A nuclease nano-silver biological disinfectant and its preparation method

Abstract

This invention discloses a nuclease-based nano-silver biological disinfectant and its preparation method, belonging to the field of enzyme engineering technology. Each 1000mL of disinfectant solution comprises: 5-15g of ε-polylysine salt, 50-150g of nisin, 5-15g of lysozyme, 0.5-1.5g of nuclease, 0.1-0.3g of adjuvant, 0.5-1g of active silver particles, and the remainder being sterile water. The raw materials for this nuclease-based biological disinfectant are readily available and low in cost; the preparation method is simple, requiring only uniform mixing of various raw materials; the application method is simple, achieving disinfection through spraying or application; it has good safety, causing no damage to the objects being disinfected during use, is non-irritating, easy to operate, and suitable for mass production.

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering technology, specifically relating to a nuclease nano-silver biological disinfectant and its preparation method. Background Technology

[0002] Currently, disinfectants used in public places and homes for disinfecting air and various object surfaces are mainly chemical agents, including oxygen-containing disinfectants, peroxide disinfectants, alcohol disinfectants, and quaternary ammonium salt disinfectants. Common household disinfectants typically contain alcohol or hypochlorous acid as their main component, primarily for disinfecting viruses and other pathogenic microorganisms. However, alcohol is flammable and explosive, easily causing fires and other accidents, and is not suitable for large-scale disinfection. Chlorine-containing disinfectants such as hypochlorous acid have strong irritant and corrosive properties; if diluted or used improperly, they can easily produce toxic and harmful substances such as chlorine gas, causing injury to people.

[0003] With the improvement of living standards and awareness of diseases, people are paying more and more attention to health. Green, non-toxic, and highly effective disinfectants have received widespread attention and have good development prospects. Biological disinfectants are disinfectants whose main components are naturally occurring or produced through genetic engineering technology, such as antibacterial peptides, bacteriophages, and biological enzymes. They have advantages such as mild action conditions, good bactericidal effect, no harmful residues, and safe use. Currently existing nuclease biological disinfectants generally consist mainly of nucleases, proteases, ethanol, and glycerol, which have low bactericidal stability, require strict storage and regulation, and still contain flammable and explosive components like ethanol. For example, Chinese patent application CN103891779A, entitled "A Disinfectant," describes its effective components as ceramide nuclease, protease, and cell wall-breaking enzyme, with the following weight percentages: ceramide nuclease 0.03%-0.08%, protease 0.03%-0.08%, cell wall-breaking enzyme 0.001%-0.01%, ethanol 15%, glycerol 10%, and the balance being distilled water.

[0004] For example, Chinese patent application CN114028307A, entitled "A Skin Disinfectant and its Preparation Method," describes a skin disinfectant characterized by comprising the following components in the indicated weight ratios: 0.5-3 parts glycerol, 0.5-5 parts propylene glycol, 5-40 parts ethanol, 1-15 parts hypochlorous acid solution, 1-7 parts diethanolamine, 1-7 parts triethanolamine, 1-7 parts monoethanolamine, 2-15 parts non-foaming surfactant, 0.2-5 parts sulfur extract, 0.1-3 parts alum; 0.5-2 parts DL-β-phenylserine, 0.5-5 parts L-cysteine ​​hydrochloride, 0.05-1.5 parts retinol, 0.1-2 parts vitamin C, and vitamin B2. 0.02-1 part, Vitamin PP (anti-peeling factor C6H51VO2) 0.01-1 part, Vitamin E 0.1-1 part, Recombinant human interferon 0.01-1 part, Bactericidal peptide 0.05-1 part, Lysozyme 0.02-1 part, Cell growth factor FGF 0.01-1 part, Skin rejuvenation growth factor EGF 0.01-1 part, Ribonuclease 0.01-0.6 part, Piperizine 0.2-3 parts; supplemented with Rutin 0.3-2 parts, Artemisia argyi 0.5-3 parts, and Eclipta prostrata 0.5 parts. -3 parts, Bletilla striata 0.5-3 parts, Hippophae rhamnoides 0.1-1 parts, Aquilaria sinensis 0.1-1 parts, Stemona japonica 0.1-1 parts, Cnidium monnieri 0.1-1 parts, Ligusticum striatum 0.3-1 parts, Morinda officinalis 0.5-3 parts, Sophora flavescens 0.1-1 parts, Schizonepeta tenuifolia 0.1-1 parts, Rheum palmatum 0.1-1 parts, Saposhnikovia divaricata 0.1-1 parts, Alisma plantago-aquatica 0.1-1 parts, Senecio scandens 0.5-2 parts, Chasing Wind Powder 0.5-2 parts, Artemisia capillaris 0.1-1 parts, Kochia scoparia 0.5-3 parts, Trifolium repens 1-5 parts, Zanthoxylum bungeanum 0.5-1 parts. It also contains a large amount of alcohol components, and its composition is too complex. The higher the complexity of the raw materials, the more difficult it is to control the product performance, ultimately leading to a significant increase in cost, making it difficult to effectively utilize and promote in real life. Furthermore, current disinfectants are difficult to completely kill bacteria. Residual genetic material on object surfaces can still lead to reinfection under suitable conditions, and the bactericidal and bacteriostatic effects are unstable.

[0005] Therefore, finding a simple, effective, and safe biological disinfectant that can thoroughly kill bacteria and is easy to promote in practice is a pressing technical problem that needs to be solved. Summary of the Invention

[0006] This invention addresses the problems existing in the prior art by providing a biological disinfectant composed of nuclease and active silver particles. This nuclease-based biological disinfectant uses ε-polylysine salt, lactic acid streptococci, lysozyme, and nuclease as its main components. It exhibits good bactericidal effect and stability, is non-irritating to skin and nasal mucosa, does not cause water pollution, is non-corrosive, and is safe to use. Test results show that this biological disinfectant can effectively kill microorganisms such as Staphylococcus aureus, Escherichia coli, and Bacillus subtilis. It can meet the disinfection needs of large-scale air and surface disinfection in public places such as airports, train stations, subways, and restaurants, and is also suitable for home and office use, meeting the disinfection needs of food processing, pharmaceutical GMP production, and laboratories.

[0007] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0008] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 5-15g ε-polylysine salt, 50-150g nisin, 5-15g lysozyme, 0.5-1.5g nuclease, 0.1-0.3g adjuvant, 0.5-1g active silver particles, with the remainder being sterile water.

[0009] Preferably, each 1000mL of disinfectant contains: 9-11g of ε-polylysine salt, 90-110g of nisin, 9-11g of lysozyme, 0.9-1.1g of nuclease, 0.1-0.2g of adjuvants, 0.9-1g of active silver particles, and the remainder is sterile water.

[0010] Preferably, the adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0011] Preferably, the preparation method of the active silver particles is as follows: 0.1-0.3 mg of baicalein and 1-5 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0012] Preferably, the sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 15-30 min.

[0013] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0014] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0015] (2) Preparation of active silver nanoparticles: Add 0.1-0.3 mg of baicalein and 1-5 g of chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, and after thorough drying, active silver particles are obtained.

[0016] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0017] All raw materials used in this invention are commercially available. The ε-polylysine salt, nisin, lysozyme, and nuclease can be industrial products with a mass percentage of not less than 90%. The nuclease should be an industrial product capable of acting on both RNA and DNA.

[0018] This invention adds ε-polylysine salt, which is a safe antimicrobial peptide for humans. It can effectively disrupt the structure of microbial cell membranes and strongly inhibit Gram-positive and Gram-negative bacteria, yeasts, molds, viruses and other microorganisms. It also has a synergistic effect with other ingredients, greatly improving the killing effect.

[0019] The disinfectant in this invention contains nisin, a polypeptide compound composed of amino acids and a natural antibacterial agent. It inhibits the growth and reproduction of most Gram-positive bacteria, and has a particularly strong antibacterial effect against spores produced by heat-resistant Bacillus and Clostridium botulinum. This further promotes the elimination of microorganisms.

[0020] The lysozyme added to the disinfectant in this invention is a non-toxic, harmless, and highly safe high-basic protein that selectively decomposes the cell walls of pathogenic microorganisms. It has a strong decomposing effect on Gram-positive bacteria, such as Bacillus subtilis and Micrococcus radiodurans. It also has a certain dissolving effect on Gram-negative bacteria such as Escherichia coli, Proteus vulgaris, and Vibrio parahaemolyticus, greatly improving the disinfection effect against microorganisms.

[0021] The addition of ε-polylysine salt, nisin, and lysozyme cannot completely eliminate pathogens, especially against residual viral genetic material. Furthermore, if the amounts of ε-polylysine salt, nisin, and lysozyme are small, their ability to break down cell walls and cell membranes is limited, and they cannot completely release DNA or RNA. Therefore, this invention adds nucleases and active silver nanoparticles, and uses baicalin to activate the silver nanoparticles. On the one hand, baicalin is a natural flavonoid compound with natural antibacterial properties. On the other hand, baicalin contains hydroxyl groups, which, under a suitable acidic pH (5-6) environment, can increase the adsorption force between silver particles, ε-polylysine salt, nisin, lysozyme, and other substances and cells. They are firmly adsorbed onto the cell membrane and break through the cell wall, entering the cell and causing cell proteins to coagulate, thus fully exerting their effects. At this time, the added nucleases, active silver nanoparticles, and nucleases work synergistically to rapidly hydrolyze the phosphodiester bonds in nucleotides after efficiently destroying the cell structure, acting on DNA or RNA to completely remove genetic material and fundamentally inhibit bacterial growth and reproduction.

[0022] Beneficial effects

[0023] 1. The addition of sterile water to the nucleic acid biological disinfectant of the present invention and the nuclease biological disinfectant of the present invention will not cause oxidation or corrosion of the surface of the object being disinfected, and will not produce toxic side effects on human skin and respiratory system.

[0024] 2. The nuclease biological disinfectant of the present invention has ε-polylysine salt, lactic acid streptococcus, lysozyme, nuclease, and nano silver ions as its main components. It has strong bactericidal specificity and good effect, high bactericidal stability, thorough and efficient bactericidal effect, mild action conditions, no irritation to skin and nasal mucosa, no water pollution, and no corrosiveness.

[0025] 3. The raw materials of the nuclease biological disinfectant of the present invention are readily available and low in cost; the preparation method is simple, and the nuclease biological disinfectant can be prepared by mixing various raw materials evenly; the application method is simple, and disinfection can be achieved by spraying or applying; it has good safety, will not damage the objects to be disinfected during use, is non-irritating, easy to operate, and easy to mass-produce. Attached Figure Description

[0026] Figure 1 The images show the results of the experiment to disinfect Agrobacterium GV3101, where (a) is a schematic diagram of the clarity of the sample in the centrifuge tube, and (b) is a diagram of the culture medium incubation effect.

[0027] Figure 2 The images show the results of the AK2 test for eliminating Escherichia coli, where (a) is a schematic diagram of the clarity of the sample in the centrifuge tube and (b) is a diagram of the results of the culture medium incubation.

[0028] Figure 3 The images show the results of the AchE1 test for eliminating Escherichia coli, where (a) is a schematic diagram of the clarity of the sample in the centrifuge tube and (b) is a diagram of the culture medium incubation effect.

[0029] Figure 4 The results of the MnSOD test for eliminating Escherichia coli are shown in the figure. (a) is a schematic diagram of the clarity of the sample in the centrifuge tube, and (b) is a diagram of the culture medium incubation effect.

[0030] Figure 5 A diagram illustrating the effect of disinfectant on the degradation of plasmid DNA in E. coli.

[0031] Figure 6 The diagrams show the degradation effects of plasmid DNA in Escherichia coli in Embodiment 5, Comparative Examples 5-8, and the blank control of this invention.

[0032] Figure 7 Graphs showing the degradation effect of plasmid DNA in E. coli at different time points. Detailed Implementation

[0033] The technical solution of the present invention will be further described below with reference to specific embodiments, but it is not limited thereto.

[0034] Example 1

[0035] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 9g of ε-polylysine salt, 90g of nisin, 9g of lysozyme, 0.9g of nuclease, 0.1g of adjuvant, 0.5g of active silver particles, with the remainder being sterile water.

[0036] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0037] Preferably, the preparation method of the active silver particles is as follows: 0.1 mg of baicalein and 1 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0038] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 15 min.

[0039] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0040] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0041] (2) Preparation of active silver nanoparticles: Add 0.1 mg baicalein and 1 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, obtain active silver particles after thorough drying.

[0042] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0043] All raw materials used in this embodiment are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of 90%.

[0044] Example 2

[0045] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 11g ε-polylysine salt, 110g nisin, 11g lysozyme, 1.1g nuclease, 0.2g adjuvant, 0.6g active silver particles, with the remainder being sterile water.

[0046] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0047] The preparation method of the active silver particles is as follows: 0.1 mg of baicalein and 2 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0048] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 15 min.

[0049] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0050] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0051] (2) Preparation of active silver nanoparticles: Add 0.1 mg baicalein and 2 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, and after thorough drying, active silver particles are obtained.

[0052] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0053] All raw materials used in this embodiment are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0054] Example 3

[0055] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 10g ε-polylysine salt, 100g nisin, 10g lysozyme, 1g nuclease, 0.2g adjuvant, 0.6g active silver particles, and the remainder being sterile water.

[0056] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0057] The preparation method of the active silver particles is as follows: 0.2 mg of baicalein and 2 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0058] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 20 min.

[0059] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0060] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0061] (2) Preparation of active silver nanoparticles: Add 0.2 mg baicalein and 2 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, obtain active silver particles after thorough drying.

[0062] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0063] All raw materials used in this embodiment are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0064] Example 4

[0065] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 15g ε-polylysine salt, 150g nisin, 15g lysozyme, 0.5g nuclease, 0.1g adjuvant, 0.5g active silver particles, with the remainder being sterile water.

[0066] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0067] The preparation method of the active silver particles is as follows: 0.3 mg of baicalein and 5 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH value of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0068] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 30 min.

[0069] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0070] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0071] (2) Preparation of active silver nanoparticles: Add 0.3 mg baicalein and 5 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, obtain active silver particles after thorough drying.

[0072] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0073] All raw materials used in this embodiment are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0074] Example 5

[0075] A nuclease nano-silver biological disinfectant, comprising the following components per 1000mL of disinfectant: 5g ε-polylysine salt, 50g nisin, 5g lysozyme, 1.5g nuclease, 0.3g adjuvant, 1g active silver particles, and the remainder being sterile water.

[0076] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0077] The preparation method of the active silver particles is as follows: 0.3 mg of baicalein and 5 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH value of the mixed solution is adjusted to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0078] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 30 min.

[0079] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0080] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0081] (2) Preparation of active silver nanoparticles: Add 0.3 mg baicalein and 5 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, obtain active silver particles after thorough drying.

[0082] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0083] All raw materials used in this embodiment are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0084] Comparative Example 1

[0085] A nuclease nano-silver biological disinfectant, comprising 9g of ε-polylysine salt, 90g of nisin, 9g of lysozyme, 0.1g of adjuvants, 0.5g of active silver particles, and the remainder being sterile water per 1000mL of disinfectant.

[0086] In this comparative example, except for the absence of nuclease, the raw materials and preparation methods are the same as in Example 1.

[0087] Comparative Example 2

[0088] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 11g of ε-polylysine salt, 110g of nisin, 11g of lysozyme, 0.2g of adjuvants, 0.6g of active silver particles, with the remainder being sterile water.

[0089] In this comparative example, except for the absence of nuclease, the raw materials and preparation methods are the same as in Example 2.

[0090] Comparative Example 3

[0091] A nuclease nano-silver biological disinfectant, comprising the following components per 1000mL of disinfectant: 10g of ε-polylysine salt, 100g of nisin, 10g of lysozyme, 0.2g of adjuvants, 0.6g of active silver particles, with the remainder being sterile water.

[0092] In this comparative example, except for the absence of nuclease, the raw materials and preparation methods are the same as in Example 3.

[0093] Comparative Example 4

[0094] A nuclease nano-silver biological disinfectant, comprising the following per 1000mL of disinfectant: 15g ε-polylysine salt, 150g nisin, 15g lysozyme, 0.1g adjuvant, 0.5g active silver particles, with the remainder being sterile water.

[0095] In this comparative example, except for the absence of nuclease, the raw materials and preparation methods are the same as in Example 4.

[0096] Comparative Example 5

[0097] A nuclease nano-silver biological disinfectant, each 1000mL of disinfectant solution includes: 5g of ε-polylysine salt, 50g of nisin, 5g of lysozyme, 0.3g of adjuvants, 1g of active silver particles, and the remainder is sterile water.

[0098] In this comparative example, except for the absence of nuclease, the raw materials and preparation methods are the same as in Example 5.

[0099] Comparative Example 6

[0100] A nuclease nano-silver biological disinfectant, comprising the following components per 1000mL of disinfectant: 5g ε-polylysine salt, 50g nisin, 5g lysozyme, 1.5g nuclease, 0.3g adjuvant, 1g active silver particles, and the remainder being sterile water.

[0101] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0102] The preparation method of the active silver particles is as follows: 5g of chitosan is added to 100mL of sterile water and stirred thoroughly. Then, 10mL of 0.01mol / L silver nitrate solution is added and stirred evenly. Then, 5mL of 0.005mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 5-6 with 0.5mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60min, the active silver particles are obtained after thorough drying.

[0103] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 30 min.

[0104] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0105] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0106] (2) Preparation of active silver nanoparticles: Add 5g of chitosan to 100mL of sterile water, stir thoroughly, then add 10mL of 0.01mol / L silver nitrate solution and stir evenly. Then slowly add 5mL of 0.005mol / L NaBH4 solution and adjust the pH of the mixed solution to 5-6 with 0.5mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60min, and after thorough drying, active silver particles are obtained.

[0107] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0108] All raw materials used in this comparative example are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0109] Except for the absence of baicalin in the preparation of the active silver particles, the raw materials and preparation methods in this comparative example are the same as in Example 5.

[0110] Comparative Example 7

[0111] A nuclease nano-silver biological disinfectant, comprising the following components per 1000mL of disinfectant: 5g ε-polylysine salt, 50g nisin, 5g lysozyme, 1.5g nuclease, 0.3g adjuvant, 1g active silver particles, and the remainder being sterile water.

[0112] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0113] The preparation method of the active silver particles is as follows: 0.3 mg of baicalein and 5 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 7-8 with 0.5 mol / L sodium hydroxide solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0114] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 30 min.

[0115] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0116] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0117] (2) Preparation of active silver nanoparticles: Add 0.3 mg baicalein and 5 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 7-8 with 0.5 mol / L sodium hydroxide solution under continuous shaking. After continuous shaking reaction for 60 min, and after thorough drying, active silver particles are obtained.

[0118] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0119] All raw materials used in this comparative example are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0120] Except for the pH adjustment to neutral or slightly alkaline in the preparation of active silver nanoparticles, the raw materials and preparation methods in this comparative example are the same as in Example 5.

[0121] Comparative Example 8

[0122] A nuclease nano-silver biological disinfectant, comprising the following components per 1000mL of disinfectant: 5g ε-polylysine salt, 50g nisin, 5g lysozyme, 1.5g nuclease, 0.3g adjuvant, 1g active silver particles, and the remainder being sterile water.

[0123] The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:1.

[0124] The preparation method of the active silver particles is as follows: 0.3 mg of baicalein and 5 g of chitosan are added to 100 mL of sterile water and stirred thoroughly. Then, 10 mL of 0.01 mol / L silver nitrate solution is added and stirred evenly. Then, 5 mL of 0.005 mol / L NaBH4 solution is slowly added and the pH of the mixed solution is adjusted to 3-4 with 0.5 mol / L hydrochloric acid solution under continuous shaking. The reaction is carried out under continuous shaking for 60 min. After thorough drying, active silver particles are obtained.

[0125] The sterile water is obtained by autoclaving distilled water at a pressure of 150 kPa, a temperature of 120°C, and a sterilization time of 30 min.

[0126] A method for preparing a nuclease-based silver nanoparticle disinfectant includes the following preparation steps:

[0127] (1) Sterilize the purchased or homemade distilled water by high pressure;

[0128] (2) Preparation of active silver nanoparticles: Add 0.3 mg baicalein and 5 g chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution and adjust the pH of the mixed solution to 3-4 with 0.5 mol / L hydrochloric acid solution under continuous shaking. After continuous shaking reaction for 60 min, and after thorough drying, active silver particles are obtained.

[0129] (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease silver nanoparticle biological disinfectant.

[0130] All raw materials used in this comparative example are commercially available. The raw materials such as ε-polylysine salt, nisin, lysozyme, and nuclease are industrial products with a mass percentage of not less than 90%.

[0131] Except for the pH adjustment to 3-4 in the preparation of active silver nanoparticles, the raw materials and preparation methods in this comparative example are the same as in Example 5.

[0132] Antibacterial efficacy test

[0133] 1. Antibacterial test of Agrobacterium GV3101

[0134] Take three 1.5ml centrifuge tubes, add 900 μL of diluted Agrobacterium GV3101 (containing tomato yellow leaf curl virus) to each tube, then add 100 μL of sterile water to tube 1, 100 μL of Comparative Example 1 disinfectant to tube 2, and 100 μL of Example 1 disinfectant to tube 3. Incubate in a 37℃ shaking incubator for 18–24 h and observe bacterial growth. The results showed that tube 1 was turbid, tube 2 was clear, and tube 3 was clear. Figure 1 As shown in (a); then the samples from the three centrifuge tubes were inoculated into culture media and incubated in a 37℃ incubator for 18–24 h to observe bacterial growth; the results showed that Agrobacterium GV3101 grew in culture medium 1, but not in culture medium 2 or 3. Figure 1As shown in (b); then, the samples from centrifuge tubes 1, 2, and 3 were injected into the leaves of the cultured tomato seedlings. Each sample from the three centrifuge tubes was injected into different leaves of the same tomato plant, with 5-10 leaves per sample. The phenomena were observed. The results showed that the tomato leaves injected into centrifuge tubes 1 and 2 turned yellow at the leaf tips and curled at the leaf edges, while the tomato leaves injected into centrifuge tube 3 showed no change. This indicates that although the disinfectant in Comparative Example 1 killed Agrobacterium GV3101, it did not kill the tomato yellow leaf curl virus. In contrast, the disinfectant in Example 1 not only killed Agrobacterium GV3101 but also destroyed the single-stranded circular DNA structure of the tomato yellow leaf curl virus.

[0135] This demonstrates that the disinfectant in this embodiment of the invention can completely eliminate tomato yellow leaf curl virus and its genetic material, achieving a fundamental bactericidal effect.

[0136] Note: The subsequent PCR amplification experiments in this invention all used primers synthesized by Shanghai Sangon Biotech.

[0137] MnSOD-R: GGCTGCTACTGTTGCTGTCC

[0138] MnSOD-F: AGCGTTCGTCCACATTCTTC

[0139] AK2-R: CAAGGTTCCGTTTGGCAGAG

[0140] AK2-F: GGCTTCGTATTCGCTCATTCC

[0141] AChE1-R:TCAGAGGCGTTCAGGTTGTG

[0142] AChE1-F:GATTGCCGATGGGTGGTTC

[0143] 16S rDNA primers

[0144] 1492R: TACGGCTACCTTGTTACGACTT

[0145] 27F: AGAGTTTGATCCTGGCTCAG

[0146] I. Methods for treating bacterial suspension

[0147] Transfer 500 μl of bacterial culture into a 1.5 ml centrifuge tube and heat to boiling for 10 minutes.

[0148] II. PCR reaction system:

[0149]

[0150] III. PCR Reaction Procedure

[0151]

[0152] IV. Detection Methods

[0153] The samples were analyzed using 1% agarose gel electrophoresis with a 5kb marker.

[0154] 2. Antibacterial test of Escherichia coli containing AK2 plasmid

[0155] Take three 1.5ml centrifuge tubes, add 900 μL of diluted E. coli containing AK2 plasmid to each tube, then add 100 μL of sterile water to tube 1, 100 μL of disinfectant from Comparative Example 2 to tube 2, and 100 μL of disinfectant from Example 2 to tube 3. Incubate in a 37°C shaking incubator for 18–24 hours and observe bacterial growth. The results showed that tube 1 was turbid, tube 2 was clear, and tube 3 was clear. Figure 2 As shown in (a). Then, the samples from the three centrifuge tubes were inoculated into culture medium and incubated in a 37°C incubator for 18-24 hours. Bacterial growth was observed, as shown in (a). Figure 2 (b) shows that E. coli containing the AK2 plasmid grew in culture medium 1, but E. coli containing the AK2 plasmid did not grow in culture medium 2, and E. coli containing the AK2 plasmid did not grow in culture medium 3. Then, PCR amplification experiments were performed on the samples from centrifuge tubes 1, 2, and 3. The amplification results were analyzed by agarose electrophoresis and the results were observed by gel imaging. Figure 5 The results showed that DNA amplification occurred in centrifuge tubes 1 and 2, but not in centrifuge tube 3, indicating that the AK2 plasmid in centrifuge tube 3 was hydrolyzed by nuclease.

[0156] This demonstrates that the disinfectant in this embodiment of the invention can completely eliminate Escherichia coli containing the AK2 plasmid and its genetic material, achieving a fundamental bactericidal effect.

[0157] 3. Antibacterial test of Escherichia coli containing AchE1

[0158] Take three 1.5ml centrifuge tubes, add 900 μL of diluted E. coli containing AchE1 to each tube, then add 100 μL of sterile water to tube 1, 100 μL of Comparative Example 3 disinfectant to tube 2, and 100 μL of Example 3 disinfectant to tube 3. Incubate in a 37°C shaking incubator for 18–24 hours and observe bacterial growth.

[0159] The results showed that centrifuge tube 1 was turbid, centrifuge tube 2 was clear, and centrifuge tube 3 was clear. Figure 3As shown in (a); then the samples from the three centrifuge tubes were inoculated into culture media and incubated in a 37℃ incubator for 18–24 h to observe bacterial growth; the results showed that E. coli containing AchE1 grew in culture medium 1, but no E. coli containing AchE1 grew in culture medium 2, and no E. coli containing AchE1 grew in culture medium 3. Figure 3 (b) shows the results; then, the samples from centrifuge tubes 1, 2, and 3 were subjected to PCR amplification experiments, and the amplification results were analyzed by agarose electrophoresis and observed by gel imaging. Figure 5 The results showed that DNA amplification occurred in centrifuge tubes 1 and 2, but not in centrifuge tube 3, indicating that AchE1 in centrifuge tube 3 was hydrolyzed by nuclease.

[0160] This demonstrates that the disinfectant in this embodiment of the invention can completely eliminate Escherichia coli containing AchE1 and its genetic material, achieving a fundamental bactericidal effect.

[0161] 4. Antibacterial test of Escherichia coli containing the MnSOD gene

[0162] Take three 1.5ml centrifuge tubes, add 900 μL of diluted E. coli containing the MnSOD gene to each tube, then add 100 μL of sterile water to tube 1, 100 μL of Comparative Example 4 disinfectant to tube 2, and 100 μL of Example 4 disinfectant to tube 3. Incubate in a 37°C shaking incubator for 18–24 hours and observe bacterial growth.

[0163] The results showed that centrifuge tube 1 was turbid, centrifuge tube 2 was clear, and centrifuge tube 3 was clear. Figure 4 As shown in (a); then the samples from the three centrifuge tubes were inoculated into culture media and incubated in a 37℃ incubator for 18–24 h to observe bacterial growth; the results showed that E. coli containing the MnSOD gene grew in culture medium 1, but no E. coli containing the MnSOD gene grew in culture medium 2, and no E. coli containing the MnSOD gene grew in culture medium 3. Figure 4 (b) shows the results; then, the samples from centrifuge tubes 1, 2, and 3 were subjected to PCR amplification experiments, and the amplification results were analyzed by agarose electrophoresis and observed by gel imaging. Figure 5 The results showed that DNA amplification occurred in centrifuge tubes 1 and 2, but not in centrifuge tube 3, indicating that MnSOD in centrifuge tube 3 was hydrolyzed by nuclease.

[0164] This demonstrates that the disinfectant in this embodiment of the invention can completely eliminate Escherichia coli containing the MnSOD gene and its genetic material, achieving a fundamental bactericidal effect.

[0165] Figure 5 The figures show the degradation effect of disinfectants in Escherichia coli by disinfectants in Examples 2-4 and Comparative Examples 2-4 of the present invention. As can be seen from the figures, the disinfectants of the present invention have a good decomposition effect on plasmid DNA in Escherichia coli.

[0166] Meanwhile, comparative experiments were conducted on the disinfectants obtained in Comparative Examples 5-8 to verify their effectiveness in decomposing genetic material:

[0167] Take six 1.5ml centrifuge tubes and add 900 μL of diluted E. coli containing the MnSOD gene to each tube. Then, add 100 μL of sterile water to tube 1, 100 μL of Comparative Example 5 disinfectant to tube 2, 100 μL of Example 5 disinfectant to tube 3, 100 μL of Comparative Example 6 disinfectant to tube 4, 100 μL of Comparative Example 7 disinfectant to tube 5, and 100 μL of Comparative Example 8 disinfectant to tube 6. Incubate all tubes together in a 37°C shaking incubator for 18–24 h. Then, inoculate the samples from three of the centrifuge tubes into culture medium and incubate them in a 37°C incubator for 18–24 h. Perform PCR amplification experiments on the samples from tubes 1–7, analyze the amplification results using agarose gel electrophoresis, and observe the results using gel imaging. The results are as follows. Figure 6 As shown, the disinfectant in the embodiments of the present invention can achieve complete decomposition of viral genetic material. However, comparative examples 5-8, which changed the composition of the disinfectant and the preparation method and parameters of the active silver particles, have a weaker ability to decompose genetic material than the embodiments of the present invention. This demonstrates the synergistic effect between the raw materials of the present invention, which can achieve thorough elimination of pathogenic genetic material.

[0168] 5. Effects of different time periods on the degradation of plasmid DNA in E. coli

[0169] Take 15 1.5ml centrifuge tubes, add 900 μL of diluted E. coli containing AK2 plasmid to each centrifuge tube, then add 100 μL of sterile water to centrifuge tube 1, 100 μL of Comparative Example 5 disinfectant to centrifuge tube 2, and 100 μL of Example 5 disinfectant to centrifuge tube 3. After the samples and bacterial solutions have reacted for 1 min, inoculate the samples from centrifuge tubes 1, 2, and 3 onto culture medium and incubate them in a 37℃ incubator for 18–24 h to observe bacterial growth. At the same time, perform PCR amplification experiments on the samples from centrifuge tubes 1, 2, and 3, analyze the amplification results using agarose gel electrophoresis, and observe the results using gel imaging. Add 100 μL of LB disinfectant to centrifuge tube 4, 100 μL of Comparative Example 5 disinfectant to tube 5, and 100 μL of Example 5 disinfectant to tube 6. After 5 minutes of contact between the sample and bacterial culture, inoculate the samples from centrifuge tubes 4, 5, and 6 onto culture medium and incubate at 37°C for 18–24 hours to observe bacterial growth. Simultaneously, perform PCR amplification experiments on the samples from centrifuge tubes 4, 5, and 6, analyze the amplification results using agarose gel electrophoresis, and observe the results using gel imaging. Repeat the above procedure at 10 minutes (tubes 7–9), 30 minutes (tubes 10–12), and 60 minutes (tubes 13–15).

[0170] Experiments showed that after 10 minutes of interaction between the disinfectant in Comparative Example 5 and the bacterial solution, no *E. coli* containing the AK2 plasmid grew in the culture medium, achieving a good bactericidal effect with a rapid onset of action. In Example 5, after 10 minutes of interaction between the disinfectant and the bacterial solution, not only did no *E. coli* containing the AK2 plasmid grow in the culture medium, but PCR experiments also showed that the disinfectant in Example 5 hydrolyzed the AK2 plasmid. Figure 7 As shown.

[0171] 6. Sterilization test

[0172] The killing tests for Staphylococcus aureus CICC 10201 and Escherichia coli DH10B were conducted. The bacterial strains were at the 3rd to 8th generation, and bacterial suspensions were prepared with 0.03 mol / L PBS. The experimental and counting protocols were based on the "Laboratory Test Methods for the Bactericidal Efficacy of Disinfectants" (GB / T 38502—2020), specifically sections 5.2 Neutralizing Agent Identification Test and 5.6 Bactericidal Test.

[0173] Preparation of bacterial suspension for testing:

[0174] Open the inoculum tube aseptically, add an appropriate amount of nutrient broth using a capillary pipette, and aspirate several times to dissolve and disperse the inoculum. Take a test tube containing 5.0 mL-10.0 mL of nutrient broth, add a small amount of inoculum suspension, and incubate at 36℃ ± 1℃. Take fresh slant cultures from generations 3 to 8, cultured on nutrient agar for 18-24 hours, and add 3.0 mL-5.0 mL of diluent to the test tube using a 5.0 mL pipette, aspirating repeatedly to wash off the bacterial growth. Then, transfer the washings to another sterile test tube using a 5.0 mL pipette, mix with an electric mixer for 20 seconds, or shake on the palm of your hand 80 times to ensure the bacteria are evenly suspended.

[0175] Inactivation performance test: Following the quantitative suspension sterilization test, the disinfectant concentrate and water were mixed at a mass ratio of 1:4 to prepare the test solution. The contact time was 5-15 minutes, and the test was repeated 3 times. The test environment was 23.2℃ and 50% relative humidity. The results are shown in Tables 1-2.

[0176] Table 1 Results of Staphylococcus aureus eradication

[0177]

[0178]

[0179] Table 2 Results of Escherichia coli eradication

[0180]

[0181] Stability test:

[0182] The disinfectant of this invention has a strong killing effect on various pathogenic microorganisms such as Staphylococcus aureus and Escherichia coli. Efficacy tests show that, after 2 minutes of action, the kill rates against Staphylococcus aureus and Escherichia coli can reach 99.30% and 99.96%, respectively. When the nuclease biological disinfectant prepared in embodiments 1-5 was used in groups of three (100 mL each) and left at room temperature for 15 days, the killing effect on Staphylococcus aureus and Escherichia coli was the same, and the disinfectant showed good stability.

[0183] It should be noted that the above embodiments are merely some preferred embodiments of the present invention, and not all embodiments. Obviously, based on the above embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

Claims

1. A method for preparing a nuclease-based silver nanoparticle biological disinfectant, characterized in that, The preparation steps include the following: (1) Sterile water is obtained by autoclaving purchased or homemade distilled water; (2) Preparation of active silver nanoparticles: Add 0.1-0.3 mg of baicalein and 1-5 g of chitosan to 100 mL of sterile water, stir thoroughly, then add 10 mL of 0.01 mol / L silver nitrate solution and stir evenly. Then slowly add 5 mL of 0.005 mol / L NaBH4 solution. Under continuous shaking, adjust the pH of the mixed solution to 5-6 with 0.5 mol / L hydrochloric acid solution. Continue shaking for 60 min. After thorough drying, active silver nanoparticles are obtained. (3) Active silver nanoparticles, ε-polylysine salt, nisin, lysozyme, nuclease, and adjuvants are sequentially dispersed in sterile water and ultrasonically dispersed evenly to obtain the nuclease-nano silver biological disinfectant; wherein, each 1000 mL of the disinfectant comprises: 5-15 g of ε-polylysine salt, 50-150 g of nisin, 5-15 g of lysozyme, 0.5-1.5 g of nuclease, 0.1-0.3 g of adjuvants, 0.5-1 g of active silver nanoparticles, and the remainder is sterile water; The adjuvant is a mixture of calcium propionate and cocamidopropyl betaine in a mass ratio of 1:

1.

2. The method for preparing the nuclease nano-silver biological disinfectant according to claim 1, characterized in that, Each 1000 mL of the disinfectant comprises: 9-11 g of ε-polylysine salt, 90-110 g of nisin, 9-11 g of lysozyme, 0.9-1.1 g of nuclease, 0.1-0.2 g of adjuvants, 0.9-1 g of active nano-silver particles, and the remainder being sterile water.

3. The method for preparing the nuclease nano-silver biological disinfectant according to claim 1, characterized in that, The high-pressure sterilization conditions are: pressure 150 kPa, temperature 120℃, and sterilization time 15-30 min.

Images