Application of soybean cryptochrome CRY1 gene in promoting potato plant dwarf and / or increasing potato tuber number

Abstract

The application belongs to the technical field of plant genetic engineering, and relates to application of a soybean cryptochrome CRY1 gene in promoting dwarfing of potato plants and / or increasing the number of potato tubers. The application provides application of a soybean cryptochrome CRY1 gene or a CRY1 protein or a recombinant vector, an expression cassette or a recombinant bacterium containing the CRY1 gene in promoting dwarfing of potato plants and / or increasing the number of potato tubers. The soybean cryptochrome genes GmCRY1a and GmCRY1b have important functions in promoting dwarfing of potato plants and / or increasing the number of potato tubers, and have important application values in potato production.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the soybean cryptochrome CRY1 gene in promoting potato plant dwarfing and / or increasing potato tuber quantity. Background Technology

[0002] Cryptochrome is a photoreceptor that is widely found in plants, animals, and all higher eukaryotes, and is sensitive to blue light and near-ultraviolet light (330-390nm). CRY1 and CRY2, as major members of the plant cryptochrome family, regulate downstream transcription factors (including HY5, HFR1, and CO) in a BL-dependent manner by inhibiting the activity of the E3 ubiquitin ligase COP1. They are widely involved in regulating numerous physiological processes such as photomorphogenesis, photoperiod regulation of flowering, diurnal rhythms, stomatal opening, and development (Ahmad M., and Cashmore, AR (1993). HY4 gene of Athaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature, 366, 162-166. Lin, C., and Todo, T. (2005). The cryptochromes. Genome Biol, 6, 220. Liu, HT, Liu, B., Zhao, CX, Pepper, M, and Lin, CT (2011b). The action mechanisms of plant cryptochromes. Trends Plant Sci, 16, 684-691. Wang, Q., and Lin, C. (2020). Mechanisms of cryptochrome-mediated photoresponses in plants. Annual Review of Plant Biology, 71, 103-129. Keller, MM, Jaillais, Y., Pedmale, UV, Moreno, JE, Chory, J., and Ballaré, CL (2011). Cryptochrome 1 and phytochrome B control shade-avoidance responses in Arabidopsis via partially independent hormonal cascades. The Plant Journal, 67(2), 195-207. However, the regulatory role of the soybean cryptochrome CRY1 gene in potato has not yet been reported. Summary of the Invention

[0003] The purpose of this invention is to provide the application of the soybean cryptochrome CRY1 gene in promoting dwarfing of potato plants and / or increasing the number of potato tubers. The soybean cryptochrome genes GmCRY1a and GmCRY1b play important roles in promoting dwarfing of potato plants and / or increasing the number of potato tubers, and have significant application value in potato production.

[0004] This invention provides the application of the soybean cryptochrome CRY1 gene or CRY1 protein or a recombinant vector, expression cassette or recombinant bacteria containing the CRY1 gene in increasing the number of tubers in potatoes.

[0005] This invention also provides the application of overexpression of the soybean cryptochrome CRY1 gene or CRY1 protein in increasing the number of tubers in potatoes.

[0006] Preferably, the soybean cryptochrome CRY1 gene includes the GmCRY1a gene and / or the GmCRY1b gene.

[0007] Preferably, the nucleotide sequence of the GmCRY1a gene is shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence of the GmCRY1b gene is shown in SEQ ID NO.2.

[0009] This invention provides the application of the soybean cryptochrome CRY1 gene in promoting dwarfing of potato plants and / or increasing the number of tubers. Using genetic engineering technology, two homologous genes of the soybean cryptochrome gene CRY1 were separately transferred into potatoes, resulting in positive lines. Morphological and agronomical trait identification of the first-generation clonal transgenic lines revealed that they exhibited significantly shorter plant height and darker green leaves compared to the control, along with a significantly increased number of tubers per plant. These results demonstrate that the soybean cryptochrome genes GmCRY1a and GmCRY1b play a crucial role in promoting dwarfing of potato plants and / or increasing the number of tubers, and have significant application value in potato production. Attached Figure Description

[0010] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0011] Figure 1 A diagram illustrating the transformation process of the potato transgenic line provided by this invention;

[0012] Figure 2This is a diagram showing the PCR amplification results of the target genes in some transgenic lines provided by this invention;

[0013] Figure 3 The diagram shows the growth and tuber formation of the first generation of transgenic lines under long-day conditions provided by this invention.

[0014] Figure 4 The figure shows the comparison results of plant height, yield per plant, and number of tubers per plant of the transgenic asexual generation under long-day conditions provided by this invention. Detailed Implementation

[0015] This invention provides the application of the soybean cryptochrome CRY1 gene or CRY1 protein, or a recombinant vector, expression cassette, or recombinant bacteria containing the CRY1 gene, in promoting potato plant dwarfing and / or increasing potato tuber quantity. In this invention, the soybean cryptochrome CRY1 gene preferably includes the GmCRY1a gene and / or the GmCRY1b gene. In this invention, the nucleotide sequence of the GmCRY1a gene is preferably as shown in SEQ ID NO.1: ATGTCAGGTGGTGGAGGCAGCATAGTGTGGTTCAGAAGAGATCTGAGGATAGAAGACAATCCAGCACTGACAGCAGGAGTGAGAGCTGGTGCTGTGGTTGCAGTTTTCGTATGGGCACCTGAAGAAGAAGGTCAATACTACCCTGGCAGGGTCTCTAGATGGTGGCTCAAGAACAGTTTGGCTCATCTTCATTCCTCTCTG

[0016] AGGAATCTTGGCACTCCTCTCATCACTAAGCGATCCACTGACACTCTTTCTT

[0017] CTCTTCTTGAGGTTGTTAAGTCCACTGGAGCCACTCAACTTTTTTTTAATCA

[0018] TTTGTATGATCCCCTGTCACTTGTCAGGGATCACCGAGCAAAGGAGGTTCT

[0019] GACTGCTCAGGGCATAACAGTACGTTCCTTCAATGCGGATTTATTATATGAA

[0020] CCATGGGAAGTGAATGATGCACATGGCCGACCATTCACAACTTTTGCTGCT

[0021] TTTTGGGAAAGATGCCTTAGCATGCCTTATGACCCTGAGTCACCTCTTCTCC

[0022] CACCTAAAAGGATAATTCCAGGTGATGCATCCAGGTGTCCTAGTGATACATT

[0023] GCTGTTTGAAGATGAATTAGAGAAGGCAAGCAATGCACTTCTTGCTCGAG

[0024] CATGGTCACCTGGGTGGAGCAATGCTAACAAGGCATTGACAACCTTCATAA

[0025] ATGGTCCACTGATTGAGTACTCAAAAAACCGCAGGAAAGCAGACAGTGCA

[0026] ACTACCTCACTTCTGTCCCCCCATTTGCACTTTGGTGAGTTGAGTGTTAAG

[0027] AAGGTCTTCCATCTTGTCCGCATCAAACAAGTTTTGTGGGCCAACGAAGG

[0028] AAACAAAGCCGGCGAAGAGAGCGTGAACTTGTTCCTCAAATCTATAGGTC

[0029] TTAGAGAATATTCAAGGTACATTAGTTTCAACCACCCCTACAGTCATGAAA

[0030] GGCCTCTTCTAGGCCACCTTAAGTTCTTTCCTTGGGTTGTAAACGAAGGCT

[0031] ATTTTAAGGCATGGAGACAAGGCAGGACTGGGTACCCTTTAGTGGATGCTG

[0032] GGATGAGGGAGTTGTGGGCCACTGGTTGGCTGCATGATCGAATACGTGTTG

[0033] TAGTTTCCAGTTTCTTTGTGAAGGTTCTGCAGCTTCCATGGAGATGGGGAA

[0034] TGAAATATTTCTGGGACACCCTTTTGGATGCAGATCTTGAGAGTGATGCTCT

[0035] TGGTTGGCAGTACATATCTGGTAGTCTCCCTGATGGTCGTGAAATTGACCG

[0036] AATAGATAATCCACAGTTTGAGGGATACAAATTCGACCCTAATGGAGAATAT

[0037] GTGCGACGCTGGCTTCCAGAACTTGCAAGATTACCAACCGAGTGGATACAT

[0038] CATCCTTGGAATGCACCAGAGTCAGTGCTACAAGCTGCTGGAATTGAGTTA

[0039] GGATCGAACTATCCTCTTCCAATTGTGGGAATAGATGCAGCAAAAACCAGA

[0040] TTACTAGAAGCGCTATCAGAAATGTGGCAACAAGAGGCAGCTTCAAGAGC

[0041] TGCAATGGAGAATGGAACTGAGGAAGGACTTGGAGACTCTTCTGAATCCG

[0042] TTCCTGCTGCTTTTCCTCAAGACATGCAAATGGAGGAAACTCATGAGCCTG

[0043] TTAGGAACAATCCCCTTCCTGTTGCTCGGCGCTACCAGGATCAGATGGTTC

[0044] CAAGCATCACTTCTTCCTTGTTGAGAGTGGAAGAGGAAGAAACTTCTTCT

[0045] GATCTTCGACACTCGGCAGAAGAGAGCAGCAGAGCTGAAGTGCCAGTAA

[0046] CTGCAAATGCACAACAAAATGTAGGAGTTACATTGAATGAACGGATGCTGC

[0047] AGACCACTAATAGGAATGCACAAACACAATACAATACTACAATGGAGCTGA

[0048] GAAATGTAGCTGAAGATTCAGCAGTAGAATCTTCAAGTGGTACCAGGAGA

[0049] GAAAGGGATGGAGGTGTAGTTCCAGTATGGTCTCCCCCCAGCTTCTAGTTAC

[0050] TCAGAACAATTTGTAGGAGAGGAAATGGTATAACAAACAGTTCATCTTTC

[0051]

[0052] This invention also provides the application of overexpression of the soybean cryptochrome CRY1 gene or CRY1 protein in promoting dwarfing of potato plants and / or increasing the number of potato tubers. In this invention, the soybean cryptochrome CRY1 gene includes the GmCRY1a gene and / or the GmCRY1b gene. In this invention, the nucleotide sequence of the GmCRY1a gene is shown in SEQ ID NO. 1. In this invention, the nucleotide sequence of the GmCRY1b gene is shown in SEQ ID NO. 2. This invention preferably promotes dwarfing of potato plants and / or increases the number of potato tubers by overexpressing the soybean cryptochrome CRY1 gene in potatoes. This invention does not specifically limit the overexpression method; any conventional gene overexpression method in plants known to those skilled in the art can be used. Specifically, the present invention preferably amplifies the soybean cryptochrome CRY1 gene, constructs the gene into the plant expression vector pEarleyGate104, and then transforms the recombinant expression vector into Agrobacterium, and transforms it into potatoes using Agrobacterium-mediated transformation to promote potato plant dwarfing and / or increase the number of potato tubers.

[0053] To further illustrate the present invention, the application of the soybean cryptochrome CRY1 gene provided by the present invention in promoting potato plant dwarfing and / or increasing potato tuber quantity is described in detail below with reference to the accompanying drawings and embodiments, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] 1. Materials and Methods

[0056] 1.1 Plant receptors

[0057] This experiment used the potato cultivar Atlantic (Solanumtuberosum L.cv.Atlantic) as the recipient material and induced sterile test tube potatoes as explants for genetic transformation.

[0058] 1.2 Vectors and Gene Sequences

[0059] The Agrobacterium strain GV3101 was stored in glycerol at -80℃ for plant transgenic operations. Soybean cryptochrome-related genes and plant expression vectors are shown in Table 1. The pearlygate104 vector was purchased. The plant expression vectors shown in Table 1 were obtained by constructing the genes Cry1aGlyma.04G101500 and Cry1bGlyma.06G103200 into pearlygate104 using conventional expression vector construction methods. Both vectors carry herbicide resistance (Bar) selective marker genes. The plasmids were stored at -20℃.

[0060] Table 1. Genes and expression vectors related to soybean cryptochrome.

[0061]

[0062] 1.3 Preparation of engineered bacterial culture

[0063] Single colonies (GV3101) carrying the target gene plasmid were selected and cultured in LB liquid medium containing 50 mg / L Kan with shaking at 180 rpm, and then incubated in the dark at 28°C until OD. 595 Centrifuge at 3500 r / min for 10 min with a pH of 0.6–0.8, discard the supernatant, and resuspend in 1–2 volumes of LB liquid culture medium for later use.

[0064] 1.4 Potato genetic transformation

[0065] Referring to the previously established efficient genetic transformation system for potatoes (Zhang Li, Cheng Yongfang, Gong Lei, Gan Xiaoyan, Nie Fengjie, Chen Yuchao, Shi Lei, Zhang Guohui, Li Miao, Jie Ruixia, Song Yuxia. (2016). Study on Agrobacterium-mediated transformation of potato with HaBADH gene. Molecular Plant Breeding. 14(06), 1462-1469).

[0066] 1.5 PCR identification of resistant plants

[0067] Genomic DNA was extracted from resistant and untransformed plants using the CTAB method, with plasmids 1500 and 3200 serving as positive controls and total DNA from untransformed potatoes as a negative control. Based on the target gene sequence, upstream and downstream primers for both the vector and the gene were designed (Table 2), and PCR amplification was performed on the DNA samples. The PCR reaction mixture consisted of 12.5 μl of 10×Taq Reaction Mix, 1 μl each of upstream and downstream primers, 1 μl of template DNA, and ddH2O to a final volume of 25 μl. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, annealing at 52℃–53℃ for 30 sec (3200:52℃; 1500:53℃), extension at 72℃ for 1 min, repeated 35 times; and annealing at 72℃ for 10 min. The amplified products were detected by agarose gel electrophoresis.

[0068] Table 2 Primer sequence list

[0069]

[0070] 2 Results and Analysis

[0071] 2.1 Genetic transformation of potatoes

[0072] like Figure 1As shown, explants infected with Agrobacterium tumefaciens were co-cultured for 48 hours, then washed with sterile water containing CEF (500 mg / L) and transferred to a medium containing 500 mg / L CEF for selection. After 10 days, the surface of the potato chips began to turn green, and sprouting began on the surface of the chips after about 14 days. After about 10 more days of growth, resistant plants were formed. These resistant plants were then transferred to a rooting medium (1 / 2 MS + 0.05 mg / L NAA) containing 0.5 mg / L glufosinate and 500 mg / L CEF. When the plants grew to 5–7 leaves, leaves were cut, and DNA was extracted for PCR identification.

[0073] Figure 1 This diagram illustrates the transformation process of transgenic potato lines. 1: Aseptic test-tube potato; 2: Co-culture; 3: Resistant shoots differentiated from potato chips; 4: Resistant plantlets.

[0074] 2.2 Molecular identification of transformed plants

[0075] DNA was extracted from the transformed plants, and primers were designed based on the target gene sequence for PCR amplification. The results are as follows: Figure 2 As shown, both GmCRY1a and GmCRY1b amplified the target gene fragments. This indicates that the two soybean cryptochrome genes have been integrated into the potato genome.

[0076] Figure 2 The image shows the PCR amplification results of the target gene in some transgenic lines. In the image, A:M represents the DL2000 marker, 1 is the positive control (carrying the target gene plasmid), 2 is the negative control (non-transgenic plant); 3-9 are some GmCRY1a gene overexpression positive lines.

[0077] B: M is the DL2000 marker, 1-5 are some GmCRY1b gene overexpression positive lines, 6 is the negative control (non-transgenic plant), and 7 is the positive control (carrying the target gene plasmid).

[0078] 2.3 Functional analysis of transformed plants

[0079] Studies have shown that transgenic lines incorporating the GmCRY1a and GmCRY1b genes exhibit significantly shorter plant height and darker leaf color compared to the control group (Atlantic strains) without the target gene, and a significantly increased number of tubers per plant. Figure 3 , Figure 4 The above results demonstrate that the soybean cryptochrome genes GmCRY1a and GmCRY1b play important roles in genetically improving potato plant architecture and increasing potato tuber quantity, providing important genetic resources for creating new germplasm suitable for high-density planting.

[0080] Figure 3The figure shows the growth and tuber formation of the first generation of transgenic lines under long-day conditions. In the figure, A and B represent the phenotypes of the GmCRY1a and GmCRY1b overexpression lines, respectively; C and D represent the tuber formation of individual plants of the GmCRY1a and GmCRY1b overexpression lines, respectively.

[0081] Figure 4 The figure shows the comparison results of plant height (A), yield per plant (B), and number of tubers per plant (C) of transgenic asexual generation under long-day conditions. In the figure, lowercase letters indicate significant differences (p<0.05).

[0082] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Overexpression of soybean cryptochrome CRY1 The application of genes in increasing potato tuber yield is characterized by, The soybean cryptochrome CRY1 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2.

Images