Saccharomycopsis fibuligera and application thereof in improving flavor quality of beer

Abstract

The application discloses a Saccharomycopsis fibuligera and application thereof in improving flavor quality of beer, wherein the strain number of the Saccharomycopsis fibuligera is G02, and the Saccharomycopsis fibuligera has been preserved in the China General Microbiological Culture Collection Center on March 6, 2023, and the registration number is CGMCC No. 26747. The Saccharomycopsis fibuligera G02 has good alcohol tolerance, can maintain good growth activity under a high bitterness acid concentration of 50 IBU, and meets the basic requirements of a strain in beer production. The Saccharomycopsis fibuligera G02 can increase the content of isoamyl alcohol and 4-ethyl guaiacol in beer, can increase the types and content of aroma substances in beer, and thus improves the flavor quality of beer.

Description

Technical Field

[0001] This invention relates to a strain of capsule-coated yeast in the field of biotechnology and its application in improving the flavor and quality of beer. Background Technology

[0002] Beer has a long history. The Sumerians brewed the earliest form of beer using barley around 6000 BC. my country also has records of the birth of primitive beer—"Lijiu"—dating back 5000 years. The *Shangshu* (Book of Documents), in the chapter "Shuoming," mentions "If you make wine, you only need malt and barley," which is the same meaning as "In ancient times, malt was used to make wine, and barley was used to make Lijiu" in the *Tiangong Kaiwu* (Exploitation of the Works of Nature). Barley is made using barley, which is malt. This is similar to the raw materials used in modern beer. The modern definition of beer remains: a fermented beverage with a low alcohol content and containing carbon dioxide, made primarily from malt and water, with the addition of hops, and fermented by yeast.

[0003] Currently, popular beers can be divided into two main categories based on market type: industrial beer, which accounts for over 97% of the market, and craft beer, which accounts for less than 3%. While industrial beer has achieved mass appeal, its nutritional components and yeast, after filtration and sterilization, have lost the inherent aroma, smooth taste, elegant aftertaste, and rich nutritional value of traditional beer, making it quite different from the flavor of traditional craft beer. With global economic development and a significant improvement in living standards, people's desire for a high-quality life is growing stronger. The monotonous flavor of industrial beer can no longer fully meet people's increasing needs for a better life, and craft beer is increasingly gaining popularity.

[0004] Craft beer, officially called "workshop beer" according to the China Alcoholic Drinks Association's "Specifications for Workshop Beer and Its Production," retains the English name "Craft beer," derived from the concept of "craftsmanship" or "exquisite craftsmanship." It is defined as beer produced on small-scale brewing lines with a production capacity of less than 10 kL / batch saccharification power, brewed without adding substances unrelated to flavor enhancement, resulting in a distinctive flavor profile. This excludes large-scale, less flavorful industrial beers, aligning more closely with the American Brewers Association's definition of craft beer. Craft beer is more mature in the United States, currently accounting for 20% of total beer production, but in my country, its development is still in its growth stage.

[0005] A rich and unique flavor profile is a key characteristic of craft beer, and selecting non-brewing yeasts that produce distinctive flavor properties to improve beer aroma quality is a fermentation strategy that urgently needs development. In recent years, research on brewing yeasts has become increasingly sophisticated and its scope has expanded, with the role of non-brewing yeasts (non-Saccharomyces) in beer brewing receiving growing attention. Non-brewing yeasts are a large class of yeasts distinct from brewing yeasts (Saccharomyces cerevisiae), primarily including Hanseniaspora, Metschnikowia, and Pichia. Furthermore, research has shown that non-brewing yeasts can synthesize large amounts of volatile substances such as esters and alcohols, and some can secrete enzymes such as pectinase and glucosidase, playing a positive role in shaping novel flavor characteristics and enhancing the complexity of the beer. Summary of the Invention

[0006] The technical problem to be solved by this invention is how to improve the flavor quality of beer.

[0007] To solve the above-mentioned technical problems, the present invention first provides a strain of Saccharomycopsis fibuligera G02.

[0008] The *Saccharomycopsis fibuligera* G02 strain provided in this invention has the registration number CGMCC No. 26747 at the China General Microbiological Culture Collection Center (CGMCC). This strain was deposited at CGMCC on March 6, 2023, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Hereinafter referred to as *Saccharomycopsis fibuligera* G02.

[0009] The *Saccharomyces cerevisiae* G02 strain has an oval cell shape with an average size of 3.691 μm × 2.201 μm. Strain G02 was streaked onto YPD solid medium and incubated at 28°C inverted for 48 hours. The morphology, color, edge regularity, and texture of single colonies were then observed. Specifically, G02 single colonies were milky white with a velvety surface. *Saccharomyces cerevisiae* G02 can grow at a fermentation temperature of 10°C, demonstrating potential for low-temperature fermentation. Furthermore, the growth activity of *Saccharomyces cerevisiae* G02 gradually increases with increasing temperature. However, the growth of *Saccharomyces cerevisiae* G02 is slow in an acidic environment of pH 2.5. But at pH 8.0, *Saccharomyces cerevisiae* G02 grows well. *Saccharomyces cerevisiae* G02 grows well in media with maltose and glucose as the sole carbon source. *Saccharomyces cerevisiae* G02 exhibits good alcohol tolerance. It is noteworthy that the *Saccharomyces cerevisiae* strain G02 maintained good growth activity at a relatively high picric acid concentration of 50 IBU, meeting the basic requirements for strains used in beer production. *Saccharomyces cerevisiae* G02 possesses the DNA fragment shown in Sequence 1 of the sequence listing.

[0010] The *Saccharomyces cerevisiae* G02 was isolated and screened from the mash of Chinese Maotai-flavor liquor. It can ferment and grow at a low temperature of 10°C, demonstrating potential for low-temperature fermentation. It maintains good growth activity at hop bitterness concentrations greater than 50 IBU. *Saccharomyces cerevisiae* G02 exhibits high tolerance to 20% alcohol concentration and grows well in a medium supplemented with 2% maltose as the sole carbon source, showing potential for beer brewing.

[0011] *Saccharomyces cerevisiae* G02 grew well on media supplemented with 2% maltose, 2% glucose, 2% galactose, and 2% fructose as the sole carbon source. *Saccharomyces cerevisiae* G02 also exhibited good growth characteristics on a 20% maltose medium, demonstrating tolerance to osmotic fermentation. *Saccharomyces cerevisiae* G02 also showed good growth characteristics on a 20% glucose medium, demonstrating tolerance to osmotic fermentation.

[0012] The capsule-coated yeast G02 can grow well in YPD medium with 2% NaCl.

[0013] This invention also provides any of the following applications of the aforementioned capsule-coated yeast:

[0014] X1. Application in increasing the isoamyl alcohol content in beer;

[0015] X2. Application in increasing the content of 4-ethylguaiacol in beer;

[0016] X3. Application in increasing the types and content of aroma substances in beer;

[0017] X4. Application in improving the flavor and quality of beer.

[0018] The fermentation broth of the capsule-coated yeast G02 is also within the scope of protection of this invention.

[0019] The fermentation broth of *Saccharomyces cerevisiae* G02 can be prepared as follows: *Saccharomyces cerevisiae* G02 is cultured in a liquid fermentation medium, and the fermentation broth (containing *Saccharomyces cerevisiae* G02 and substances secreted into the liquid medium) is collected. This fermentation broth is the metabolite of *Saccharomyces cerevisiae* G02.

[0020] To address the above technical problems, the present invention also provides a product, which is a microbial agent containing the aforementioned cyst-covered yeast G02.

[0021] The above-mentioned microbial agent has at least one of the following functions: W1-W4

[0022] W1. Increase the isoamyl alcohol content in beer;

[0023] W2. Increase the content of 4-ethylguaiacol in beer;

[0024] W3. Increase the variety and content of aroma compounds in beer;

[0025] W4. Improves the flavor and quality of beer.

[0026] The active ingredient of the above-mentioned microbial agent may be *Saccharomyces cerevisiae* G02 or / and the fermentation broth of *Saccharomyces cerevisiae* G02. The active ingredient of the above-mentioned product may also contain other biological or non-biological components. Other active ingredients of the above-mentioned microbial agent can be determined by those skilled in the art based on the product's effects.

[0027] The above-mentioned microbial agents can be liquid or solid.

[0028] The liquid bacterial agent is a liquid obtained by culturing the aforementioned *Saccharomyces cerevisiae* G02 in a microbial culture medium.

[0029] The product can be in various dosage forms, such as liquid, emulsion, suspension, powder, granules, wettable powder or water-dispersible granules.

[0030] The application of the above-mentioned microbial agents is any one or more of the following X1-X6:

[0031] X1. Application in increasing the isoamyl alcohol content in beer;

[0032] X2. Application in increasing the content of 4-ethylguaiacol in beer;

[0033] X3. Application in increasing the types and content of aroma substances in beer;

[0034] X4. Application in improving the flavor and quality of beer.

[0035] The present invention also provides a method for culturing the aforementioned cladosporium-coated yeast G02, comprising the step of culturing the cladosporium-coated yeast G02 in a culture medium.

[0036] The method for preparing the bacterial agent is also within the scope of protection of this invention.

[0037] The method for preparing the bacterial agent provided by the present invention includes the step of using the *Saccharomyces cerevisiae* G02 and / or *Saccharomyces cerevisiae* fermentation broth as components of the bacterial agent to obtain the bacterial agent, wherein the bacterial agent is a liquid bacterial agent or a solid bacterial agent.

[0038] In the above method, the inoculum can be a liquid inoculum. In the above method, the *Saccharomyces cerevisiae* G02 can be cultured in a fermentation medium to obtain a fermentation broth. The fermentation broth is then mixed with a carrier to obtain the liquid inoculum. The fermentation medium can consist of: 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.

[0039] Experiments have shown that the *Saccharomyces cerevisiae* G02 strain of this invention can grow at a fermentation temperature of 10°C, demonstrating its potential for low-temperature fermentation. Furthermore, the growth activity of *Saccharomyces cerevisiae* G02 gradually increases with increasing temperature. *Saccharomyces cerevisiae* G02 exhibits good growth at pH 8.0. The *Saccharomyces cerevisiae* G02 strain shows good alcohol tolerance. Notably, the *Saccharomyces cerevisiae* G02 strain maintains good growth activity even at a relatively high picric acid concentration of 50 IBU, meeting the basic requirements for strains used in beer production. At 12... O The wort of this invention, *Saccharomyces cerevisiae* G02, was inoculated with commercial brewing yeast WB-06 as a control. After a 7-day primary fermentation period, *Saccharomyces cerevisiae* G02 showed a higher degree of fermentation in the wort than commercial brewing yeast WB-06. Furthermore, flavor analysis at the end of fermentation indicated that this strain could increase the content of isoamyl alcohol and 4-ethylguaiacol in beer, thereby increasing the variety and content of aroma compounds and imparting unique and novel flavor characteristics to the beer, thus improving its flavor quality.

[0040] Instructions for the Preservation of Biological Materials

[0041] Classification and nomenclature of biological materials: Encapsulated yeast

[0042] The Latin scientific name of the biomaterial is: *Saccharomycopsis fibuligera*

[0043] Strain number of the biological material: G02

[0044] Full name of the depository: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0045] Abbreviation of depositary institution: CGMCC

[0046] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Postcode: 100101

[0047] Date of preservation: March 6, 2023

[0048] Accession number: CGMCC No. 26747 Attached Figure Description

[0049] Figure 1 This is the phylogenetic tree of strain G02 constructed in Example 1 of the present invention.

[0050] Figure 2 This illustrates the growth of *Saccharomyces cerevisiae* G02 and *Saccharomyces cerevisiae* WB-06 under different growth environments in Example 2 of this invention. Figure 2 A represents the yeast growth status under different temperature conditions; Figure 2 B represents the yeast growth status under different pH conditions; Figure 2 C represents the yeast growth status when different carbon sources are used as the sole carbon source; Figure 2 D represents yeast growth under high concentrations of maltose and fructose culture conditions. In the figure, ns represents no significant difference, * represents a significance analysis result of P < 0.05, ** represents a significance analysis result of P < 0.01, and *** represents a significance analysis result of P < 0.001.

[0051] Figure 3 This illustrates the growth of *Saccharomyces cerevisiae* G02 and *Saccharomyces cerevisiae* WB-06 under different tolerance conditions in Example 2 of this invention. Figure 3 A represents the yeast growth status at different alcohol concentrations; Figure 3 B represents the yeast growth under different salinity and picric acid concentrations. In the figure, ns represents no significant difference, and *** represents a significance analysis result of P<0.001.

[0052] Figure 4 This refers to the CO2 weight loss during the main fermentation phase of the single-strain fermentation of *Saccharomyces cerevisiae* G02, the single-strain fermentation of commercial *Saccharomyces cerevisiae* WB-06, and the sequential mixed fermentation of *Saccharomyces cerevisiae* G02 and commercial *Saccharomyces cerevisiae* WB-06 in Example 3 of this invention. Figure 4 A represents the daily CO2 weight loss during the main fermentation period of each fermentation group; Figure 4 B represents the total CO2 weight loss during the main fermentation period of each fermentation group. In the figure, *** represents the significance analysis result of P<0.001.

[0053] Figure 5The figures represent the fermentation alcohol content of the single-strain fermentation group of *Saccharomyces cerevisiae* G02, the single-strain fermentation group of commercial *Saccharomyces cerevisiae* WB-06, and the sequential mixed fermentation group of *Saccharomyces cerevisiae* G02 and commercial *Saccharomyces cerevisiae* WB-06 in Example 3 of this invention. In the figure, ns represents no significant difference.

[0054] Figure 6 The SPME-GC-MS total ion chromatograms are shown for the single-strain fermentation group (A) of *Saccharomyces cerevisiae* G02, the single-strain fermentation group (B) of *Saccharomyces cerevisiae* WB-06, and the sequential mixed fermentation group (C) of *Saccharomyces cerevisiae* G02 and *Saccharomyces cerevisiae* WB-06 in Example 3 of this invention.

[0055] Figure 7 This describes the fermentation kinetics during the main fermentation phase of the single-strain fermentation group of *Saccharomyces cerevisiae* G02 and the single-strain fermentation group of commercial *Saccharomyces cerevisiae* WB-06 in Example 4 of this invention. Figure 7 A represents the yeast growth kinetics during the main fermentation period of each fermentation group; Figure 7 B represents the sugar content change trend during the main fermentation period of each fermentation group. In the figure, *** represents the significance analysis result of P<0.001.

[0056] Figure 8 The figures show the degree of fermentation at the end of the primary fermentation in the single-strain fermentation group of *Saccharomyces cerevisiae* G02 and the single-strain fermentation group of commercial *Saccharomyces cerevisiae* WB-06 in Example 4 of this invention. In the figure, *** represents a significance analysis result of P < 0.001.

[0057] Figure 9 This is a full-wavelength scan of the capsule-covered yeast G02 and the brewer's yeast WB-06 in Example 2 of the present invention.

[0058] Figure 10 This is a transmission electron microscope image of the capsule-coated yeast G02 of the present invention; Figure 10 A is a TEM image of a single G02 yeast; Figure 10 B is a TEM image of G02 yeast budding and multiplying; Figure 10 C is a TEM image of G02 yeast during vigorous growth.

[0059] Figure 11 The images show the morphology of the capsule-coated yeast G02 and the commercial brewer's yeast WB-06 on WL plates. Detailed Implementation

[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0061] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are conventional biochemical reagents and are commercially available.

[0063] The culture medium components used in the following examples are as follows:

[0064] Yeast nutrient liquid medium (YPD liquid medium): 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, deionized water, autoclaved at 115℃ for 30 min, with 100 mg / L chloramphenicol added to eliminate bacterial interference.

[0065] Yeast nutrient solid medium (YPD solid medium): 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar, deionized water, autoclaved at 115℃ for 30 min, with 100 mg / L chloramphenicol added to eliminate bacterial interference.

[0066] WLN medium: glucose 50 g / L, peptone 5 g / L, yeast extract 4 g / L, KH2PO4 0.55 g / L, KCl 0.425 g / L, CaCl2 0.125 g / L, MgSO4 0.125 g / L, FeCl3 0.025 g / L, MnSO4 0.025 g / L, bromocresol green 22 mg / L, agar 20 g / L. Adjust the pH to 6.2 and add 100 mg / L chloramphenicol to eliminate bacterial interference.

[0067] YP medium: 20 g / L yeast extract and 20 g / L peptone, deionized water.

[0068] Example 1: Isolation and Screening of Strains

[0069] As is well known, the production of Baijiu, a traditional Chinese fermented beverage, involves complex microbial systems at different stages. Therefore, the fermented mash (or fermented rice mash) is an important microbial resource for Baijiu. This study used the microbial resources of Baijiu mash as the research object (collected in April 2021 in Guizhou, China; collected by Ma Yanlin, phone 15701366297, email mylouc@163.com), and screened a strain of *Saccharomyces cerevisiae* G02 that exhibits good fermentation performance in beer fermentation systems. The specific process is as follows:

[0070] 1. Enrichment culture

[0071] Add a small amount of baijiu mash to a 10mL sterile saline test tube and incubate at 28℃ in a shaker for 24 hours. If mycelium appears during the incubation process, remove it immediately. Then, take another 1mL and inoculate it into another test tube. Repeat this incubation process 3-4 times.

[0072] 2. Isolation and screening of strains

[0073] Take the enriched yeast culture and dilute it 10-fold in a serial dilution to 10⁻⁶. -7 Take a dilution of 10. -5 10 -6 10 -7 0.1 mL of each solution was spread onto WLN plates and incubated at 28°C for 48 h. After colony growth, the isolated single colonies were purified by streak plating at least three times. Single colonies were then picked and cultured in YPD liquid medium. The obtained bacterial cells were stored at -80°C using 50% glycerol.

[0074] One of the isolated strains was G02.

[0075] 3. Identification of G02

[0076] 3.1. Morphological characteristics

[0077] The morphological characteristics of strain G02 were observed using the plate dilution plating method (see...). Figure 11 The bacterial strain G02 (A) has an oval shape and an average size of 3.691 μm × 2.201 μm. It was diluted and spread onto WLN solid medium and incubated upside down at 28℃ for 48 hours. The morphology, color, edge regularity, and texture of single colonies were then observed. Specifically, G02 single colonies were milky white, glossy, relatively flat, with regular edges and a velvety surface; similar to Saccharomyces cerevisiae WB-06 (see...). Figure 11 The morphology of B) showed significant differences. The transmission electron microscope image of the capsule-covered yeast G02 of this invention is shown below. Figure 10 .

[0078] 3.2. Taxonomic identification and phylogenetic tree construction of yeast

[0079] Yeast genomic DNA was extracted using the Tiangen Biochemical Yeast Genome Extraction Kit, and then amplified using the universal primers ITS1 and ITS4 for fungi. The primer sequences are as follows:

[0080] ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′;

[0081] ITS4: 5′-TCCTCCGCTTATTGATATGC-3′.

[0082] PCR reaction system: 2 μL each of primers, 25 μL Taq Polymerase Mix, 2 μL DNA template, 19 μL ionized H2O, total volume 50 μL. PCR amplification products were analyzed by 10 g / L agarose gel electrophoresis, and then sequenced by BGI Genomics (Beijing, China).

[0083] The obtained amplification product sequence is sequence 1:

[0084] CCTTCCGGATAGGGTACCTGCGGAAGGATCATTAATGTTATTTGTTTTTAGACCTGCGCTTAACTGCGCGGTTTAATAAACTCTTATACACAGTGTTTTTGTTTGCGAATTTGGTTTAGTTTGTTGGTTTTCATTCGAAAGGATGAAGATTGATTGCTAAATCTTATT CAGCTTTTAAACTCAGATCTCTTTTTAAGAGAAATGTATTTTTTTAATTACAACTAGTCGATTTTACAAACTAAAAGTTTAAAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCGTG AATCATCGAATCTTTGAACGCATATTGCGCTCTATAGTATTCTATAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCTTTGGGTTTAGTATTGAAGGTTGTGTTAGCTTCTGCTAACTCCTTTGAAATGACTTGGCAATTGATTGAGTTTTCCATATATTTGC TTAAGGATTTAATATTAGGTTCTACCAACTTATTAAATACCCTTTTGCGAAGGACTTACTCGTGTATCAAGGCCTTATAACTTTGTCATTAATTTTGACCTCAAATCAGGTAAGGATACCCGCTGAACTTAAGCATATCATAAGGCCGGAGGAAATTTTTAATTTTGTA

[0085] The sequencing results were compared for sequence similarity in the National Center for Biotechnology Information (NCBI) database (http: / / blas-t.ncbi.nlm.nih.gov / Blast.cgi), and a phylogenetic tree was constructed using the MEGA-11 software (see...). Figure 1 ).

[0086] Based on observation of biological characteristics, analysis of physiological and biochemical characteristics, and phylogenetic tree comparison analysis, strain G02 was identified as Saccharomycopsis fibuligera.

[0087] Strain G02 is *Saccharomycopsis fibuligera*, which was deposited on March 6, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Its CGMCC registration number is CGMCC No. 26747. Hereinafter referred to as *Saccharomycopsis fibuligera* G02.

[0088] Example 2: Preliminary Detection Experiment of Capsule-Clad Yeast G02

[0089] Preliminary characterization experiments were conducted on strain G02 of *Saccharomyces cerevisiae*, using commercial brewing yeast WB-06 (Belgian *Fermandis* wheat ale yeast WB-06) as a control strain to evaluate its application in beer production. Specific testing methods are as follows:

[0090] 1. Growth characteristics of strains under different temperature conditions

[0091] The initial vaccination rate was 10%. 7 Cell / mL of capsule-coated yeast G02 (with WB-06 as a control) was statically cultured in YPD liquid medium at different temperatures (10℃, 20℃, 30℃, 37℃) for 48 h. The OD600 value of the culture medium was measured (the wavelength of maximum absorption OD600 was determined by full-wavelength scan, the same below. See full-wavelength scan for details). Figure 9 To assess the growth of yeast.

[0092] See results Figure 2 The A strain, *Saccharomyces cerevisiae* G02, showed significant differences in temperature tolerance compared to the control strain, *Saccharomyces cerevisiae* WB-06. As temperature increased, the growth activity of *Saccharomyces cerevisiae* G02 gradually increased.

[0093] 2. Growth characteristics of strains under different pH conditions.

[0094] The initial vaccination rate was 10%. 7 The growth status of G02 (with WB-06 as a control) of blastocyst-coated yeast (cell / mL) was assessed by measuring the OD600 value of the liquid medium after static incubation at 28℃ for 48 h under different pH conditions (2.5, 3.5, 5.0, 8.0) on YPD liquid medium.

[0095] See results Figure 2 The growth rates of *Saccharomyces cerevisiae* strain B, *Saccharomyces cerevisiae* G02, and the control strain *Saccharomyces cerevisiae* WB-06 showed significant differences in OD600 under acidic conditions (pH 2.5, 3.5, 5.0), but no significant difference was observed between the two strains under alkaline conditions (pH 8.0). *Saccharomyces cerevisiae* G02 exhibited better growth at pH 8.0.

[0096] 3. Growth characteristics of yeasts in culture media with different carbon sources as the sole carbon source

[0097] The initial vaccination rate was 10%. 7 The growth of *Saccharomyces cerevisiae* G02 (with WB-06 as a control) at a concentration of 2% maltose as the sole carbon source was used to determine its ability to assimilate maltose. Simultaneously, the yeast was incubated statically at 28°C for 48 hours in YP liquid medium containing 2% fructose, 2% glucose, and 2% galactose as the sole carbon source, and the OD600 of the liquid medium was measured to assess the yeast's growth status.

[0098] See results Figure 2 The OD600 values ​​of *Saccharomyces cerevisiae* G02 and *Saccharomyces cerevisiae* WB-06 showed significant differences under different carbon source conditions; G02 showed poor growth on a medium with galactose as the sole carbon source.

[0099] 4. Growth characteristics of yeast under high concentrations of maltose and fructose culture conditions

[0100] The initial vaccination rate was 10%. 7 Yeast cell / mL capillary-coated yeast G02 (with WB-06 as a control) was cultured statically in an incubator at 28°C for 48 h in media with carbon sources of 10% glucose, 10% maltose, 20% glucose, and 20% maltose. The growth status of the yeast was evaluated by measuring the OD600 of the liquid medium.

[0101] See results Figure 2The OD600 values ​​of the D-type *Saccharomyces cerevisiae* strain, *Saccharomyces cerevisiae* G02, and the control strain, *Saccharomyces cerevisiae* WB-06, showed significant differences under high sugar concentrations of 10% and 20%. Notably, the control strain, *Saccharomyces cerevisiae* WB-06, exhibited poor growth at a high maltose concentration of 20%.

[0102] 5. Growth of yeast under different alcohol concentrations

[0103] The initial vaccination rate was 10%. 7 Yeast cell / mL of G02 (with WB-06 as a control) was cultured in YPD liquid medium with different ethanol concentrations (5%, 10%, 15%, 20%, v / v) at 28°C for 48 h. The growth status of the yeast was evaluated by measuring the OD600 value of the medium.

[0104] See results Figure 3 The OD600 values ​​of *Saccharomyces cerevisiae* A, *Saccharomyces cerevisiae* G02, and *Saccharomyces cerevisiae* WB-06 showed significant differences at 5%, 10%, and 15% v / v alcohol concentrations; however, there was no significant difference in OD600 values ​​between the two strains at 20% v / v alcohol concentration. *Saccharomyces cerevisiae* G02 strain exhibits better tolerance to high alcohol concentrations.

[0105] 6. Growth of yeast at different picric acid concentrations

[0106] The initial vaccination rate was 10%. 7 Yeast cell / mL of G02 (with WB-06 as a control) was cultured in YPD liquid medium at different picric acid concentrations (25 IBU, 50 IBU) in an incubator at 28°C for 48 h. The growth status of the yeast was evaluated by measuring the OD600 value of the liquid medium.

[0107] See results Figure 3 The OD600 values ​​of *Saccharomyces cerevisiae* G02 and the control *Saccharomyces cerevisiae* WB-06 showed significant differences under a YPD growth environment of 25 IBU; however, there was no significant difference in the OD600 values ​​between the two strains under a YPD growth environment of 50 IBU. Notably, *Saccharomyces cerevisiae* G02 strain maintained good growth activity at a relatively high picric acid concentration of 50 IBU.

[0108] 7. Assessing yeast tolerance by observing its growth under different salt concentrations.

[0109] The initial vaccination rate was 10%. 7Yeast cell / mL of G02 (with WB-06 as a control) was cultured in YPD medium at different salt concentrations (10% NaCl, 20% NaCl) for 48 h in an incubator at 28 °C. The growth status of the yeast was assessed by measuring the OD600 value of the liquid medium.

[0110] See results Figure 3 The OD600 values ​​of B, G02, and control Saccharomyces cerevisiae WB-06 showed significant differences under a higher 1% NaCl concentration; however, there was no significant difference in OD600 values ​​under a 5% NaCl concentration.

[0111] from Figure 2 and Figure 3 As can be seen, *Saccharomyces cerevisiae* G02 can grow at a fermentation temperature of 10°C, demonstrating potential for low-temperature fermentation. Furthermore, the growth activity of *Saccharomyces cerevisiae* G02 gradually increases with increasing temperature. However, the growth of *Saccharomyces cerevisiae* G02 is slow in an acidic environment of pH 2.5, but it grows well at pH 8.0. *Saccharomyces cerevisiae* G02 grows well in a culture medium with maltose and glucose as the sole carbon source. *Saccharomyces cerevisiae* G02 exhibits good alcohol tolerance. Notably, *Saccharomyces cerevisiae* G02 maintains good growth activity even at a relatively high picric acid concentration of 50 IBU, meeting the basic requirements for strains in beer production. However, other fundamental characteristics of *Saccharomyces cerevisiae* G02 are not yet evident, and further investigation is needed to determine its suitability for actual brewing conditions.

[0112] Example 3: Fermentation experiment of G02 capsule-coated yeast

[0113] To further determine the fermentation capacity of *Saccharomyces cerevisiae* G02 in wort, a fermentation experiment was conducted. The control strain in this experiment was commercial *Saccharomyces cerevisiae* WB-06. The study investigated the sequential mixed fermentation of *Saccharomyces cerevisiae* G02 and commercial *Saccharomyces cerevisiae* WB-06 at the same inoculum amount. The specific implementation method is as follows:

[0114] (1) Yeast preparation.

[0115] Yeast G02 and Saccharomyces cerevisiae WB-06 were cultured in the logarithmic phase, poured into four 50 mL sterile centrifuge tubes, balanced, and centrifuged at 4000 rpm for 10 min. The supernatant and surface yeast layer were discarded.

[0116] (2) Preparation of wort.

[0117] ① Grind the malt into 11-mesh powder using a malt grinder. ② Saccharify the wort. Start the saccharification apparatus: Set the program to: 45℃ for 15 minutes; 60℃ for 60 minutes; 78℃ for 10 minutes. ④ Filter the wort and wash the mash. ⑤ Boil the wort, weigh out 3g / L of Tsingtao malt extract, and boil for 3 minutes. ⑥ After boiling, allow the wort to swirl and settle, clarify, and cover with gauze. ⑦ Place the cooled wort from step ⑥ into an autoclave and sterilize at 110℃ for 15 minutes.

[0118] Weigh out 3.5g of yeast (1×10 7 The yeast (cell / mL) was transferred into five sterile centrifuge tubes. The yeast from the centrifuge tubes was then added into five Scott bottles containing the same batch of wort. One drop of defoaming agent was added and the mixture was stirred.

[0119] The following fermentation groups were constructed: a single-strain fermentation group of *Saccharomyces cerevisiae* G02, a single-strain fermentation group of *Saccharomyces cerevisiae* WB-06, and a sequential mixed fermentation group of G02 and WB-06. In the sequential mixed fermentation group, G02 was initially inoculated, and WB-06 was inoculated after 48 hours of fermentation. The initial inoculum size for all three fermentation groups was 1 × 10⁻⁶ yeast. 7 The cell / mL 3 was placed in a 300mL Erlenmeyer flask containing the wort prepared in the laboratory above and allowed to ferment at 26°C for 7 days.

[0120] (3) CO2 weight loss measurement

[0121] After inoculating the malt extract with bacteria and sealing it, the total weight of the fermentation bottle was measured. During fermentation, the total weight of the fermentation bottle was measured every 24 hours, and the difference was calculated to obtain the CO2 loss per 24 hours. The results are shown below. Figure 4 .

[0122] Depend on Figure 4 As shown in Figure A, during the primary fermentation process, the daily CO2 weight loss (10.16±2.51 g / d) of the single-strain brewing yeast WB-06 was the highest during the first fermentation stage, indicating the strongest fermentation capacity; this was significantly different from the other two groups. The daily CO2 weight loss in all three fermentation groups initially increased and then decreased during the fermentation process. This is because the initial wort was rich in various nutrients, and the oxygen content in the fermentation bottle was high, leading to rapid yeast proliferation and the generation of a large amount of CO2. In the later stages of fermentation, the oxygen in the fermentation bottle was depleted, and the yeast underwent anaerobic fermentation, producing alcohol and a relatively small amount of CO2, resulting in a decrease in CO2 weight loss. Figure 4 As shown in Figure B, when the main fermentation was completed, the total CO2 weight loss of the single-strain fermentation group of Saccharomyces cerevisiae WB-06 was not significantly different from that of the sequential mixed fermentation group, but both were significantly higher than the total CO2 weight loss of the single-strain fermentation group of Saccharomyces cerevisiae G02.

[0123] (4) Alcohol content measurement

[0124] After the primary fermentation was completed, the alcohol content was determined using the Solarbio ethanol assay kit, following the instructions. The spectrophotometer was preheated for 30 minutes, and the wavelength was adjusted to 505 nm. The spectrophotometer was zeroed using distilled water. Reagents were added as per the instructions, and after thorough mixing, the absorbance value (A1) at 505 nm was immediately measured. The mixture was then reacted in a 37°C water bath for 60 minutes, and the absorbance value (A2) was measured after another 60 minutes of reaction.

[0125] Calculate the ethanol content using Formula 1:

[0126] Ethanol content (mmol / L) = 535 × (ΔA determination - ΔA blank) ÷ (ΔA standard - ΔA blank) × dilution factor (Formula 1)

[0127] The alcohol content test results are shown below. Figure 5 After the primary fermentation was completed, the alcohol content of the fermentation broths from the G02 single-strain fermentation group, the WB-06 single-strain fermentation group, and the sequential mixed-strain fermentation group was measured using a Solarbio ethanol content assay kit. The results showed no significant difference in ethanol content among the three fermentation groups. The fermentation degree test results are shown below. Figure 5 .

[0128] (5) The main fermentation was completed in 7 days, and the main metabolites of the fermentation broth were measured.

[0129] The main metabolites of the fermentation broth were analyzed using the following methods: Qualitative and quantitative analysis of aroma substances: Gas chromatography and mass spectrometry conditions: chromatographic column: HP-DBWAX (30m × 0.25mm id3 0.5μm filmthickness3 Phenomenex3 Torrance3 CA), carrier gas: high-purity helium, flow rate: 1.0 mL·min -1 The injection port temperature was 250℃, and the split ratio was 10:1. The desorption time was 5 minutes. The temperature program was as follows: the column oven started at 35℃, held for 4 minutes, and then increased at 20℃ / min. -1 The temperature was increased to 150°C at a rate of 4°C / min. -1 The ion source temperature was increased to 230℃ and held for 10 min. The junction temperature was 280℃. The solvent delay was 4 min. The ion source temperature was 170℃, the electron energy was 70 eV, and the scan mass range was 50–550. The scan results are shown in […]. Figure 6 The qualitative analysis of volatile aroma compounds was performed based on retention indices and mass spectrometry information from the NIST 14 standard spectral library.

[0130] The measurement results are shown in Table 2:

[0131] Table 2. Main volatile components of each experimental group after fermentation.

[0132]

[0133]

[0134] Note: G02 represents the single-strain fermentation group of *Saccharomyces cerevisiae* G02; WB-06 represents the single-strain fermentation group of *Saccharomyces cerevisiae* WB-06; G02+WB-06 represents the sequential mixed fermentation group of *Saccharomyces cerevisiae* and *Saccharomyces cerevisiae* WB-06. Different lowercase letters after the data in the same row indicate that the significance analysis result is P < 0.05.

[0135] As shown in Table 2, the volatile flavor compounds in each fermentation group exhibited significant differences. Both the single fermentation group and the sequential mixed fermentation group of *Saccharomyces cerevisiae* G02 produced the unique flavor compound 4-ethylguaiacol, an aroma compound not detected in the single fermentation of *Saccharomyces cerevisiae* WB-06. This compound can impart clove and vanilla flavor characteristics to beer. The study indicates that 4-ethylguaiacol also possesses antioxidant and cytoprotective functional properties.

[0136] The above experiments confirmed the excellent phenol production capacity of *Saccharomyces cerevisiae* G02 and its application potential in beer brewing. However, further pilot-scale fermentation experiments are needed to verify its ability to be used in actual beer fermentation.

[0137] Example 4: Pilot-scale fermentation experiment of capsule-coated yeast G02

[0138] A pilot-scale fermentation experiment of G02 capsule-coated yeast was conducted using a 20L stainless steel fermenter.

[0139] The specific brewing process is as follows:

[0140] Add 24L of purified water to the mashing vessel to adjust the pH to 5.6, heat to 50℃, add crushed Pilsner malt, continue heating to 63℃ and hold for 40 minutes, then heat to 72℃ and hold for 20 minutes. Iodine testing confirms complete starch decomposition, then wash the mash. After boiling for 20 minutes, add pre-weighed Tsingtao hops; boil for 60 minutes, add carrageenan, boil for another 10 minutes, then stop boiling. The total boiling time is 70 minutes. Transfer the cooled and clarified mash to a cleaned and sterilized fermentation tank, and record the volume of the mash. After the mash transfer, inoculate the prepared yeast slurry onto the surface of the mash, then aerate the mash and set the fermentation temperature to 26℃. During fermentation, monitor and record the sugar content and pH at regular intervals. When the sugar content of the fermentation broth drops to 4... O When the temperature reaches approximately P, seal the fermentation tank and continue fermentation. Continue fermentation until it is completely complete, then gradually lower the temperature of the fermentation tank to 8°C and then 4°C, maintaining this temperature for two weeks.

[0141] Experimental group: fermentation of single-strain yeast G02; control group: fermentation of single-strain yeast WB-06.

[0142] (1) Tracking the number of yeasts during fermentation.

[0143] During the main fermentation period, every 24 hours, 2 mL of fermentation broth was added to 2 μL of H₂SO₄ and mixed thoroughly to form mixture a, to prevent yeast cell flocculation, and vortexed for 30 seconds. 100 μL of mixture a was then added to 900 μL of deionized water and vortexed to form mixture b. 30 μL of mixture b was then added dropwise to the upper sample plate, and the yeast count was determined using a Countstar automated yeast counter.

[0144] The measurement results are shown below. Figure 7 A. During the main fermentation period, the growth rate of both the *Saccharomyces cerevisiae* G02 and *Saccharomyces cerevisiae* WB-06 fermentation groups gradually increased in the first three days, then decreased on the third day. Notably, the growth trend of the *Saccharomyces cerevisiae* G02 fermentation group was significantly higher than that of the *Saccharomyces cerevisiae* WB-06 fermentation group.

[0145] (2) During the main fermentation period, 3 mL of fermentation broth was taken every 24 hours and the sugar content of each group was measured using an Anton Paar handheld saccharimeter to detect the trend of sugar content changes during the fermentation process. Figure 7 B. During the main fermentation period, the sugar content of both the *Saccharomyces cerevisiae* G02 fermentation group and the *Saccharomyces cerevisiae* WB-06 fermentation group showed a decreasing trend. For example... Figure 8 As shown, the fermentation temperature was 26℃, and the initial yeast inoculum was 10. 7 At the end of primary fermentation, the fermentation degree of the *Saccharomyces cerevisiae* G02 group was significantly higher than that of *Saccharomyces cerevisiae* WB-06. After fermentation, aroma compounds were analyzed. Qualitative and quantitative analysis methods for aroma compounds were as described in Example 3; simultaneously, the alcohol content during fermentation was measured using an automated beer analyzer. The results are shown in Table 3.

[0146] Table 3 Content of major metabolites in each experimental group after alcoholic fermentation

[0147]

[0148] In conclusion, the G02 sac-coated yeast can significantly increase the content of isoamyl alcohol and phenolic substances in beer, improve the aroma of beer, enhance the floral and fruity aroma of beer, and make the aroma of wine more complex, rich, and layered.

[0149] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A capsule-coated yeast, characterized in that: The cladoblast-coated yeast is cladoblast-coated yeast ( Saccharomycopsis fibuligera The strain number is G02, and its registration number at the China General Microbiological Culture Collection Center is CGMCC No. 26747.

2. Any of the following applications of the capsule-coated yeast of claim 1: X1. Application in increasing the isoamyl alcohol content in beer; X2. Application in increasing the content of 4-ethylguaiacol in beer; X3. Application in increasing the types and content of aroma substances in beer; X4. Application in improving the flavor and quality of beer.

3. A microbial agent, characterized in that: The inoculum contains the capsule-coated yeast as described in claim 1.

4. The microbial agent according to claim 3, characterized in that: The microbial agent has at least one of the following functions: W1-W4 W1. Increase the isoamyl alcohol content in beer; W2. Increase the content of 4-ethylguaiacol in beer; W3. Increase the variety and content of aroma compounds in beer; W4. Improves the flavor and quality of beer.

5. The microbial agent according to claim 3 or 4, characterized in that: The bacterial agent can be a liquid bacterial agent or a solid bacterial agent.

6. The microbial agent according to claim 5, characterized in that: The liquid bacterial agent is a liquid obtained by culturing the capsule-coated yeast of claim 1 in a microbial culture medium.

7. Any of the following applications of the microbial agent according to any one of claims 3-6: X1. Application in increasing the isoamyl alcohol content in beer; X2. Application in increasing the content of 4-ethylguaiacol in beer; X3. Application in increasing the types and content of aroma substances in beer; X4. Application in improving the flavor and quality of beer.

8. The method for culturing the capsule-coated yeast of claim 1, characterized in that: The step includes culturing the capsule-coated yeast of claim 1 in a culture medium.

9. A method for preparing the microbial agent according to any one of claims 3-6, characterized in that: The step includes using the *Saccharomyces cerevisiae* as a component of the inoculum to obtain the inoculum.

Images