T1 site in non-coding region of ipa1 gene and application thereof in improving plant agronomic traits

Abstract

The application discloses a T1 site in a non-coding region of an IPA1 gene and application of the T1 site in improving plant agronomic traits. The application provides application of a substance for knocking out or changing a T1 site or a fragment containing the T1 site in a promoter of a rice genome IPA1 gene in any one of the following aspects: 1) improving rice yield; 2) improving constraints of a panicle phenotype and a tiller phenotype of rice; 3) increasing panicle weight and keeping tiller number unchanged or increasing tiller number; and 4) enhancing a panicle phenotype and a stem phenotype of rice. A large number of experiments find that the T1 site is found on a transcription factor upstream of the IPA1 promoter, and after editing of the T1 site in a receptor rice, specific regulation on phenotypes of different tissue organs is generated.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and relates to a T1 site in the non-coding region of the IPA1 gene and its application in improving plant agronomic traits. Background Technology

[0002] To ensure food security amidst global warming, increasing extreme weather events, rapid population growth, and decreasing arable land, it is necessary to efficiently and rapidly optimize the phenotypes of crops and other plants in terms of yield, quality, efficiency, and stress resistance. Mutations in gene coding regions can optimize traits by altering protein function. However, key genes determining one trait in a plant often also affect other phenotypes; this phenomenon of a single gene simultaneously regulating multiple traits is called pleiotropic gene behavior. Therefore, optimizing a trait by altering its encoded product often adversely affects other traits, thus limiting further improvements in plant performance. For example, rice yield is determined by the number of panicles per plant, the number of grains per panicle, and the average grain weight, but these three factors are mutually restrictive; improving one usually negatively impacts the other two, thus limiting yield increases. To overcome this limitation, the expression levels of genes in different tissues and organs can be differentially regulated, thereby specifically optimizing a particular trait. During crop domestication, approximately half of the domestication-related genes have mutations in their gene expression regulatory regions rather than their coding regions, indicating that altering gene expression patterns and levels is a crucial component of crop domestication. Therefore, by modifying the sequence of gene expression regulatory regions, it is possible to specifically optimize a particular trait regulated by a specific gene, while having little or no impact on other traits, thus contributing to further improvements in plant performance.

[0003] However, research on non-coding regions of genes is still very limited, with little known about their functions and a wide range of research methods and tools available. Compared to coding regions, gene expression regulatory regions (non-coding regions) exhibit lower sequence conservation, even among homologous genes. It is difficult to identify conserved regions through sequence alignment, making it challenging to infer their function from conserved segments. Chromatin immunoprecipitation followed by sequencing using target protein-specific antibodies can identify potential binding sites on the genome, but the role of this binding in gene expression regulation requires further experimental verification. The yeast one-hybrid method can screen for binding proteins using a known DNA sequence, but because the inserted DNA sequence may have self-activating activity and the yeast cell environment is not entirely the same as plant cell environments, this method is not applicable to all DNA sequences. Furthermore, the number of candidate proteins identified by this method is often large, requiring extensive further experiments to verify the authenticity of protein-DNA binding and whether the bound protein affects the biological function of the gene product. Additionally, this method is only applicable to DNA sequences with known functions, and currently lacks effective means to identify the function of sequences within specific gene expression regulatory regions. Furthermore, the above methods can only identify the interaction between proteins and nucleic acids, but other experimental methods are needed to determine the impact of this interaction on gene expression regulation and the final phenotype.

[0004] In recent years, with the rapid development of genome editing technology, it has become an effective means of crop improvement. By using genome editing systems to systematically edit different segments of gene expression regulatory regions, the effects of different segments on gene expression and plant phenotypes can be effectively identified. Some segments may specifically optimize a certain trait without causing adverse effects on other aspects. This method can quickly identify a large number of genetic resources for breeding. Beneficial edit types can be introduced into existing superior crop varieties through genome editing, thus providing a new approach for crop breeding.

[0005] IPA1 is a major regulatory gene for rice plant architecture. Its gain-of-function allelic variants, ipa1-1D and ipa1-2D, can increase the number of grains per panicle, resulting in a significant yield increase. It has been widely used in rice breeding and production and is hailed as a new "green revolution" gene. However, while increasing the number of grains per panicle, the gain-of-function allelic variants of IPA1 also decrease the number of tillers, limiting its potential for further increasing rice yield. Therefore, breaking this constraint between panicle and tiller numbers, and utilizing IPA1 to increase the number of grains per panicle without affecting or increasing the number of tillers, is the key issue for further improving the yield-increasing potential of IPA1. Summary of the Invention

[0006] One object of the present invention is to provide the application of a substance that knocks out or alters the T1 site in the promoter of the rice genome IPA1 gene or a fragment containing the T1 site.

[0007] This invention provides the application of a substance containing a T1 site or a fragment containing a T1 site in the promoter of the IPA1 gene in the rice genome in any of the following ways:

[0008] 1) Increase rice yield;

[0009] 2) Improve the constraints of panicle phenotype and tiller phenotype in rice;

[0010] The aforementioned improvements specifically enhance the phenotypes of rice in the panicle, stem, and root simultaneously, without adversely affecting other aspects of the phenotype, such as the number of tillers. In the embodiments of the present invention, the constraints on improving the panicle phenotype and tiller phenotype of rice specifically refer to increasing the panicle weight of rice while increasing or keeping the number of tillers unchanged.

[0011] 3) Increase ear weight while maintaining the same number of tillers or increase the number of tillers;

[0012] 4) Enhance the phenotype of rice panicles and stems;

[0013] 5) Cultivate rice varieties to increase yield;

[0014] 6) Cultivate rice varieties with restricted improvement in panicle and tiller phenotypes;

[0015] 7) Cultivate rice varieties with increased panicle weight while maintaining the same or increased tiller number;

[0016] 7) Cultivate rice varieties with enhanced panicle and stem phenotypes;

[0017] 8) Rice breeding;

[0018] The T1 site is GCGCGTGT;

[0019] The promoter of the rice genome IPA1 gene contains a T1 site, and the promoter is as follows:

[0020] 1) The nucleotide sequence shown in SEQ ID NO: 52;

[0021] 2) DNA molecules that hybridize with the DNA molecules defined in 1) under strict conditions and have the same function;

[0022] 3) DNA molecules defined in 1) having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology and having the same function.

[0023] The aforementioned substances that knock out the T1 site or fragments containing the T1 site in the promoter of the rice genome IPA1 gene are substances that completely or partially delete the T1 site or fragments containing the T1 site in the promoter of the rice genome IPA1 gene, thereby destroying the T1 site.

[0024] Alternatively, the substance that alters the T1 site in the promoter of the rice genome IPA1 gene can be a substance that alters the T1 site or a fragment containing the T1 site in the promoter of the rice genome IPA1 gene, thereby disrupting the T1 site. The alteration can be a complete or partial deletion, base substitution modification, fragment insertion, or a combination of these methods.

[0025] In an embodiment of the present invention, the knockout or alteration of the E7-E9 and E11 strains is taken as an example, wherein:

[0026] The nucleotide sequence of the fragment containing the T1 site is any one of the following:

[0027] 1) The DNA molecule shown in SEQ ID NO: 48 (corresponding to the genome deletion sequence in the E7 edited strain);

[0028] 2) The DNA molecule shown in SEQ ID NO: 49 (corresponding to the genome deletion sequence in the E8 edited strain);

[0029] 3) The DNA molecule shown in SEQ ID NO: 50 (corresponding to the genome deletion sequence in the E9 edited strain);

[0030] 4) The DNA molecule shown in SEQ ID NO: 51 (corresponding to the genome deletion sequence in the E11 edited strain).

[0031] The aforementioned knockout or alteration can be achieved using existing methods, such as base editing, PE site-directed deletion, gene editing, homologous recombination + gene editing, etc. Among them, gene editing can be performed using CRISPR / Cas technology, with the target sites being SEQ ID NO: 25 and 26, and the gene editing vector being the vector Vector25 in Table 1. Any substance and any method that can knock out or alter the T1 site in the promoter of the IPA1 gene in the rice genome can achieve the purpose of this invention to improve the restricted phenotypes of rice panicles and tillers.

[0032] Knockout or alteration systems can be constructed and introduced into recipient plants. Specifically, this can be done by transforming plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and then cultivating the transformed plant tissues into plants.

[0033] Another object of the present invention is to provide the following method.

[0034] This invention provides a method for increasing rice yield, comprising the following steps:

[0035] Knocking out or altering the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the rice genome disrupts the T1 site, thus obtaining the target rice.

[0036] The yield of the target rice is greater than that of the starting rice.

[0037] This invention provides a method for improving the constraints of panicle phenotype and tiller phenotype in rice, comprising the following steps:

[0038] Knocking out or altering the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the rice genome disrupts the T1 site, thus obtaining the target rice.

[0039] The panicle weight of the target rice is greater than that of the starting rice, and the number of tillers in the target rice is unchanged (no significant difference) or increased compared to the starting rice.

[0040] This invention provides a method for cultivating rice with increased yield, comprising the following steps:

[0041] Knock out the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the starting rice genome to destroy the T1 site and obtain the target rice.

[0042] The yield of the target rice or its offspring is greater than that of the starting rice.

[0043] The offspring can be produced through self-pollination or hybridization with other rice varieties.

[0044] This invention provides a method for cultivating rice with increased panicle weight while maintaining or increasing the number of tillers, comprising the following steps:

[0045] Knock out the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the starting rice genome to destroy the T1 site and obtain the target rice.

[0046] The panicle weight of the target rice or its offspring is greater than that of the starting rice, and the number of tillers of the target rice is unchanged (no significant difference) or increased compared with that of the starting rice.

[0047] This invention also protects the T1 site or fragments containing the T1 site in the promoter of the rice genome IPA1 gene.

[0048] The T1 site mentioned above is GCGCGTGT.

[0049] The nucleotide sequence of the fragment containing the T1 site is any one of the following:

[0050] 1) The DNA molecule shown in SEQ ID NO: 48 (corresponding to the genome deletion sequence in the E7 edited strain);

[0051] 2) The DNA molecule shown in SEQ ID NO: 49 (corresponding to the genome deletion sequence in the E8 edited strain);

[0052] 3) The DNA molecule shown in SEQ ID NO: 50 (corresponding to the genome deletion sequence in the E9 edited strain);

[0053] 4) The DNA molecule shown in SEQ ID NO: 51 (corresponding to the genome deletion sequence in the E11 edited strain).

[0054] The T1 site in the promoter of the rice genome IPA1 gene or a fragment containing this site in the promoter of the rice genome IPA1 gene can be used as a target in the development of products with any of the following functions:

[0055] 1) Increase rice yield;

[0056] 2) Improve the constraints of panicle phenotype and tiller phenotype in rice;

[0057] 3) Increase ear weight while maintaining the same number of tillers or increase the number of tillers;

[0058] 4) Enhance the phenotype of rice panicles and stems;

[0059] 5) Cultivate rice varieties to increase yield;

[0060] 6) Cultivate rice varieties with restricted improvement in panicle and tiller phenotypes;

[0061] 7) Cultivate rice varieties with increased panicle weight while maintaining the same or increased tiller number;

[0062] 7) Cultivate rice varieties with enhanced panicle and stem phenotypes;

[0063] 8) Rice breeding;

[0064] The T1 site is GCGCGTGT.

[0065] The rice varieties mentioned above can be genetically modified rice, including seeds, callus tissue, intact plants, and cells.

[0066] The rice variety mentioned above could be Zhonghua 11.

[0067] Gene expression regulatory sequences in the promoter region can regulate gene expression levels in different tissues. Manipulating these sequences can separately regulate different traits influenced by the genes. This invention aims to find a site that can separately regulate IPA1 expression in the panicle and tillering buds, thereby establishing a regulatory relationship between IPA1 and tillering. Editing this site or fragments containing it can increase rice yield. Extensive experiments have revealed that the T1 site upstream of the IPA1 promoter transcription factor, when edited in recipient rice, specifically regulates the phenotypes of different tissues and organs. Attached Figure Description

[0068] Figure 1 To target the location of the IPA1 gene expression regulatory region.

[0069] Figure 2 The predicted deletion locations for each CRISPR editing vector.

[0070] Figure 3 For the detection of transgenic isolation of some edited strains.

[0071] Figure 4 The phenotypes of some edited strains are shown, with the scale bar indicating 10 centimeters.

[0072] Figure 5 This indicates the location of deleted segments for some edited strains.

[0073] Figure 6 The number of tillers for some edited lines is given, and the values ​​are expressed as mean ± standard deviation (n = 10). Student's t-test was performed. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns indicates no significant difference.

[0074] Figure 7 For the ear weight of some edited lines, the values ​​are expressed as mean ± standard deviation (n = 10), and Student's t-test was performed. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns indicates no significant difference.

[0075] Figure 8 Let E7 be the yield per plant, expressed as mean ± standard deviation (n = 10). Student's t-test. ***, P < 0.001.

[0076] Figure 9 Delete the segments in E8 and E9.

[0077] Figure 10 The number of tillers for E8 and E9 is given, and the values ​​are expressed as mean ± standard deviation (n = 10). Student's t-test is performed. ns indicates no significant difference.

[0078] Figure 11The ear weights of E8 and E9 are given, expressed as mean ± standard deviation (n = 10). Student's t-test. ***, P < 0.001.

[0079] Figure 12 For E8 and E9, the yield per plant is given, and the values ​​are expressed as mean ± standard deviation (n = 10). Student's t-test. ***, P < 0.001.

[0080] Figure 13 Delete the segments for E10 and E11.

[0081] Figure 14 Let be the number of tillers for E10 and E11, expressed as mean ± standard deviation (n = 10), and use a Student's t-test. ns indicates no significant difference.

[0082] Figure 15 The ear weights for E10 and E11 are given, and the values ​​are expressed as mean ± standard deviation (n = 10). Student's t-test was performed. ***, P < 0.001; ns indicates no significant difference.

[0083] Figure 16 The yield per plant for E10 and E11 is given, and the values ​​are expressed as mean ± standard deviation (n = 10). Student's t-test was performed. ***, P < 0.001; ns indicates no significant difference. Detailed Implementation

[0084] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0085] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0086] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the biochemical, molecular biological, genetic, and other related terms and laboratory procedures used herein are all widely used terms and routine procedures in their respective fields. For example, the recombinant DNA technology and molecular cloning technology used in this invention are well known to those skilled in the art and are described more fully in the following literature: Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989. Unless otherwise specified, all materials and reagents used in this invention are commercially available. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0087] The terms "Cas9 nuclease" and "Cas9" are used interchangeably in this article, referring to RNA-guided nucleases that include the Cas9 protein or fragments thereof (such as proteins containing the Cas9 endonuclease domain and / or guide RNA binding domain). Cas9 is a component of the CRISPR / Cas (clustered, regularly spaced short palindromic repeats and their associated proteins) genome editing system, which uses guide RNA to target and cleave DNA target sequences to form DNA double-strand breaks (DSBs).

[0088] "Guide RNA" and "gRNA" are used interchangeably in this article. They are usually composed of a complex formed by partial complementarity between CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The crRNA contains a sequence that is complementary to the target sequence and specifically guides the CRISPR complex (Cas9+crRNA+tracrRNA) to bind to the target sequence. When using the CRISPR system for gene editing and other applications, single guide RNA (sgRNA) can be artificially designed, which contains the characteristics of both crRNA and tracrRNA in one RNA strand and guides the CRISPR complex to bind specifically to the target sequence.

[0089] When used to refer to plants, "genome" not only refers to chromosomal DNA in the cell nucleus, but also includes DNA found in organelles such as chloroplasts and mitochondria.

[0090] The rice variety Zhonghua 11, a conventional japonica rice variety, denoted as ZH11, is used as the recipient material for transgenic and gene editing in this invention.

[0091] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0093] In the following examples, ear weight refers to the weight of a single ear per plant; tiller number refers to the number of tillers per plant; and yield refers to the yield per plant.

[0094] Example 1: Discovery and determination of T1 sites for regulating panicle and tillering control in rice

[0095] I. Rice IPA1 gene editing

[0096] 1. Identification of gene editing regions and design of target sequences for the IPA1 gene.

[0097] Genomic regions that regulate IPA1 gene expression were identified. Based on previous studies on IPA1 and gene expression regulation (Zhang et al. (2017) A natural tandem array alleviates sepigenetic repression of IPA1 and leads to superior yielding rice. Nat. Commu. 8, 14789), the 2kb upstream of the transcription start site and the 1kb downstream of the transcription termination site of the IPA1 gene (genbank code: LOC4345998, submitted on September 26, 2021) were identified as the regions to be edited.

[0098] Editing sites suitable for CRISPR-Cas9 are designed within a defined region. In addition to possessing the PAM sequence required by the Cas9 protein used (NGG and NAG in this example), the designed targets must also have high sequence specificity to avoid off-target effects. This invention designs a total of 39 targets SEQ ID NO: 1-39 (…). Figure 1 ).

[0099] 2. Preparation of CRISPR vectors for gene editing of the IPA1 gene

[0100] Based on the location of the designed target on the genome, two adjacent target sites were linked into the same CRISPR vector. The information of the construct is listed in Table 1.

[0101] Each CRISPR vector in Table 1 was constructed according to the method described in the Plant Cas9 / gRNA Plasmid Construction Kit (Vishang Lide Biotechnology Co., Ltd., catalog number VK005-1), as follows:

[0102] Two adjacent target sites were constructed into the BSAI site of the vk005-1 (Vishanglide Biotechnology Co., Ltd., catalog number vk005-1) vector, respectively, to obtain vk005-1-g1 and vk005-1-g2; the vk005-1-g1 vector was then digested with AscI+Spel enzyme, and the resulting short fragment was inserted into the vk005-1-g2 vector digested with AscI+AvrII enzyme, named a CRISPR vector, which contains two adjacent target sites.

[0103] Table 1 lists CRISPR editing vectors and their corresponding targets.

[0104]

[0105]

[0106] 3. Gene Editing

[0107] Each CRISPR vector, after transformation into rice, is expected to cause fragment deletion between the two sgRNA target sites. All deleted fragments can relatively evenly cover the IPA1 uncoding region. Figure 2 The details are as follows:

[0108] The 38 gene-editing CRISPR vectors obtained in step 2 above were transformed into Agrobacterium EHA105 strain, resulting in 38 Agrobacterium strains containing different editing vectors.

[0109] Thirty-eight strains of Agrobacterium containing different editing vectors were mixed in equal proportions (equal bacterial counts) and then transformed into the rice cultivar Zhonghua 11 according to the method of Shan et al. (Shan et al. (2013) Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 31, 686-688), resulting in approximately 800 transformed lines.

[0110] 4. Identification

[0111] Using T-DNA specific primers to detect the target sequence contained in the transfected T-DNA in partially transformed rice lines, we can identify whether the seedlings are transgenic positive and identify the sgRNA contained therein, so as to determine the editing location and select appropriate genome identification primers.

[0112] The T-DNA specific primer sequences mentioned above are SEQ ID NO: 40 and SEQ ID NO: 41.

[0113] The rice lines that yielded the 1007bp amplified fragment were positively transformed, and the sgRNA sequence contained therein was subsequently determined by sequencing.

[0114] Table 2 lists T-DNA specific primers.

[0115] SEQ ID NO: 40 CTAAGGCAGGGTTGGTTACG SEQ ID NO: 41 AATATGGGGTTTTTGTTGCTCCC

[0116] Based on the location of the sgRNA target site on the rice genome, one pair of primers was selected from the following three pairs of IPA1 non-coding region-specific primers to detect genome editing in the above-mentioned positive transformed rice lines. The three pairs of primers are SEQ ID NO: 42 and SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47. Among them, SEQ ID NO: 42 and 43 detect the region 2kb to 1kb upstream of the IPA1 transcription start site; SEQ ID NO: 44 and 45 detect the region 1kb upstream of the IPA1 transcription start site; and SEQ ID NO: 46 and 47 detect the region 1kb downstream of the IPA1 transcription termination site.

[0117] The amplified sequence was sequenced and compared with the genome sequence of the IPA1 uncoding region on rice chromosome 8 (genbank gene number: LOC4345998, submission date: September 26, 2021) to identify the plant type whose genome was edited.

[0118] A strain that amplifies the target fragment using any primer pair is a strain with gene editing in the IPA1 non-coding region.

[0119] Table 3 lists the primers specific to the non-coding region of IPA1.

[0120]

[0121]

[0122] II. Rice IPA1 gene-edited lines and corresponding phenotypes

[0123] 1. Continue to plant the lines with gene editing in the IPA1 non-coding region obtained above into the next generation, with 10 plants in each line, to obtain the T1 generation lines with gene editing in the IPA1 non-coding region.

[0124] To prevent non-specific editing that might result from persistently high Cas9 expression in T-DNA, transgene segregation was identified from T1 generation plants. The method involved PCR amplification of the genomic DNA of T1 generation lines with gene editing in the IPA1 non-coding region using T-DNA specific primers SED ID No. 40 and 41, followed by agarose gel electrophoresis to detect transgene segregation. The rice variety Zhonghua 11 was used as a control.

[0125] Some results are as follows Figure 3 As shown, E1-E7 could not be amplified by T-DNA specific primers, indicating that E1-E7 are edited lines from which the transgene has been isolated.

[0126] To prevent non-specific editing that may result from persistent high expression of the Cas9 protein, the E1-E7 edited lines were then subjected to IPA1 non-coding region-specific primers to detect genome editing, followed by amplification and sequencing.

[0127] SEQ ID NO: 44 and SEQ ID NO: 45 identify the E1-E11 edited strains;

[0128] The resulting plants with the target fragment were homozygous edits to the IPA1 non-coding region. Lines with duplicate edits were excluded, and the remaining lines were used for phenotypic identification. Lines E1-E7 with homozygous edits to the IPA1 non-coding region were obtained.

[0129] Using the same identification method, strains E8 and E9 with homozygous editing of the IPA1 non-coding region were also obtained.

[0130] Based on sequencing results analysis, the gene editing types of the IPA1 non-coding region homozygous edited lines E1-E7 used for phenotypic identification are as follows:

[0131] The homozygous edited IPA1 non-coding region line E1: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the tcgtcggagtaggggcgctcggggtatggggctcggcggaggc (SEQ ID NO: 52, positions 190-232) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted.

[0132] The IPA1 non-coding region homozygous edited line E2: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only gctcggggtatggggctcggcggaggctcgctggagtaggggc (SEQ ID NO: 52, positions 206-248) and tacgcagctccggtgctgc (SEQ ID NO: 52, positions 394-412) upstream of the transcription start site in the promoter region of the IPA1 gene were deleted.

[0133] The IPA1 non-coding region homozygous edited line E3: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only gcgcctccaccgtcgacgacagcgccgct (SEQ ID NO: 52 positions 411-439) and gagaagacacgagagaattaggtggagg (SEQ ID NO: 52 positions 639-666) upstream of the transcription start site in the promoter region of the IPA1 gene were deleted.

[0134] The homozygous edited IPA1 non-coding region line E4: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the ccctggagaagacacgagagaattaggtggagg (SEQ ID NO: 52, positions 634-666) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted.

[0135] The homozygous edited IPA1 non-coding region line E5: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the gcgccgttcgccggtgctgccgagctccgccgcgcctgccggagcacgctgccatggccg (SEQ ID NO: 52, positions 574-633) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted.

[0136] The homozygous edited IPA1 non-coding region line E6: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the following deletion was made upstream of the transcription start site in the promoter region of the IPA1 gene: atggccgccctggagaagacacgagagaattaggtggagggtgggggaagggtgagattttttatattatc tatgggtcccattataaattttctaaaccacacttatactgtgggtgca (SEQ ID NO: 52, positions 627-746).

[0137] The IPA1 non-coding region homozygous edited line E7: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the cgcgcgtgtgagggtgtgaggataatttttattttaagtggtttttaagggcgg (SEQ ID NO: 52, positions 876-929) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted. The corresponding target site is the vector Vector25 in Table 1, which contains target sites SEQ ID NO: SED ID No. 25 and 26.

[0138] 2. Phenotypic identification

[0139] Twenty-four plants of each of the homozygous edited IPA1 non-coding region lines E1-E7 obtained in step 1 were planted, and ten of them were selected for phenotypic identification.

[0140] The phenotypes identified included: number of tillers, panicle weight, number of grains per panicle, number of primary and secondary branches per panicle, seed setting rate, thousand-grain weight, and yield per plant. The cultivated rice variety Zhonghua 11 was used as the wild-type control (ZH11).

[0141] The results are as follows Figure 4 As shown, some edited lines exhibit phenotypic changes in one or more aspects compared to the wild type. In particular, the magnitude of changes in various aspects of phenotypic changes in these lines are not necessarily correlated, indicating that editing the non-coding region of IPA1 may have different regulatory effects on IPA1 expression in different tissues, resulting in different degrees of impact on IPA1 function in different tissues.

[0142] Analysis of the deletion sites on the IPA1 promoter in these phenotypic altered lines revealed that the deleted fragments were distributed across multiple locations on the IPA1 promoter, indicating the presence of numerous transcriptional regulatory sites on the IPA1 promoter that can influence tissue-specific expression of IPA1. Figure 5 This demonstrates that the method of the present invention can effectively discover sequence regions on non-coding regions such as gene promoters that play an important role in gene expression.

[0143] Statistical analysis of tiller number and ear weight in these lines revealed that deletion of the IPA1 promoter fragment could either increase or decrease tiller number and ear weight in the edited lines. Furthermore, some edited lines broke the negative correlation between tiller number and ear weight; for example, E1 could simultaneously decrease both tiller number and ear weight, while E7 could simultaneously increase both. Some lines could also specifically regulate one phenotype without affecting others. For instance, E2 could specifically decrease ear weight without affecting tiller number, E4 and E5 could specifically decrease tiller number without affecting ear weight, and E6 could specifically increase tiller number without affecting ear weight. Figures 6-7 ).

[0144] Among these edited lines, E7 can simultaneously increase tiller number and ear weight, exhibiting excellent yield potential. Therefore, further testing of single-plant yield in E7 revealed that deletion of the IPA1 promoter fragment in E7 can significantly increase the yield of the edited lines, with yield increases exceeding 100% under experimental field planting conditions. Figure 8 ).

[0145] The transcription factor binding sites that may exist on the deletion sequence of the IPA1 promoter in E7 were predicted using the plant cis-acting element prediction database (the E7 deletion sequence is SEQ ID NO: 48: CGCGCGTGTGAGGGTGTGAGGATAATTTTTATTTTAAGTGGTTTTTAAGGGCGG). A T1 site sequence of GCGCGTGT was found to exist on it.

[0146] 3. Analysis of independent edited lines E8 and E9 with T1 site deletion

[0147] To verify whether T1 deletion is the cause of the E7 phenotypic change, the lines E8 and E9, which were obtained by the method described in section 1 above with T1 deletion, were analyzed.

[0148] The IPA1 non-coding region homozygous edited line E8: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the ggacgcattgctactgcccttgtaccctgctataagaagataaccaatgacatctccactcgattttctcg gcgcgcgtgtgaggg (SEQ ID NO: 49, SEQ ID NO: 52 positions 804-889) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted. The corresponding target site is the vector Vector25 in Table 1, which contains target sites SEQ ID NO: SED ID No. 25 and 26.

[0149] The IPA1 non-coding region homozygous edited line E9: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the gtaccctgctataagaagataaccaatgacatctccactcgattttctcggcgcgcgcgtgtgagg (SEQ ID NO: 50, SEQ ID NO: 52 positions 825-888) upstream of the transcription start site in the promoter region of the IPA1 gene was deleted. The corresponding target site is the vector Vector25 in Table 1, which contains target sites SEQ ID NO: SED ID No. 25 and 26.

[0150] After comparison, it was found that the two independently edited strains, E8 and E9, only overlapped with the deletion fragment in the constructed E7 strain obtained from step 1 of the above two methods at the T1 site. The deletion fragment of E8 is SEQ ID NO: 49: ggacgcattgctactgcccttgtaccctgctataagaagataaccaatgacatctccactcgattttctcggcgcgcgcgtgtgaggg (SEQ ID NO: 52, positions 804-889), which overlaps with the deletion fragment of E7, SEQ ID NO: 48, by 14 bp. The deletion fragment of E9 is SEQ ID NO: 50: gtaccctgctataagaagataaccaatgacatctccactcgattttctcggcgcgcgcgtgtgagg (SEQ ID NO: 52, positions 825-888), which overlaps with the deletion fragment of E7, SEQ ID NO: 49. NO:48 has a 13bp overlap, and the regions where the E8, E9, and E7 deletion fragments overlap all contain an 8bp T1 site. Figure 9 ).

[0151] Twenty-four plants of each of the homozygous edited IPA1 non-coding region lines E8-E9 obtained in step 1 were planted, and ten of them were selected for phenotypic identification.

[0152] The number of tillers in E8 and E9 was examined, and no significant difference was found compared with the wild-type control, Hua 11, indicating that the deletion of the T1 site was not the reason for the increased number of tillers in E7. Figure 10 ).

[0153] The ear weight of E8 and E9 was examined, and it was found that deletion of the fragment in E8 and E9 significantly increased ear weight, indicating that deletion at the T1 site was the cause of the increased ear weight in E7. Figure 11 ).

[0154] Further analysis of the yield per plant for E8 and E9 revealed that E8 and E9 significantly increased the yield per plant. Figure 12 ).

[0155] Therefore, it can be seen that E7, E8, and E9 plants all had a segment containing the 8bp T1 site deleted. Compared with wild-type rice, E7 plants simultaneously increased tillering number and panicle weight, while E8 and E9 plants maintained the same tillering number but increased panicle weight, thus achieving increased yield. This indicates that knocking out or altering the T1 site or a segment containing the T1 site in the promoter of the IPA1 gene in the rice genome can improve the constraints on panicle and tillering phenotypes in rice, thereby increasing rice yield.

[0156] The above-mentioned E7-E9 strains can all be processed using existing methods, such as base editing, PE site-specific deletion, gene editing, homologous recombination + gene editing, etc. Among them, gene editing can be performed using CRISPR / Cas technology, with the target sites being SEQ ID NO: 25 and 26, and the gene editing vector being Vector25 in Table 1; to achieve site-specific deletion of the corresponding deletion fragment, the E7-E9 strains with homozygous editing of the target IPA1 non-coding region are obtained.

[0157] Comparative example: lines retaining the T1 site

[0158] To further verify whether the increased panicle weight phenotype in E7, E8, and E9 was caused by the deletion of the 8bp T1 site, the same CRISRP vector as E7, E8, and E9 (Vector25 in Table 1, containing sgRNAs SEQ ID NO: 25 and SEQ ID NO: 26) was constructed and rice was transformed using the same method as in Example 1 to obtain transformed lines.

[0159] After identifying the positive transformed rice lines using T-DNA specific primers, amplification was performed using primers SEQ ID NO: 44 and 45. The lines that yielded the PCR products were lines with gene editing in the IPA1 non-coding region.

[0160] The lines with gene editing in the IPA1 non-coding region were further planted according to the method in Example 1, Part 2, to obtain lines E10 and E11 with homozygous editing in the IPA1 non-coding region.

[0161] The homozygous edited IPA1 non-coding region line E10: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the taccctgctataagaagataaccaatgacatctccactcgattttctcgg (SEQ ID NO: 52, positions 826-875) and gagggtgt (SEQ ID NO: 52, positions 885-892) upstream of the transcription start site in the promoter region of the IPA1 gene were deleted. It contains the E8 deletion fragment, but the T1 site is retained.

[0162] The IPA1 non-coding region homozygous edited line E11: Compared with the IPA1 gene on chromosome 8 of the wild-type rice cultivar Zhonghua 11 (genbank gene number: LOC4345998, submission date: September 26, 2021), only the TTTCTCGGCGCGCGTGTGAGGGTGTGAGGATAAT (SEQ ID NO: 51, SEQ ID NO: 52 positions 867-901) upstream of the transcription start site in the IPA1 gene promoter region was deleted, which includes the T1 site and the 10 bp upstream of T1 and the 17 bp downstream of T1 site (…). Figure 13 ).

[0163] The aforementioned E10-E11 strains can all be obtained using existing methods: combining homologous recombination and gene editing to achieve site-specific deletion of the corresponding deletion fragment, resulting in E10-E11 strains with homozygous editing of the target IPA1 non-coding region.

[0164] 2. Phenotypic detection

[0165] Twenty-four plants of each unique edit type from the homozygous edits of the IPA1 non-coding region obtained from E10 and E11 were planted, and ten of them were selected for phenotypic identification. The phenotypic characteristics identified included: number of tillers, panicle weight, and yield per plant. The cultivated rice variety Zhonghua 11 was used as the wild-type control (ZH11).

[0166] The number of tillers in E10 and E11 was examined, and no significant difference was found between their tiller numbers and those in the wild-type control, Flower 11. This indicates that deletion or non-deletion of the T1 site does not affect the number of tillers. Figure 14 ).

[0167] The ear weight of E10 and E11 was tested, and it was found that the deletion of the fragment in E11 significantly increased the ear weight, while the deletion of the fragment in E10 did not affect the ear weight. Since E10 and E8 have almost the same sequence deletion, but E8 deleted the T1 site while E10 retained the T1 site, it indicates that the deletion of the T1 site is the reason for the increase in ear weight. Figure 15 ).

[0168] Further analysis of individual plant yields in E10 and E11 revealed that E11 significantly increased plant yield, while the deletion of the fragment in E10 did not affect individual plant yield. Since E10 and E8 have almost identical sequence deletions, but E8 deleted the T1 site while E10 retained the T1 site, this indicates that the deletion of the T1 site is the cause of the increased individual plant yield. Figure 16 ).

[0169] Multiple independent edited lines showed increased ear weight and yield per plant when the T1 site was deleted or removed. However, when the T1 site was deleted but the T1 site was retained, no phenotype of increased ear weight and yield per plant was observed. This indicates that deletion of the T1 site can increase ear weight and thus increase yield per plant.

[0170] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. SEQUENCE LISTING <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> A T1 site in the non-coding region of the IPA1 gene and its application in improving plant agronomic traits. <160> 52 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <400> 1 gttatatgtg tacgagaggc 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 attagattgg ctagctataa 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 atcacacaca cgttaggtct 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 tatagtgttc aaagtacatg 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 aaatgaagat actaaacctg 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 tttagcatta ttaaaacgtg 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 ttataacaat gctacacatt 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 aaattgtaca aaaatacctg 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 ccacgtcctt gcactttaaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 aaacttggtc acacgaagct 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 11 aaaagttgct gaggttcgtt 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 cgctttcttg tttctcgcgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <400> 13 gctcggggta tggggctcgg 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <400> 14 cgcgtgtggc tacgcagctc 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <400> 15 ccgtcgacga cagcgccgct 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <400> 16 ccgctccacc cggttggagg 20 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <400> 17 cctgccggag cacgctgcca 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 ccatggcagc gtgctccggc 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 gcacgctgcc atggccgccc 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 cgagagaatt aggtggaggg 20 <210> 21 <211> 20 <212> DNA <213> Artificial sequence <400> 21 tggtttagaa aatttataat 20 <210> 22 <211> 20 <212> DNA <213> Artificial sequence <400> 22 ctaaaccaca cttatactgt 20 <210> 23 <211> 20 <212> DNA <213> Artificial sequence <400> 23 cccacagtat aagtgtggtt 20 <210> 24 <211> 20 <212> DNA <213> Artificial sequence <400> 24 agctgcaaca taggtggttt 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 cttcttatag cagggtacaa 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <400> 26 ggcgcgcgtg tgagggtgtg 20 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <400> 27 gagagaggaa agagacggaa 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <400> 28 ccacccgcga ccgcgagcaa 20 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 cttgcgggac gacagatcga 20 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <400> 30 aaaggaaatt ctaaggtgac 20 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <400> 31 ttcatggaga gttacataga 20 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <400> 32 tctgcttatt attctggtgc 20 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <400> 33 atacaggccg agaagtgaaa 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <400> 34 ctggaaggct ggaaacatac 20 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <400> 35 gctctgctgc tgagtattgt 20 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <400> 36 gtgagaccac atgcacagcg 20 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <400> 37 gagaggagga tgatccatgt 20 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <400> 38 tctatcatca cagaaaagca 20 <210> 39 <211> 20 <212> DNA <213> Artificial sequence <400> 39 agcaacaacc cagcaaacag 20 <210> 40 <211> 20 <212> DNA <213> Artificial sequence <400> 40 ctaaggcagg gttggttacg 20 <210> 41 <211> 23 <212> DNA <213> Artificial sequence <400> 41 aatatggggt ttttgttgct ccc 23 <210> 42 <211> 21 <212> DNA <213> Artificial sequence <400> 42 ttgaatctcg tttagagcag g 21 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <400> 43 ctactccgac gagcctcctt 20 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <400> 44 gtggcgtgtg gcaatgtaga 20 <210> 45 <211> 21 <212> DNA <213> Artificial sequence <400> 45 ggagccttgg aatgcatgaa g 21 <210> 46 <211> 22 <212> DNA <213> Artificial sequence <400> 46 tgctgtattg tcgaggactt ct 22 <210> 47 <211> 24 <212> DNA <213> Artificial sequence <400> 47 acaactgtgt caaatcttgc atgt 24 <210> 48 <211> 54 <212> DNA <213> Artificial sequence <400> 48 cgcgcgtgtg agggtgtgag gataattttt attttaagtg gtttttaagg gcgg 54 <210> 49 <211> 86 <212> DNA <213> Artificial sequence <400> 49 ggacgcattg ctactgccct tgtaccctgc tataagaaga taaccaatga catctccact 60 cgattttctc ggcgcgcgtg tgaggg 86 <210> 50 <211> 64 <212> DNA <213> Artificial sequence <400> 50 gtaccctgct ataagaagat aaccaatgac atctccactc gattttctcg gcgcgtgt 60 gagg 64 <210> 51 <211> 35 <212> DNA <213> Artificial sequence <400> 51 ttttctcggc gcgcgtgtga gggtgtgagg ataat 35 <210> 52 <211> 1000 <212> DNA <213> Artificial sequence <400> 52 cgtgtggcaa tgtagagcca cgtaggcaag tcgcttgcgt ggaggagaga ggggagtggg 60 gaccgttccc aacccagctt cgtgtgacca agttggcca cacgggccaa acgaacctca 120 gcaacttttg tcagaaagaa aagaacctcc gcgagaaaca agaaagcgag agagggagag 180 aaaggaggct cgtcggagta ggggcgctcg gggtatgggg ctcggcggag gctcgctgga 240 gtaggggccg ccactgcgtg gggctcgccg gagtaggggc gctcggggag cctcccgaga 300 tccgccgctc agcggcgccg ccgtcttccg ggcagagctc tcgaagctcg cctcctcgc 360 gcgccggtgg cgttggcggg gccgcgtgt ggctacgcag ctccggtgct gcgcctccac 420 cgtcgacgac agcgccgctt ggcgctgccg ccgtcttccg ccgcgccgct ggacgccgcc 480 agatctgctg ctcgtcgccg cgtgggccgc tccacccggt tggaggagga gaggcggcgc 540 cgcgcttggg ctgccccacc gccgagctct gccgcgccgt tcgccggtgc tgccgagctc 600 cgccgcgcct gccggagcac gctgccatgg ccgccctgga gaagacacga gagaattagg 660 tggagggtgg gggaagggtg agatttttta tattatctat gggtcccatt ataaattttc 720 taaaccacac ttatactgtg ggtgcagtgt catttagagt tcccaaacca cctatgttgc 780 agctgtggta taacaatttg ctaggacgca ttgctactgc ccttgtaccc tgctataaga 840 agataaccaa tgacatctcc actcgatttt ctcggcgcgc gtgtgagggt gtgaggataa 900 tttttatttt aagtggtttt taagggcgga gagagagaga gagagagggc accgcactac 960 ttctacttgt gtgtgtgtcg ctcgctgggc ttcgccacct 1000

Claims

1. Applications of substances that knock out the T1 site in the promoter of the IPA1 gene in the rice genome, or fragments containing the T1 site, in any of the following: 1) Increase the yield per rice plant; 2) Improve rice yield per plant; The T1 site is GCGCGTGT; The promoter of the rice genome IPA1 gene contains the T1 site, and the promoter is the nucleotide sequence shown in SEQ ID NO: 52; The substance that knocks out the T1 site in the promoter of the rice genome IPA1 gene or contains a fragment containing the T1 site is a CRISPR system; The targets of the CRISPR system are SEQ ID NO: 25 and SEQ ID NO: 26, and the carrier of the CRISPR system is Vector25; The vector Vector25 was constructed by first constructing SEQ ID NO: 25 and SEQ ID NO: 26 into the BSAI site of the vk005-1 vector, respectively, to obtain vk005-1-g1 and vk005-1-g2; then the vk005-1-g1 vector was digested with AscI+Spel enzyme, and the resulting short fragment was inserted into the vk005-1-g2 vector digested with AscI+AvrII enzyme, to obtain the vector.

2. A method for increasing the yield per rice plant, comprising the following steps: Knock out the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the starting rice genome to destroy the T1 site and obtain the target rice. The yield of the target rice is greater than that of the starting rice; The knockout of the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the rice genome is achieved by introducing the Vector25 vector described in claim 1 into rice. The T1 site is GCGCGTGT; The promoter of the rice genome IPA1 gene contains a T1 site, and the promoter is the nucleotide shown in SEQ ID NO:

52.

3. A method for cultivating rice with increased yield per plant, comprising the following steps: Knock out the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the starting rice genome to destroy the T1 site and obtain the target rice. The knockout of the T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the rice genome is achieved by introducing the Vector25 vector described in claim 1 into rice. The yield per plant of the target rice or its offspring is greater than that of the starting rice; The T1 site is GCGCGTGT; The promoter of the rice genome IPA1 gene contains a T1 site, and the promoter is the nucleotide shown in SEQ ID NO:

52.

4. The T1 site or a fragment containing the T1 site in the promoter of the IPA1 gene in the rice genome; The T1 site is GCGCGTGT; The nucleotide sequence of the fragment containing the T1 site is any one of the following: 1) The DNA molecule shown in SEQ ID NO: 48; 2) The DNA molecule shown in SEQ ID NO: 49; 3) The DNA molecule shown in SEQ ID NO: 50; 4) The DNA molecule shown in SEQ ID NO: 51.

Images