fume hood; prepare DNA lysis buffer and DNA extraction buffer; turn on the water bath and set the temperature to 65℃;

[0139] (2) Take 0.2g of sample and put it directly into a 2mL centrifuge tube, add 200μl of DNA extraction buffer and steel beads; grind with a 60Hz grinder for 90s; at the same time, preheat an appropriate amount of DNA lysis buffer;

[0140] (3) Open the centrifuge tube after grinding and add 800 μl of preheated DNA lysis buffer; place it in a water bath for lysis reaction for 30 min. During this period, gently invert the centrifuge tube several times every 10 min to mix it;

[0141] (4) Remove the contents and place them in a fume hood. Add 800 μl of chloroform and gently pipette for 20 min to mix thoroughly. Centrifuge at 12000 rpm for 10 min at room temperature.

[0142] (5) Transfer the supernatant (approximately 800 μl) to a new centrifuge tube, add 800 μl of chloroform, and gently pipette for 20 min to mix thoroughly. Centrifuge at 12000 rpm for 10 min;

[0143] (6) Repeat the previous step 1-2 times, and finally add the supernatant (800 μl) to a 1.5 mL centrifuge tube;

[0144] (7) Add 800 μl of isopropanol and mix gently with a shaker or by hand until a white flocculent substance appears, which is the DNA extract.

[0145] (8) Discard the supernatant, wash twice with 75% alcohol, discard the alcohol and open the centrifuge tube, place it in a fume hood to dry, add 50 μL of double-distilled water to dissolve, tap lightly and then add water to make up to 500 μl, and store in a refrigerator at 4°C.

[0146] 2. PCR amplification

[0147] (1) Using a DNA sample diluted 10-fold as a template, PCR amplification was performed with the forward primer NPTII-F: ttgtgcctgaagcgggaagg, as shown in SEQ ID NO.12; and the reverse primer NPTII-R: cgataccgtaaagcacgaggaa, as shown in SEQ ID NO.13. The PCR system is shown in Table 8.

[0148] Table 8 PCR Reaction System

[0149] <![CDATA[ddH2O]]> 16 10×buffer 2 dNTP 0.4 NPTⅡ-R 0.25 NPTⅡ-F 0.2 Easy-Taq enzyme 0.2 DNA template 1

[0150] (2) PCR program settings

[0151] The PCR instrument reaction program was set as follows: 95℃, 5 min; 95℃, 60 s; 58℃, 30 s; 72℃, 30 s, 28 cycles; 72℃, 5 min. After completion, the samples were stored at 4℃.

[0152] 3. Agarose gel electrophoresis was used to examine the amplification results.

[0153] Take 6 μl of PCR product, use 5 kb of Mark as a control, and detect it by 0.8% 1×TBE agarose gel electrophoresis. Determine the size of the positive band based on the length of the gene located between the primer pairs.

[0154] VI. GUS staining of transgenic cotton pGhPER21::GUS after response to chemical defoliant

[0155] Positive plants were planted, seeds were harvested to obtain the T1 generation, and GUS staining analysis was performed on the T1 generation transgenic material. The results are as follows: Figure 4 As shown, the specific steps are as follows:

[0156] 1. Kanamycin screening for positive and negative plants: Seeds obtained from generation T0 were planted on kanamycin screening medium (sterile seedling medium with 200 mg / L kanamycin added). On day 5, the growth of lateral roots was observed. If lateral roots were grown, the plants were considered positive, and the corresponding plants were used for subsequent staining experiments and greenhouse cultivation. If no lateral roots were found, the plants were considered negative and used as negative controls.

[0157] 2. GUS staining analysis of different tissues during the seedling stage. Two seedlings from each line and the control were selected and cut into three parts: root, hypocotyl, and cotyledon. For the root, care was taken to preserve lateral roots and prevent breakage. The hypocotyl was cut into three segments, 2-3 mm long. Leaves were protected from bending and mechanical damage. Materials from different lines were placed in separate centrifuge tubes, labeled, and an appropriate amount of GUS staining solution was added to submerge the tissues. The tubes were then incubated overnight (12-14 hours) at 37°C in the dark. The GUS staining solution was recovered and stored in the dark for reuse. 75% alcohol was added to submerge the materials. The sterile seedlings treated with the above stress were then removed and destained at 37°C for 1-2 hours. The alcohol was changed and destaining was repeated 2-3 times. If the destaining effect was not obvious, the treatment was continued multiple times or anhydrous ethanol (100%) was used for destaining. The materials were removed, the surface alcohol was wiped off, and they were placed on a white background for photography.

[0158] 3. Perform GUS histochemical staining on plants at the 5-leaf stage. Positive plants and negative controls were planted, and treated with a defoliant at the 5-leaf stage. Each line and control was divided into two groups: one group was cultured normally, while the other group was treated with a 1‰ concentration of defoliant (tebuconazole). Samples were taken 24 hours later. Two plants from each line and the control were selected and cut into four parts: root, hypocotyl, leaf, and abscission layer. GUS staining analysis was performed. The GUS histochemical localization method was based on the method of Jefferson et al. (Gus fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higherplants. EMBO J, 1987, 6: 3901-3907). Different organs and tissues of the transgenic plants were placed in GUS staining solution and incubated at 37°C for 2 hours to overnight. After decolorization with 70% alcohol, the tissues were fixed in FAA and stored. The expression of the GUS gene was observed by the naked eye or under a stereomicroscope and then photographed under a stereomicroscope (Leika MZFLⅢ). The GUS staining solution (100 mL) consists of the following components: x-gluc 90 mg, chloramphenicol 10.0 mg, 0.1 M sodium phosphate buffer (pH 7.0) 50 mL, methanol 20% (v / v), and sterile water to a final volume of 100 mL; tissue fixative (FAA): 70% ethanol 90 mL, 5% acetic acid 5 mL, 38% formaldehyde 5 mL.

[0159] Figure 4 In this study, one of the pGhPER21::GUS transgenic lines, pPER-1, which tested positive by PCR, was selected for GUS staining qualitative analysis, with 35S::GUS and negative isolates serving as controls. The 35S::GUS transgenic plants showed significant tissue staining at the seedling stage, while the negative isolates showed no staining. The cotyledons, hypocotyls, and roots of the pGhPER21::GUS transgenic plants showed virtually no staining at the seedling stage. Furthermore, the staining of leaves, main stem, and roots at the 5-leaf stage was similar to the negative control, although slight staining was observed in the petiole abscission layer compared to the negative control. pGhPER21 exhibits tissue-specific expression characteristics induced by chemical defoliants.

[0160] VII. Expression levels of pGhPER21::GUS in transgenic cotton and detection of pGhPER21::GhCKX3 phenotype and expression levels after defoliation.

[0161] The expression levels of GUS in the petiole abscission layer of pGhPER21::GUS T1 generation transgenic cotton and GhCKX3 in the petiole abscission layer of pGhPER21::CKX3 T1 generation transgenic cotton were analyzed, such as... Figure 5 As shown.

[0162] Figure 5 In section A and B, four positive lines of the pGhPER21::GUS transgenic plantlets at the 5-leaf stage were treated with a defoliant and a control (water) treatment, respectively, on the leaves ( Figure 5 A) and petiole abscission layer ( Figure 5 B) Sampling was performed at different sites, and the expression level of GUS in the tissues was detected by qRT-PCR. Comparing the GUS expression levels of the control and treatment groups, it was found that in leaves, the expression level in the treatment groups was generally lower than that in the control group, and both levels were very low. Therefore, the possibility of the promoter pGhPER21 driving high gene expression in leaves was ruled out. However, in the abscission layer, the expression levels in two treatment groups were significantly higher than those in the control group. This indicates that pGhPER21 is very likely driving specific GUS expression in the abscission layer. Figure 5 C represents two positive lines of pGhPER21::GhCKX3, pGhPER21::GhCKX3#11 and pGhPER21::GhCKX3#9, in which the expression of GhCKX3 in the petiole abscission layer was significantly higher than that in the control material, indicating that pGhPER21 can drive the expression of GhCKX3 in the petiole abscission layer. Figure 5 D indicates that the expression level of GhCKX3 in the petiole abscission layer was increased to some extent compared with the control before and at 3, 6, 12, 24, 48, and 72 hours after treatment with pGhPER21::GhCKX3#11 and pGhPER21::GhCKX3#9 defoliants.

[0163] 1. Sample Acquisition

[0164] Seeds from the T0 generation of pGhPER21::GUS plants were harvested and planted in a light-cultured room. When the seedlings reached the 5-leaf stage, each line and the control were divided into two parts. One part was cultured normally, and the other part was coated with a 1‰ defoliant (Sinthiabendazole). After 24 hours, the leaves and abscission layers were taken and placed into 2mL centrifuge tubes, which were then quickly frozen in liquid nitrogen and stored at -80℃ for later use.

[0165] pGhPER21::GhCKX3 T1 generation plants grown in the greenhouse to the boll-opening stage were treated with a defoliant (1‰ concentration of sineb). Absorption layers were sampled before treatment and at 3, 6, 12, 24, 48, and 72 hours after treatment.

[0166] 2. RNA extraction and reverse transcription are the same as in step one.

[0167] 3. RT-PCR and qRT-PCR are performed in the same way as in step one.

[0168] Phenotypic studies were conducted on pGhPER21::CKX3T1 generation transgenic cotton before and after defoliant application.

[0169] Sampling: pGhPER21::GhCKX3 T1 generation plants grown in a greenhouse to the boll-opening stage were treated with a defoliant (1‰ concentration of sinetetracycline). Before treatment and at 3, 6, 12, 24, 48, and 72 hours after treatment, samples of the petiole abscission layer at approximately the 6th-9th node were taken. Approximately 0.5 cm stem segments were used for tissue staining. Figure 6 As shown.

[0170] Depend on Figure 6 The left-middle image clearly shows that under defoliant induction, the pGhPER21::GhCKX3 transgenic material defoliated significantly earlier than Jin668; the right-middle image also clearly shows that the pGhPER21::GhCKX3#9 line began to actively detach from the petiole abscission layer at 48h, and the cells were in a loose state and about to form a fracture zone.

[0171] In addition, petioles at the 6th-9th nodes were manually removed at different time points before and after defoliant spraying. A single-sided protective blade was used to collect approximately 0.1 cm of the exposed surface remaining on the cotton plant body. This sample was placed in 2.5% glutaraldehyde fixative, vacuumed for 15 minutes, and then sent for scanning electron microscopy to observe the cell morphology of the petiole abscission fracture surface. Figure 7 As shown.

[0172] Scanning electron microscopy revealed that the pGhPER21::GhCKX3 transgenic line began to show rounded, unruptured cells 48 hours after defoliant application, while the control material Jin668 still showed severe cell fragmentation. At 72 hours, the pGhPER21::GhCKX3 transgenic line showed complete or mostly intact cells, including those in the vascular bundles, while the Jin668 material only showed rounded cell morphology in some areas, with the vascular bundles not yet showing any signs of expression. Therefore, pGhPER21 can be specifically expressed in the abscission zone of cotton petioles by defoliant.

[0173] Specific steps for staining and observing petiole abscission layer tissue before and after defoliant treatment:

[0174] 1. Fixation: 100 mL of 70% FAA fixative: 70 mL of anhydrous ethanol, 10 mL of 37% formaldehyde solution, and 5 mL of glacial acetic acid, diluted to 100 mL with water. Cut the material to be fixed into small pieces, add the pre-cooled fixative (the volume of the fixative should be at least 10 times the volume of the material). Place the fixative on ice and evacuate for 15 minutes, then slowly release the gas. Repeat this process twice more until the material settles to the bottom. After evacuation, replace the fixative with fresh fixative and fix overnight.

[0175] 2. Dehydration

[0176] The dehydration process is shown in Table 9.

[0177] Table 9 Dehydration Procedure

[0178] 50% ethanol 30min 50% ethanol 30min 50% ethanol 30min 70% ethanol 1 hour, can be stored overnight or for long-term preservation. 85% ethanol 1h 95% ethanol For stays of 1 hour or more, overnight stays are recommended.

[0179] 3. Continue dehydration to achieve transparency

[0180] The dehydration and clearing process continues as shown in Table 10.

[0181] Table 10 Continued Dehydration and Transparency Process

[0182] Anhydrous ethanol 1h Anhydrous ethanol 1h 3 / 4 volume anhydrous ethanol + 1 / 4 volume xylene 1h 1 / 2 volume anhydrous ethanol + 1 / 2 volume xylene 1h 1 / 4 volume anhydrous ethanol + 3 / 4 volume xylene 1h xylene 1h xylene 1h

[0183] 4. Wax impregnation

[0184] The wax impregnation procedure is shown in Table 11.

[0185] Table 11 Wax Impregnation Transparency Procedure

[0186] Xylene + approximately 1 / 4 volume of crushed wax 42℃ overnight Continue to add broken wax 42℃ 1-2 days pure wax 60℃ 3h pure wax 60℃ 3h pure wax 60℃ 3 hours, overnight stay possible

[0187] 5. Embedding

[0188] Prepare appropriately sized cardboard boxes according to the sample in advance, melt fresh paraffin wax on an induction cooker and place it in a constant temperature oven at 60℃ for later use. The temperature of the liquid paraffin used for embedding should not be too high to avoid scalding the tissue.

[0189] 6. Trim blocks

[0190] Remove the wax block from the cardboard box. You can see the red sample underneath. As needed, trim the wax block into a horizontal or vertical cut. The cut surface of the slicer blade should be rectangular; otherwise, it will be difficult to form a wax strip.

[0191] 7. Slice

[0192] Attach the repaired wax block to the rectangular base and fix it to the microtome. Align the wax block with the blade of the microtome, adjust the slice thickness, and start slicing. Use a brush to collect the wax strips and lay the cut wax strips flat on a clean piece of paper.

[0193] 8. Gluing and spreading of sheets

[0194] Apply 10 μL of 0.1% poly-L-lysine to a clean glass slide and bake at 37°C for at least 1 hour. After baking, add distilled water to the slide, cut the wax ribbon into small pieces, and lay them flat on the slide so that the wax ribbon floats on the distilled water. Place the slide on a slide dryer at 37-42°C and bake for 5 minutes. After the wax ribbon is flattened, absorb the excess water. Finally, place the slide in a slide box and bake at 37-42°C for 1-2 days.

[0195] 9. Dewaxing and rehydration

[0196] The dewaxing and rehydration procedures are shown in Table 12.

[0197] Table 12 Wax Impregnation Transparency Procedure

[0198]

[0199]

[0200] 10. Staining

[0201] Stain with 0.5% toluidine blue (0.5g toluidine blue dissolved in 100ml double-distilled water) for about 3 minutes.

[0202] 11. Dehydrated and transparent

[0203] The dyeing process is carried out in the reverse order in the dyeing vat that has just been dewaxed and rehydrated, as shown in Table 13.

[0204] Table 13

[0205] distilled water 2min 30% ethanol 1min 50% ethanol 1min 70% ethanol 1min 80% ethanol 1min 95% ethanol 1min Anhydrous ethanol 1min Anhydrous ethanol 1min 1 / 2 xylene + 1 / 2 anhydrous ethanol 2min xylene 5min xylene 5min

[0206] 12. Sealing

[0207] Mix equal volumes of neutral resin (from Sinopharm) and xylene to make a mounting medium. Remove the slide from the xylene, add two drops of the mounting medium, and use tweezers to slowly place a clean coverslip on the slide, avoiding air bubbles. Blow in a fume hood for more than 1 hour, and dry overnight in a constant temperature oven at 37-42℃.

[0208] 13. Observation

[0209] The slides can be observed and photographed under a microscope, or stored long-term in a slide box.

[0210] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A cotton promoter pGhPER21 induced by a chemical defoliant, wherein, The promoter pGhPER21 has a nucleotide sequence as shown in SEQ ID NO.

1.

2. An expression cassette comprising the nucleotide sequence of the cotton promoter pGhPER21 as described in claim 1.

3. A recombinant vector comprising the nucleotide sequence of the cotton promoter pGhPER21 as described in claim 1.

4. A transgenic cell line comprising the recombinant vector as described in claim 3.

5. A recombinant microorganism comprising the recombinant vector as described in claim 3.

6. A primer pair for amplifying the cotton promoter pGhPER21 as described in claim 1, said primer pair comprising: The forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.

3.

7. A method for preparing the cotton promoter pGhPER21 as described in claim 1, comprising the following steps: using cotton whole-genome DNA as a template, performing PCR amplification using primer pairs, wherein the primer pairs comprise: The forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.

3.

8. The application of the cotton promoter pGhPER21 as described in claim 1 in the breeding of cotton that enhances the response to the chemical foliar agent sinomethol, wherein, The cotton promoter pGhPER21 is used to drive the expression of the exfoliated cell formation-related gene GhCKX3; the application specifically includes the following steps: The cotton promoter pGhPER21, which is induced by the chemical defoliant sinotrile as described in claim 1, is linked into a vector to construct a recombinant expression vector; The recombinant expression vector was transformed into Agrobacterium GV3101 strain for expression, and a bacterial culture containing the promoter pGhPER21 was obtained. The bacterial solution is transferred into cotton cells, tissues, or organs.

9. The application according to claim 8, wherein the cotton promoter pGhPER21 is specifically expressed in the abscission zone of cotton petioles under the induction of the chemical defoliant sinosulfuron.

Images