Application of Sclerotinia homeocarpa DT-8 in rice yield increase

Abstract

The application belongs to the technical field of crop cultivation, and particularly relates to application of a Sclerotinia sclerotiorum attenuated strain DT-8 in rice yield increase. The Sclerotinia sclerotiorum attenuated strain DT-8 can significantly and stably increase the rice yield. Meanwhile, the Sclerotinia sclerotiorum attenuated strain DT-8 carries a weak-toxin related DNA virus SsHADV-1, has no pathogenicity to crops, is safer, and can be widely used in production. Meanwhile, the Sclerotinia sclerotiorum attenuated strain DT-8 is applied in rice yield increase, is simple to apply, has low cost, and has good effect.

Description

Technical Field

[0001] This invention belongs to the field of crop cultivation technology, specifically relating to the application of attenuated DT-8 strain of Sclerotinia sclerotiorum in increasing rice yield. Background Technology

[0002] Rice is a vital food crop, providing the main source of food and nutrition for over 50% of the world's population. Therefore, safe rice production is of great significance to ensuring global food security. The development of dwarf and semi-dwarf varieties, the utilization of hybrid vigor, and the promotion of modern cultivation techniques have greatly improved rice production levels. However, it is predicted that by 2025, rice production will still need to increase by approximately 60% to meet the demands of the growing global population. Given the decreasing availability of arable land and the increasing scarcity of freshwater and other environmental resources, the stable development of rice production must rely on science and technology. This involves both tapping into the potential of rice and developing more rational cultivation techniques. Utilizing beneficial biological resources to promote healthy rice growth and increase yield is a green and environmentally friendly approach.

[0003] Microbial fertilizers are a class of microbial preparations made through the artificial cultivation of beneficial microorganisms for plants. Their function is to utilize the life activities of specific microorganisms to promote the transformation of substances in the soil, improve crop nutrition, and stimulate or adjust plant growth, thereby increasing yield. In recent years, microbial inoculants have become increasingly popular in the market due to their ability to improve soil physical and chemical properties and increase the yield and quality of agricultural products. However, their market promotion has been hampered by slow results and inconsistent product quality. Therefore, providing a highly efficient and stable microbial preparation for increasing rice yield is particularly important for achieving more stable and effective results. Summary of the Invention

[0004] The purpose of this invention is to provide the application of attenuated DT-8 strain of Sclerotinia sclerotiorum in increasing rice yield. The attenuated DT-8 strain of Sclerotinia sclerotiorum described in this invention can significantly increase rice yield, and has high stability, low cost, and good effect.

[0005] This invention provides the application of attenuated DT-8 strain of Sclerotinia sclerotiorum in increasing rice yield. The preservation number of the attenuated DT-8 strain of Sclerotinia sclerotiorum is: CCTCC M 2019328.

[0006] Preferably, the viable count of the attenuated DT-8 strain of *Sclerotinia sclerotiorum* is at least 1.4 × 10⁻⁶. 5 cfu / mL.

[0007] Preferably, the attenuated viral strain DT-8 of Sclerotinia sclerotiorum exists in the form of an aqueous suspension.

[0008] The method for preparing the aqueous suspension includes: expanding and fermenting the attenuated strain DT-8 of Sclerotinia sclerotiorum to obtain a Sclerotinia sclerotiorum fermentation broth;

[0009] The Sclerotium sclerotiorum fermentation broth was mixed with a protectant and a preservative to obtain the aqueous suspension.

[0010] Preferably, the culture medium for the expanded culture includes PDB medium, the temperature is 18-22°C, and the time is 3.5-4.5 days;

[0011] The expansion culture is a shaking culture, and the shaking rotation speed is 100-200 rpm.

[0012] Preferably, the fermentation medium for fermentation culture comprises the following components: 80-120g of yeast extract, 150-250g of peptone and 150-200g of glucose per 30L of fermentation medium.

[0013] Preferably, during the fermentation process, the inoculation amount of the attenuated DT-8 strain of Sclerotium sclerotiorum obtained from the expansion culture is 3-9% of the fermentation medium volume; the fermentation temperature is 18-22℃, the time is 40-80h, the rotation speed is 100-180rpm, and the pH is natural.

[0014] Preferably, the protective agent and the preservative are added at 0.5 wt.% to 4 wt.% and 0.05 wt.% to 0.4 wt.% of the *Sclerotium sclerotiorum* fermentation broth, respectively.

[0015] The surface of the water suspension also includes a layer of antifungal agent.

[0016] The present invention also provides a method for increasing rice yield by initiating rice seeds with the water suspension agent described in the above technical solution.

[0017] Preferably, the initiation includes the following steps:

[0018] Disinfected rice seeds were soaked in the DT-8 aqueous suspension for 8–12 hours and then dried to constant weight.

[0019] The soaking temperature is 18–22°C.

[0020] Preferably, the volume ratio of the aqueous suspension to the mass ratio of the disinfected rice seeds is (80-150) mL: 1 kg.

[0021] Beneficial effects:

[0022] This invention provides the application of attenuated strain DT-8 of Sclerotinia sclerotiorum in increasing rice yield. The attenuated strain DT-8 can stably and significantly increase rice yield. At the same time, the attenuated strain DT-8 carries the attenuated viral DNA virus SsHADV-1, which has no pathogenicity to crops and is safer, so it can be widely used in production.

[0023] Secondly, the application of the attenuated strain DT-8 of Sclerotinia sclerotiorum to increase rice yield is simple, low-cost, and effective.

[0024] Biological Preservation Information

[0025] The attenuated viral strain DT-8 of Sclerotinia sclerotiorum was deposited on May 5, 2019, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC M 2019328. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0027] Figure 1 The PCR detection results of SsHADV-1 in the attenuated viral strain DT-8 of Sclerotium sclerotiorum in Example 1;

[0028] Figure 2 Scanning electron microscopy observation of the attenuated strain DT-8 of Sclerotinia sclerotiorum in rice roots, as shown in Example 4.

[0029] Figure 3 The results of the detection of the bacterial infection rate of rice plants treated with the attenuated viral strain DT-8 of Sclerotinia sclerotiorum in Example 5 are shown below. A and B are the stems and seeds of the treated rice, respectively; C and D are the stems and seeds of the untreated rice, respectively; M is the molecular weight marker; water is the negative control; and Ss is the positive control of the attenuated viral strain DT-8 of Sclerotinia sclerotiorum.

[0030] Figure 4 The image shows the growth status of rice plants in the treatment and control groups in Example 6. Detailed Implementation

[0031] This invention provides the application of a live attenuated strain of *Sclerotinia sclerotiorum*, DT-8, in increasing rice yield. The preservation number of the live attenuated strain DT-8 is CCTCC M 2019328. The live attenuated strain DT-8 of this invention carries the attenuated DNA virus SsHADV-1, which is non-pathogenic to crops and can be safely used in crop production. When the live attenuated strain DT-8 of this invention is inoculated onto rice, it can colonize and grow endophytically within the rice plant, significantly increasing rice yield.

[0032] In this invention, the viable count of the attenuated DT-8 strain of *Sclerotinia sclerotiorum* is preferably at least 1.4 × 10⁻⁶. 5 cfu / mL, more preferably 2.0 × 10⁻⁶ 5cfu / mL. The present invention preferably applies the attenuated strain DT-8 of *Sclerotinia sclerotiorum* in rice in the form of an aqueous suspension.

[0033] The preferred method for preparing the aqueous suspension of the present invention includes expanding and fermenting a strain of attenuated Sclerotinia sclerotiorum DT-8 to obtain a Sclerotinia sclerotiorum fermentation broth; and mixing the Sclerotinia sclerotiorum fermentation broth with a protectant, a preservative and a fungicide to obtain the aqueous suspension.

[0034] The viable count of the attenuated strain DT-8 of *Sclerotinia sclerotiorum* in the aqueous suspension concentrate of the present invention is preferably at least 1.4 × 10⁻⁶. 5 cfu / mL, more preferably 2.0 × 10⁻⁶ 5 cfu / mL.

[0035] This invention preferably involves scaling up the culture of a live attenuated strain of *Sclerotinia sclerotiorum*, DT-8, to obtain a seed culture of DT-8. The culture medium used for scaling up the culture is preferably PDB medium, and the source of the PDB medium is not particularly limited; commercially available products in the art are acceptable. The preferred temperature for scaling up the culture is 18–22°C, more preferably 20°C; the preferred culture time is 3.5–4.5 days, more preferably 4 days. The scaling up culture is preferably a shaking culture, and the preferred shaking speed is 100–200 rpm, more preferably 150 rpm.

[0036] After obtaining the attenuated viral strain DT-8 of *Sclerotinia sclerotiorum*, the present invention preferably ferments the attenuated viral strain DT-8 seed culture to obtain *Sclerotinia sclerotiorum* fermentation broth. The fermentation culture medium of the present invention preferably comprises the following components: 80-120g yeast extract, 150-250g peptone, and 150-200g glucose per 30L of fermentation culture medium; more preferably, 100g yeast extract, 200g peptone, and 180g glucose per 30L of fermentation culture medium. During the fermentation culture of the present invention, the inoculum amount of the attenuated viral strain DT-8 of *Sclerotinia sclerotiorum* obtained from the expansion culture is preferably 3-9% of the fermentation culture medium volume, more preferably 9%. The fermentation culture temperature of the present invention is preferably 18-22℃, more preferably 20℃; the fermentation culture time is preferably 40-80h, more preferably 60h; the fermentation rotation speed is preferably 100-180rpm, more preferably 100rpm; and the fermentation pH value is preferably the natural pH.

[0037] After obtaining the *Sclerotinia sclerotiorum* fermentation broth, the present invention preferably mixes the *Sclerotinia sclerotiorum* fermentation broth with a protectant and a preservative to obtain the aqueous suspension. The protectant preferably includes trehalose or glycerol, more preferably trehalose; the amount of the protectant is preferably 0.5 wt. to 4 wt.% of the *Sclerotinia sclerotiorum* fermentation broth, more preferably 0.5 wt.%. The preservative preferably includes sodium penicillin or streptomycin sulfate, more preferably streptomycin sulfate; the amount of the preservative is preferably 0.05 wt. to 0.4 wt.% of the *Sclerotinia sclerotiorum* fermentation broth, more preferably 0.05 wt.%. The present invention preferably further includes adding a layer of antifungal agent to the surface of the aqueous suspension; the antifungal agent preferably includes paraffin oil, sodium citrate, or sodium lactate, more preferably paraffin oil.

[0038] This invention also provides a method for increasing rice yield by initiating rice seeds with the aqueous suspension agent described in the above technical solution. This invention does not specifically limit the rice varieties used; conventional rice varieties in the art can all be initiated using the aqueous suspension agent. For example, Huanghuazhan, Meixiangzhan, and Liangyou 6326 are used as examples in the embodiments of this application, but these should not be considered as the entire scope of protection of this invention.

[0039] The preferred initiation method of the present invention includes the following steps: soaking disinfected rice seeds in the aqueous suspension for 8-12 hours and drying them to constant weight; the soaking temperature is 18-22°C.

[0040] This invention preferably involves disinfecting rice seeds to obtain disinfected rice seeds. The disinfection conditions are not particularly limited; conventional disinfection methods in the art can be used. For example, this invention describes the disinfection of rice seeds using sodium hypochlorite, but this should not be considered solely within the scope of this invention. This invention preferably uses 5% sodium hypochlorite to disinfect the rice seeds, followed by rinsing with sterile water to complete the disinfection process. The disinfection time is preferably 5–15 minutes, more preferably 10 minutes. The number of rinsing cycles is preferably 2–5 times, more preferably 3 times; the duration of each rinse is preferably 1–5 minutes, more preferably 1 minute.

[0041] After obtaining the disinfected rice seeds, the present invention preferably soaks the disinfected rice seeds in the aqueous suspension for 8-12 hours and then dries them to a constant weight. The volume ratio of the aqueous suspension to the mass of the disinfected rice seeds is preferably (80-150) mL:1 kg, more preferably 100 mL:1 kg. The soaking time is preferably 10 hours, and the soaking temperature is preferably 22°C. The drying method is preferably air drying. The present invention does not have specific limitations on the specific air drying operation; conventional air drying methods in the art can be used.

[0042] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] Verification of Sclerotium sclerotiorum attenuated strain DT-8 carrying virus SsHADV-1:

[0045] Collect *Sclerotium sclerotiorum* hyphae, rapidly grind them into powder using liquid nitrogen, transfer the powder to a 2 mL centrifuge tube, add 800 μL of preheated 2% CTAB extraction buffer, incubate at 65°C for 30 min, inverting and mixing several times during incubation; add 400 μL of chloroform and 400 μL of phenol, gently invert and mix, centrifuge at 12,000 rpm at room temperature for 15 min; take 650 μL of supernatant, add an equal volume of pre-cooled isopropanol to precipitate for 30 min; centrifuge at 12,000 rpm at room temperature for 15 min; discard the supernatant, wash with 70% ethanol, discard the residual liquid, dry, add 50 μL of deionized water, and dissolve at 37°C for 5–10 min.

[0046] Using *Sclerotium sclerotiorum* DNA as a template, SsHADV-1 was detected using specific primers SsCP-F1: 5'-GGAGCATCCTCAACACGACATC-3' (SEQ ID NO.1) and SSCP-R1: 5'-TACGAAGAAGGTCGGACGCC-3' (SEQ ID No.2). The PCR reaction program was as follows: 95℃ pre-deformation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 32 cycles of amplification followed by 72℃ extension repair for 5 min, and storage at 16℃ for 2 min. A water negative control was used. The amplified products were subjected to agarose gel electrophoresis, stained with ethidium bromide (0.5 μg / mL), and observed using a gel imaging system. The results are as follows: Figure 1 :Depend on Figure 1 It can be seen that the present invention specifically amplifies a 755bp fragment of SsHADV-1 in the attenuated strain DT-8 of Sclerotium sclerotiorum, proving that the attenuated strain DT-8 of Sclerotium sclerotiorum carries the virus SsHADV-1.

[0047] Example 2

[0048] Preparation of aqueous suspension of attenuated virulent strain DT-8 of Sclerotinia sclerotiorum:

[0049] The DT-8 strain was inoculated into 300 mL of PDB medium (200 g potato, 20 g glucose, distilled water added to 1000 mL, autoclaved at 121℃ for 30 min) and cultured by shaking at 18–22℃ and 100–200 rpm for 3.5–4.5 days. In a 50 L fermenter, 30 L of culture medium was added, with a formulation of 100 g yeast extract, 200 g peptone, and 180 g glucose per 30 L of medium. The culture was inoculated at a 9% ratio and cultured at 20℃, 100 rpm, and natural pH for 60 h. 0.4 wt.% trehalose and 0.05 wt.% streptomycin sulfate were added to the culture as protectants and mixed thoroughly. A layer of liquid paraffin oil was added to the surface of the aqueous suspension as a fungicide. The viable count of the prepared aqueous suspension was 1.4 × 10⁻⁶. 5 cfu / mL.

[0050] Example 3

[0051] Induction of rice seeds by attenuated strain DT-8 of Sclerotinia sclerotiorum in water suspension:

[0052] There are no special restrictions on the surface disinfection conditions of rice seeds. The rice seeds were disinfected with 5% sodium hypochlorite for 10 minutes, rinsed three times with sterile water for 1 minute each time, and soaked in the aqueous suspension prepared in Example 2 at 18-22°C for 10 hours. The dosage of the aqueous suspension was 100 mL: 1 kg. The seeds were then immediately air-dried to constant weight.

[0053] Example 4

[0054] The attenuated strain DT-8 of Sclerotinia sclerotiorum grows endophytically in the roots of rice:

[0055] To confirm the endophytic growth of *Sclerotinia sclerotiorum* in rice roots and its growth and spread mechanisms, tissue-cultured rice seedlings were inoculated with *Sclerotinia sclerotiorum*. At the 5-leaf stage, mycelial blocks of a attenuated *Sclerotinia sclerotiorum* strain DT-8 were inoculated at the base of the stem. Electron microscopy was performed on rice root samples 15 days after inoculation, and the results showed... Figure 2 As shown.

[0056] Depend on Figure 2 It can be seen that the hyphae of the DT-8 strain of Sclerotium sclerotiorum are distributed in both the intercellular spaces and inside the root cells of rice.

[0057] Example 5

[0058] The attenuated strain DT-8 of Sclerotinia sclerotiorum grows endophytically in rice stems and seeds:

[0059] To investigate the growth status of the attenuated strain DT-8 of *Sclerotinia sclerotiorum* in rice plants after seed priming:

[0060] The rice seeds induced in Example 3 and the rice seeds in the control group (with water induced as a control) were transplanted and potted. At maturity, a pair of highly specific Sclerotinia sclerotiorum primers XJJ21: 5'-GTTGCTTTGGCGTGCTGCTC-3' (SEQ ID NO.3) and XJJ22: 5'-TGACATGGACTCAATACCAAGCTG-3' (SEQ ID No.4) were used to detect the stems and the resulting seeds.

[0061] The PCR detection method is as follows: one stem from each rice plant is taken as one stem sample, and 10 seeds from each rice plant are mixed together to form one seed sample. 100 stem and seed samples are taken from each treatment and control. Rice stems and seed tissues were collected and rapidly ground into powder using liquid nitrogen. The powder was transferred to a 2 mL centrifuge tube, and 800 μL of preheated 2% CTAB extraction buffer was added. The tube was incubated at 65°C for 30 min, inverting several times during incubation. 400 μL of chloroform and 400 μL of phenol were added, and the mixture was gently inverted and centrifuged at 12,000 rpm for 15 min at room temperature. 650 μL of the supernatant was collected, and 650 μL of chloroform was added for extraction. The mixture was inverted and centrifuged at 12,000 rpm for 10 min. 450 μL of the supernatant was collected, and an equal volume of pre-cooled isopropanol was added for nucleic acid precipitation for 30 min. The tube was then centrifuged at 12,000 rpm for 15 min at room temperature. The supernatant was discarded, and 1 mL of 70% ethanol was added to wash the precipitate. This step was repeated once. The residual liquid was discarded, and the tube was dried in a 37°C oven for 10 min. 50–60 μL of deionized water (containing 25 μg / mL) was added. Dissolve RNase A at 37°C for 5–10 min.

[0062] Using DNA extracted from rice stems and seeds as templates, PCR amplification was performed (annealing at 95℃ for 5 min, 33 cycles including denaturation at 94℃ for 1 min, annealing at 63℃ for 30 s, extension at 72℃ for 30 s, followed by extension at 72℃ for 5 min, and incubation at 16℃ for 5 min). DNA from the attenuated viral strain DT-8 of Sclerotinia sclerotiorum was used as a positive control. The amplified products were subjected to agarose gel electrophoresis, stained with ethidium bromide (0.5 μg / mL), and observed using a gel imaging system. The presence or absence of the target band determined the endophytic growth of strain DT-8. Simultaneously, the PCR amplified products were sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared and analyzed in the NCBI database.

[0063] The test results showed that, after seed treatment, the attenuated strain DT-8 of *Sclerotinia sclerotiorum* could grow in rice stems and newly formed seeds, with a detection rate of 70% in both stems and seeds; while the detection rate in the untreated control rice stems was 15%, and the detection rate in seeds was 0%. Figure 3The results are partially shown, and the sequencing result of the PCR product that amplified the band is 5'-GTTGCTTTGGCGTGCTGCTCTTCGGGGCCTTGTATGCTCGCCAGAGAATATCAAAACTCTTTTTATTAATGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGTTTGGTATTGAGTCCATGTCAG-3' (SEQ ID No. 5), which corresponds to the sequence of the attenuated strain of *Sclerotinia sclerotiorum*. This indicates that the attenuated strain of *Sclerotinia sclerotiorum* DT-8 can stably grow in rice plants after seed priming treatment.

[0064] Example 6

[0065] Rice seeds were induced using the initiation method described in Example 3 and the aqueous suspension agent described in Example 2. The induced rice seeds (treatment group) and uninitiated rice seeds (control group) were tested in an experimental field in Xiangyang City, Hubei Province in April 2021 (rice variety: Huanghuazhan). Each treatment consisted of three plots, each 200m². 2 Standard water and fertilizer management was used throughout the process, without the use of fungicides. The plant growth status in the field in October was as follows: Figure 4 As shown in the figure, the left side represents the treatment group, and the right side represents the control group. The yield measurement results are shown in Table 1.

[0066] Table 1. Field trial results of Huang Huazhan treated with attenuated strain DT-8 of Sclerotium sclerotiorum in aqueous suspension.

[0067]

[0068] Depend on Figure 4 It can be concluded that the rice plants in the treatment group had thick, green stems and large panicles; while the rice plants in the control group were weak, with yellowing and senescent leaves at the base. As shown in Table 1, when the yield of the plots was measured at harvest, the treatment with the attenuated viral strain DT-8 of Sclerotinia sclerotiorum in Huanghuazhan resulted in a 12.3-13.8% increase in rice yield compared to the control.

[0069] Example 7

[0070] Rice seeds were induced using the initiation method described in Example 3 and the aqueous suspension agent described in Example 2. The induced rice seeds (treatment group) and uninitiated rice seeds (control group) were tested in an experimental field in Xiangyang City, Hubei Province in April 2021 (rice variety: Meixiangzhan). Each treatment consisted of three plots, each 200m². 2 The entire process involved conventional water and fertilizer management, without the use of fungicides. Yield was measured at harvest, and the results are shown in Table 2.

[0071] Table 2. Field trial results of *Sclerotium sclerotiorum* attenuated strain DT-8 treated with aqueous suspension in *Meixiangzhan*.

[0072]

[0073] As shown in Table 2, treatment of Meixiangzhan rice with the aqueous suspension of the attenuated strain DT-8 of Sclerotinia sclerotiorum can increase rice yield by 13.3% to 21.9%.

[0074] Example 8

[0075] Rice seeds were induced using the initiation method described in Example 3 and the water suspension agent described in Example 2. The induced rice seeds (treatment group) and uninitiated rice seeds (control group) were tested in an experimental field in Qichun County, Hubei Province in April 2021 (rice variety: Liangyou 6326). Conventional water and fertilizer management was used throughout the process, without the use of fungicides. Yields were measured at harvest, and the results are shown in Table 3.

[0076] Table 3. Field trial results of treating Liangyou 6326 with attenuated strain DT-8 of Sclerotium sclerotiorum in aqueous suspension.

[0077]

[0078] As shown in Table 3, the treatment of Liangyou 6326 with the aqueous suspension of the attenuated strain DT-8 of Sclerotinia sclerotiorum can increase rice yield by 10.4% to 17.1%.

[0079] As can be seen from the above examples, the attenuated strain DT-8 of Sclerotinia sclerotiorum can be colonized in rice seeds, roots and stems, thereby achieving the technical effect of stably and significantly increasing rice yield.

[0080] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention. sequence list <110> Hubei Hongshan Laboratory <120> Application of attenuated strain DT-8 of Sclerotinia sclerotiorum in increasing rice yield <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <400> 1 ggagcatcct caacacgaca tc 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tacgaagaag gtcggacgcc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gttgctttgg cgtgctgctc 20 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 tgacatggac tcaataccaa gctg 24 <210> 5 <211> 292 <212> DNA <213> Artificial Sequence <400> 5 gttgctttgg cgtgctgctc ttcggggcct tgtatgctcg ccagagaata tcaaaactct 60 ttttattaat gtcgtctgag tactatataa tagttaaaac tttcaacaac ggatctcttg 120 gttctggcat cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca 180 gtgaatcatc gaatctttga acgcacattg cgccccttgg tattccgggg ggcatgcctg 240 ttcgagcgtc atttcaaccc tcaagctcag tttggtattg agtccatgtc ag 292

Claims

1. Attenuated strain of Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum The application of DT-8 in increasing rice yield is characterized by, The preservation number of the attenuated viral strain DT-8 of Sclerotium sclerotiorum is: CCTCC M 2019328; The viable count of the attenuated strain DT-8 of *Sclerotinia sclerotiorum* was at least 1.4 × 10⁻⁶. 5 cfu / mL; the attenuated strain of Sclerotinia sclerotiorum DT-8 exists in the form of an aqueous suspension; the preparation method of the aqueous suspension includes: expanding and fermenting the attenuated strain of Sclerotinia sclerotiorum DT-8 to obtain a Sclerotinia sclerotiorum fermentation broth; mixing the Sclerotinia sclerotiorum fermentation broth with a protectant and a preservative to obtain the aqueous suspension.

2. The application according to claim 1, characterized in that, The culture medium for the expanded culture includes PDB medium, with a temperature of 18-22℃ and a time of 3.5-4.5 days; The expansion culture is a shaking culture, and the shaking rotation speed is 100~200 rpm.

3. The application according to claim 2, characterized in that, The fermentation medium used for fermentation culture includes the following components: 80-120g of yeast extract, 150-250g of peptone and 150-200g of glucose per 30L of fermentation medium.

4. The application according to claim 2 or 3, characterized in that, During the fermentation process, the seed culture of the attenuated DT-8 strain of Sclerotinia sclerotiorum obtained from the expansion culture is 3-9% of the fermentation medium volume; the fermentation temperature is 18-22℃, the time is 40-80h, the rotation speed is 100-180rpm, and the pH is natural.

5. The application according to claim 1, characterized in that, The protective agent and preservative are added at amounts of 0.5 wt.%~4 wt.% and 0.05 wt.%~0.4 wt.% of the *Sclerotium sclerotiorum* fermentation broth, respectively. The surface of the water suspension also includes a layer of antifungal agent.

6. A method for increasing rice yield, characterized in that, Initiation of rice seeds using the aqueous suspension agent according to any one of claims 1 to 5.

7. The method according to claim 6, characterized in that, The triggering process includes the following steps: Disinfected rice seeds were soaked in the DT-8 aqueous suspension for 8-12 hours and then dried to constant weight. The soaking temperature is 18~22℃.

8. The method according to claim 7, characterized in that, The volume ratio of the aqueous suspension to the mass of the disinfected rice seeds is (80~150) mL: 1 kg.

Images