A functional gene for delaying postharvest apple fruit softening quality improvement

Abstract

The application discloses a functional gene for delaying postharvest apple fruit softening quality improvement, and belongs to the technical field of fruit and vegetable preservation and plant genetic engineering technology. A B-Box (BBX) transcription factor MdBBX25 isolated from an apple is obtained, and the nucleotide sequence of the MdBBX25 is shown as SEQ ID NO. 1. It is found through qRT-PCR technology analysis that the expression amount of the MdBBX25 gene in a 'Jinguan bud mutant' apple variety (with a faster softening speed) is lower than that in a 'Jinguan' apple variety. Subcellular localization shows that the transcription factor is located in the nucleus. Through apple transient injection experiments, paraffin section observation, physiological data determination and gene expression analysis, it is shown that overexpression of the MdBBX25 can delay apple fruit softening by inhibiting ethylene biosynthesis and cell wall degradation, and silencing of the MdBBX25 can accelerate apple fruit softening by promoting ethylene biosynthesis and cell wall degradation, which shows that the MdBBX25 has obvious effects on delaying postharvest apple fruit softening quality. The exploration of the MdBBX25 gene provides a basis for improving the internal quality of the apple fruit.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the use of the apple MdBBX25 gene in delaying postharvest apple fruit softening quality. Background Technology

[0002] Apples, one of the world's four major fruit trees, are a primary cultivated species in temperate regions. my country, with its vast territory, fertile soil, and suitable climate, boasts the richest diversity of apple species, possessing the world's highest apple production and largest cultivated area. The rate of fruit softening not only affects post-harvest shelf life but also significantly impacts other economically important aspects, such as harvest frequency, handling procedures, and fruit transport distance. The ideal degree of softening can vary depending on the variety and cultivar, as excessive softening often leads to post-harvest rot or consumer rejection. Therefore, a deeper understanding of the underlying mechanisms leading to apple fruit softening can provide valuable insights for preventing undesirable texture deterioration and extending shelf life.

[0003] Fruit firmness is closely related to its softening and plays a crucial role in determining overall palatability and transportability. Fruit firmness is primarily influenced by the integrity of the cell wall structure and the characteristics of the cuticle. Cell wall degradation, leading to a loosened cell structure, is a key factor causing the fruit to gradually lose firmness during ripening. Numerous studies have shown that the disintegration of cell wall polysaccharides plays a significant role in fruit softening. The softening characteristics of fruit can be largely attributed to changes in the activity of cell wall-related enzymes, including polygalacturonase (PG), β-glucosidase (BGL), cellulase, expansin (EXP), endoglucanase / hydrolase (XTH), endoglucanase (GLU), xylanase, β-galactosidase, UDP-arabinose-4-imidease, xylan, and pectin methyl esterase.

[0004] During fruit ripening and development, fruit texture softening is jointly regulated by multiple transcription factors and genes. Clarifying the mechanisms by which transcription factors influence and regulate fruit quality provides new directions for fruit quality improvement breeding. B-box (BBX) proteins are a class of transcription factors with zinc finger structures, composed of one or two B-box motifs (CX2CX8CX7CX2CX4HX8H) in the N-terminal region. In some cases, they may also include a CCT (CONSTANS, CO-like, and TOC1) domain near the carboxyl terminus. BBX proteins play a crucial role in regulatory networks that govern various growth and development processes, including photomorphogenesis in seedlings, photoperiod regulation during flowering, shading, and responses to biotic and abiotic stresses. Recent studies have revealed other roles of BBX proteins in various biological processes, including thermomorphogenesis, anthocyanin accumulation, carotenoid biosynthesis, flavonoid biosynthesis, and leaf senescence. However, to date, no publicly available reports have demonstrated that BBX proteins are involved in changes in fruit texture. Summary of the Invention

[0005] To address the problem of postharvest apple fruit softening caused by accelerated ethylene biosynthesis and cell wall degradation, this invention provides a functional gene for delaying postharvest apple fruit softening and improving quality.

[0006] An application of a functional gene, as shown in SEQ ID NO.1 of the nucleotide sequence listing, in delaying postharvest apple fruit softening and improving quality involves cloning the functional gene shown in SEQ ID NO.1 into an overexpression vector. Overexpression of the functional gene inhibits ethylene biosynthesis and cell wall degradation in apples, delays the decrease in apple fruit firmness, slows down the ripening and senescence process, and achieves delayed postharvest apple fruit softening.

[0007] The further defined technical solution is as follows:

[0008] The overexpression vector is pSuper1300.

[0009] This refers to the application of using genetic engineering techniques to introduce the functional gene shown in SEQ ID No. 1 into apple varieties with poor storage resistance, thereby enhancing their storage resistance.

[0010] The beneficial technical effects of this invention are reflected in the following aspects:

[0011] (1) This invention helps to elucidate the mechanism of action of the apple BBX gene in regulating apple softening from a molecular perspective, providing a theoretical basis and gene resources for apple molecular-assisted breeding and genetic engineering breeding. Through apple transient injection experiments, paraffin section observation, physiological data measurement, and gene expression analysis, it was shown that overexpression of MdBBX25 can delay apple fruit softening by inhibiting ethylene biosynthesis and cell wall degradation, while silencing MdBBX25 can accelerate apple fruit softening by promoting ethylene biosynthesis and cell wall degradation, indicating that MdBBX25 has a significant effect on delaying the softening quality of postharvest apple fruit.

[0012] (2) MdBBX25 can guide the quality maintenance of apple fruits during postharvest storage. By detecting changes in the expression level of the MdBBX25 gene, it can be determined whether apple varieties are suitable for long-term storage, reduce storage losses, and improve production efficiency.

[0013] (3) Genetic engineering techniques can be used to introduce the MdBBX25 gene into apple varieties with poor storage resistance to improve apple varieties and enhance their storage resistance. Attached Figure Description

[0014] Figure 1 A diagram illustrating the analysis of the BBX transcription factor family in transcriptome sequencing;

[0015] Figure 2 Graphs showing the expression levels of the BBX gene in apple fruits of 'Golden Delicious' and 'Golden Delicious Bud Mutation' at different storage times;

[0016] Figure 3 Subcellular localization of the MdBBX25-GFP fusion protein in onion epidermal cells;

[0017] Figure 4 Phenotypic and paraffin section images of apple fruits infected with the overexpression vector;

[0018] Figure 5 A graph showing the physiological data of apple fruits after the overexpression vector was infected with the fruit.

[0019] Figure 6 This is a diagram showing the gene expression pattern of MdBBX25 related to ethylene biosynthesis and cell wall degradation after the overexpression vector infects apple fruit.

[0020] Figure 7 Phenotypic and paraffin section images of apple fruits infected with a silencing vector;

[0021] Figure 8 A graph showing the physiological data of apple fruits after being infected with a silencing vector.

[0022] Figure 9This diagram illustrates the gene expression patterns of MdBBX25 related to ethylene biosynthesis, cell wall degradation, and other processes after the silencing vector infects apple fruit. Detailed Implementation

[0023] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0024] Current reports on BBX mainly focus on photomorphogenesis, flowering, and biotic stress, with no reports on its role in regulating fruit texture. Identifying and functionally studying the apple BBX gene is of significant theoretical importance.

[0025] This invention involved in-depth research, resulting in the isolation and cloning of the apple MdBBX25 (MD08G1049600) gene from 'Golden Delicious' apples. The full-length cDNA is 990 bp and is documented in the JGI database (https: / / phytozome-next.jgi.doe.gov).

[0026] An application of a functional gene, as shown in SEQ ID NO.1 of the nucleotide sequence listing, in delaying the softening of apple fruit after harvest and improving its quality, involves cloning the functional gene shown in SEQ ID NO.1 into the overexpression vector pSuper1300. Overexpression of the functional gene inhibits ethylene biosynthesis and cell wall degradation in apples, delays the decrease in apple fruit firmness, slows down the ripening and senescence process, and achieves the goal of delaying the softening of apple fruit after harvest.

[0027] In the functional gene shown in SEQ ID NO.1 of the nucleotide sequence listing, ATG represents the start codon and TAG represents the stop codon. (The full length of the sequence listed above is consistent with the sequence in the database).

[0028] This invention utilizes genetic engineering techniques to introduce the functional gene shown in SEQ ID No. 1 into apple varieties with poor storage resistance, thereby enhancing their storage resistance.

[0029] To investigate the function of the gene MdBBX25, this invention constructed overexpression and silencing vectors for the gene MdBBX25. Specifically:

[0030] The gene overexpression vector was constructed as follows:

[0031] Forward and reverse primers for MdBBX25 were designed, and the gene sequence was cloned from the cDNA of *Agrobacterium tumefaciens*. The sequence was then constructed into the plant overexpression vector pSuper1300 using XbaⅠ and SmaⅠ double restriction sites, forming the fusion plasmid MdBBX25-pSuper1300. This plasmid was then transformed into *Agrobacterium tumefaciens* GV3101 using a freeze-thaw method. The primer sequences are as follows:

[0032] MdBBX25(XbaⅠ)-F:GCTCTAGACATGGCATCGAAGCTCTGCGAC(SEQ IDNO.2)

[0033] MdBBX25(SmaⅠ)-R:TCCCCCGGGAAAACGACGGAACGACGCCGTA(SEQ IDNO.3)

[0034] The gene silencing vector was constructed as follows:

[0035] A 200-400 bp fragment of the non-conserved cDNA region of this gene was selected as a specific fragment, the sequence of which is shown in SEQ ID NO.4. Then, using the XbaⅠ and KpnⅠ double restriction enzyme sites, SEQ ID NO.2 was incorporated into the viral silencing vector pTRV2 to construct the pTRV2-MdBBX25 recombinant plasmid, which was then transformed into Agrobacterium tumefaciens GV3101 using the freeze-thaw method. Primer sequences are as follows:

[0036] pTRV2-MdBBX25(XbaⅠ)-F:GCTCTAGAGAAGAACCGAAAGTTCGAGAAGAC

[0037] (SEQ ID NO.5)

[0038] pTRV2-MdBBX25(KpnⅠ-R:

[0039] CGGGGTACCCAGTACACCGGATCTCGACCGATA(SEQ ID NO.6)

[0040] Apple instantaneous injection experiments, paraffin section observations, physiological data measurements, and gene expression analysis showed that overexpression of MdBBX25 can delay apple fruit softening by inhibiting ethylene biosynthesis and cell wall degradation, while silencing MdBBX25 can accelerate apple fruit softening by promoting ethylene biosynthesis and cell wall degradation. This indicates that MdBBX25 has a significant effect on delaying postharvest apple fruit softening and improving quality.

[0041] The discovery of the MdBBX25 gene not only provides a new candidate gene for maintaining the postharvest softening quality of apples, but also provides a theoretical basis for the study of the postharvest preservation function of other fleshy fruits.

[0042] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0043] The test reagents used in the embodiments of this invention are all conventional reagents in the art and can be purchased through commercial channels.

[0044] Example 1: Cloning of the full-length and specific fragments of the apple MdBBX25 gene

[0045] (I) RNA extraction and reverse transcription from 'Golden Delicious' apple fruits

[0046] 1. Extraction of total RNA from plants

[0047] The total RNA content of apple leaf and apple fruit samples was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing). The specific steps are as follows:

[0048] 1) Homogenization treatment. Grind 50-100 mg of plant leaves or fruit pulp into powder rapidly in liquid nitrogen, add 500 μL of lysis buffer SL (please check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix.

[0049] 2) Centrifuge at 12,000 rpm for 2 min.

[0050] 3) Transfer the supernatant to the filter column CS (place the filter column CS in the collection tube), centrifuge at 12,000 rpm for 2 min, and carefully aspirate the supernatant from the collection tube into a new RNase-free centrifuge tube, avoiding contact between the pipette tip and cell debris in the collection tube as much as possible.

[0051] 4) Slowly add 0.4 times the volume of supernatant in anhydrous ethanol and mix well (precipitation may occur at this time). Transfer the resulting solution and precipitate together into the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0052] 5) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0053] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube. Add 70 μL of RDD buffer and mix gently.

[0054] 7) Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 min.

[0055] 8) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0056] 9) Add 500 μL of washing buffer RW to the adsorption column CR3 (please check whether ethanol has been added before use), centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0057] 10) Repeat step 9.

[0058] 11) Centrifuge at 12,000 rpm for 2 min, place the adsorption column CR3 into a new RNase-Free centrifuge tube, add 30-50 μL of RNase-Free ddH2O dropwise to the middle of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min to obtain the RNA solution.

[0059] The RNA was stored at -80°C. Before storage, the integrity of the RNA was detected by agarose gel electrophoresis and the concentration of the RNA was determined on an Agilent 2100 bioanalyzer (Santa Clara, California, USA).

[0060] 2. RNA is reverse transcribed into cDNA

[0061] The samples were reverse transcribed using the HiScript IIQ RT SuperMix for qPCR kit (Vazyme, Nanjing). The specific steps are as follows:

[0062] 1) Genomic DNA removal.

[0063]

[0064]

[0065] Gently pipette to mix. React at 42°C for 2 minutes.

[0066] 2) Prepare the reverse transcription reaction system.

[0067]

[0068] Gently pipette to mix.

[0069] 3) Perform reverse transcription.

[0070] 85℃ 5 seconds

[0071] Obtain the reverse transcription product. The product can be used immediately for qPCR reactions, or stored at -20°C and used within six months; for long-term storage, it is recommended to aliquot and store at -70°C. Avoid repeated freeze-thaw cycles on the cDNA.

[0072] (II) Cloning of the full-length MdBBX25 gene

[0073] Using the cDNA from step (I) of Example 1 as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme. The upstream and downstream primers for MdBBX25 are as follows:

[0074] MdBBX25-F:GACAAGAGTGAGTGCTATTTACG(SEQ ID NO.7)

[0075] MdBBX25-R:TTCCCGGGGAAAAAAACGAA(SEQ ID NO.8)

[0076] The amplification steps are as follows: 1)

[0078]

[0079]

[0080] Template usage:

[0081]

[0082] 2) PCR reaction program: 95℃ pre-denaturation for 3 minutes; cycling parameters: 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 70 seconds, for 35 cycles; 72℃ extension for 5 minutes.

[0083] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD19-T, transformed into Escherichia coli DH5α, plated on LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the JGI database (https: / / phytozome-next.jgi.doe.gov) by BLAST, and the cloned sequence was consistent with the MD08G1049600 sequence.

[0084] (III) Cloning of a MdBBX25 gene-specific fragment

[0085] Using the cDNA from step (I) of Example 1 as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme. The upstream and downstream primers for the MdBBX25 specific fragment are as follows:

[0086] MdBBX25-VIGS-F:GAGAAGCGGAAGAACCGAAAGTTC (SEQ ID NO.9);

[0087] MdBBX25-VIGS-R:CAGTACACCGGATCTCGACCGATA(SEQ ID NO.10);

[0088] The amplification steps and PCR reaction procedure are the same as those in Example 1 (II).

[0089] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD19-T, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmids were extracted from the correctly sequenced single colonies to determine the specific fragment sequence of the MdBBX25 gene.

[0090] Example 2: Expression levels of the BBX gene in 'Golden Delicious' and 'Golden Delicious Bud Mutation' apple fruits at different storage times

[0091] 1) To investigate the major genes affecting postharvest apple fruit softening, transcriptome sequencing was performed on 'Golden Delicious' and 'Golden Delicious Bud Mutation' apple fruits. Analysis of the transcriptome sequencing results revealed a large-scale transcription factor family, BBX. (See [link to relevant documentation]). Figure 1Genes marked with "*" are differentially expressed. Six differentially expressed genes were selected: MdBBX1 (MD15G1045000), MdBBX2 (MD13G1263800), MdBBX16 (MD09G1079200), MdBBX25 (MD08G1049600), MdBBX42 (MD16G1265000), and MdBBX54 (MD04G1042700).

[0092] 2) Sample the pulp of 'Golden Delicious' and 'Golden Delicious Bud Mutation' apples from different storage periods and rapidly fix them in liquid nitrogen. Extract total RNA from the pulp of the above-mentioned apples from different storage periods and reverse transcribe it into cDNA, using the same method as step (I) in Example 1.

[0093] 3) Specific primers were designed for the non-conserved regions of the MdBBX1, MdBBX2, MdBBX16, MdBBX25, MdBBX42, and MdBBX54 genes, as well as the apple internal reference primers MdActin-F and MdActin-R. The sequences are as follows:

[0094] MdBBX1-qRT-F:GGCATCGTTCCCGTCGTTTTA (SEQ ID NO. 11);

[0095] MdBBX1-qRT-R:TGATGCGAATCCCCAAACCAA (SEQ ID NO. 12);

[0096] MdBBX2-qRT-F:CGTGGTGGATCGCATCTATT (SEQ ID NO.13);

[0097] MdBBX2-qRT-R:GAGAGAGACTTTACGGACTTGC (SEQ ID NO. 14);

[0098] MdBBX16-qRT-F: GATGACCCTATCTCTTCAAATAAC (SEQ ID NO. 15);

[0099] MdBBX16-qRT-R:CAATCACACTTCACACATCTC (SEQ ID NO.16);

[0100] MdBBX25-qRT-F:GTACAGAGAGAAGCGGAAGAAC (SEQ ID NO. 17);

[0101] MdBBX25-qRT-R:CCGGATCTCGACCGATATTTAC (SEQ ID NO. 18);

[0102] MdBBX42-qRT-F:CCGCAAGTTCCAGAAGACTAT(SEQ ID NO.19);

[0103] MdBBX42-qRT-R:CTTTCACCGGCCAATCAATAAA (SEQ ID NO. 20);

[0104] MdBBX54-qRT-F:CAGAAATCTCCTCCGCCAATTA (SEQ ID NO. 21);

[0105] MdBBX54-qRT-R:TCCCAGAAGCAAGTGAGAAAG (SEQ ID NO. 22);

[0106] MdActin-F:GAAGCTGCTGGCATTCATGA (SEQ ID NO. 23);

[0107] MdActin-R:CTGGTGGAGCTACAACCTTG (SEQ ID NO. 24);

[0108] 4) Using the cDNA obtained in step (2) as templates, adjust these cDNA templates with apple internal reference primers MdActin-F and MdActin-R to make the concentration of each cDNA template consistent.

[0109] 5) Perform qRT-PCR using cDNA templates of consistent concentration to detect MdBBX1, see [link to qRT-PCR]. Figure 2 A and MdBBX2 in the middle, see Figure 2 B, MdBBX16, see Figure 2 C, MdBBX25, see Figure 2 D and MdBBX42 in the text, see Figure 2 E and MdBBX54 in the text, see Figure 2 The expression differences of the F1 gene in 'Golden Delicious' and 'Golden Delicious Bud Mutation' fruits at different storage periods were investigated. It was found that as storage time increased and firmness decreased, the expression level of MdBBX25 significantly increased, reaching a high level at 15 days of storage. Figure 2 In the D-phase, the expression level of MdBBX25 decreased rapidly until the hardness was low in the later stage of storage, and the expression level of 'Golden Crown' was always higher than that of 'Golden Crown Bud Mutation'. The expression pattern of the MdBBX25 gene is consistent with the expectation of BBX gene function in this experiment. Therefore, further research on MdBBX25 will be conducted in the later stage.

[0110] Example 3: Construction of MdBBX25 gene-related vectors

[0111] The full-length cDNA sequence of the MdBBX25 gene obtained in step (II) of Example 1 was amplified using primer sequences SEQ ID NO.2 and SEQ ID NO.3, which respectively contain XbaⅠ and SmaⅠ restriction sites. Following the gene cloning method in step (II) of Example 1, the sequence was ligated into the cloning vector pMD19-T to obtain the fusion plasmid MdBBX25-pMD19-T(XbaⅠ, SmaⅠ).

[0112] Then, the empty vector pSuper1300 and MdBBX25-pMD19-T (XbaⅠ, SmaⅠ) were digested with restriction endonucleases XbaⅠ and SmaⅠ, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pSuper1300 vector and the target gene MdBBX25 fragment were ligated and transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdBBX25-pSuper1300 was extracted.

[0113] Similarly, the cDNA-specific fragment of the MdBBX25 gene obtained in step (iii) of Example 1 was amplified using primer sequences with XbaⅠ and KpnⅠ restriction sites, namely SEQ ID NO.5 and SEQ ID NO.6, respectively. Following the gene cloning method in step (ii) of Example 1, it was ligated into the cloning vector pMD19-T to obtain the fusion plasmid MdBBX25-VIGS-pMD19-T(XbaⅠ, KpnⅠ). Then, the empty vector pTRV2 and MdBBX25–VIGS-pMD19-T(XbaⅠ, KpnⅠ) were digested with restriction endonucleases XbaⅠ and KpnⅠ, respectively. Agarose gel electrophoresis was performed, the fragments were recovered, and T4-DNA ligase was used to ligate the linear pTRV2 vector and the target gene MdBBX25-specific fragment. This was then transformed into *E. coli* DH5α. For single colonies with correct sequencing, the recombinant plasmid MdBBX25-pTRV2 was extracted.

[0114] The two recombinant plasmids were transformed into Agrobacterium GV3101 using the freeze-thaw method.

[0115] Example 4: Transient transformation of apple fruit using the MdBBX25 gene

[0116] (a) Injection of an overexpression vector containing the MdBBX25 gene

[0117] 1) Preparation of MMA infiltration solution: The final concentrations of each component in 100 mL of infiltration solution are 10 mM MgCl2, 10 mM fatty acid methyl ester sulfonate (MES) and 200 μM acetylsuccinone (AS). The pH of the infiltration solution is adjusted to pH 5.6 using KOH. It should be prepared and used immediately.

[0118] 2) Prepare the injection solution. Place the GV3101 Agrobacterium containing MdBBX25-pSuper1300 and pSuper1300 in LB liquid medium (containing 100 mg / L Kan and 100 mg / L Rif), and incubate at 28°C with shaking at 200 rpm until OD reaches 100%. 600 The concentration was 0.8–1, then transferred to a 50 ml centrifuge tube, centrifuged at 5000 rpm for 10 min to collect the bacterial cells, and resuspended twice with MMA solution to adjust the OD value. 600 =0.8, and then the injection solution was left to stand in a dark incubator at 28°C for 3 hours.

[0119] 3) Injection. Using a sterile disposable syringe, draw 1 mL of injection solution. Using a needle, make four evenly distributed punctures at the equator of the 'Golden Crown Bud Mutation' fruit on day 0 of harvest. Gently press the syringe (without the needle) against the puncture site and slowly inject the injection solution into the fruit through the punctures (injection rate approximately 1 mL / min). -1 The injected fruit was then stored at room temperature.

[0120] (ii) Injection of a silencing vector containing the MdBBX25 gene

[0121] 1) Preparation of MMA infiltration solution: The final concentrations of each component in 100 mL of infiltration solution are 10 mM MgCl2, 10 mM fatty acid methyl ester sulfonate (MES) and 200 μM acetylsuccinone (AS). The pH of the infiltration solution is adjusted to pH 5.6 using dilute hydrochloric acid. It should be prepared and used immediately.

[0122] 2) Prepare the injection solution. Place GV3101 Agrobacterium containing MdBBX25-pTRV2, pTRV2, and pTRV1 (the helper expression vector for pTRV2) in LB liquid medium (containing 100 mg / L Kan and 100 mg / L Rif), and incubate at 28°C with shaking at 200 rpm until OD500 is reached. 600 The concentration was 1.0–2.0, then transferred to a 50 ml centrifuge tube, centrifuged at 5000 rpm for 10 min to collect the bacterial cells, and resuspended twice with MMA solution to adjust the OD value. 600 =1.0~2.0, and then the injection solution was left to stand in a dark incubator at 28℃ for 3 hours.

[0123] 3) Mixing. Two processes were set up: MdBBX25-pTRV (MdBBX25-pTRV2 and pTRV1 mixed at a volume ratio of 1:1); and pTRV (pTRV2 and pTRV1 mixed at a volume ratio of 1:1).

[0124] 4) Injection. Using a sterile disposable syringe, draw 1 mL of injection solution. Using a needle, make four evenly distributed punctures at the equator of the 'Golden Delicious' fruit on day 0 of harvest. Gently press the syringe (without the needle) against the puncture sites and slowly inject the injection solution into the fruit through the punctures (injection rate approximately 1 mL / min). -1 The injected fruit was then stored at room temperature.

[0125] Example 5: Subcellular localization of the MdBBX25 gene

[0126] Similar to the transient overexpression method for fruits described above, the enzyme-digested MdBBX25 fragment was inserted into the pSuper1300-GFP vector (SmaI / XbaI) to generate the MdBBX25 green fluorescent protein (GFP) fusion protein construct. The resulting construct was transferred to Agrobacterium GV3101 and used to infect fresh onion scales. The infected onion scales were observed using an EVOS FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA). The specific steps are as follows:

[0127] 1) Use fresh onions. First, remove the outer scales. Then, on a clean bench, use a sterilized blade to cut the inner skin of the onion into small pieces. Use sterilized tweezers to remove the inner skin and spread it evenly on 1 / 2 MS solid culture medium without any hormones. Incubate in the dark at 28°C for about 24 hours.

[0128] 2) Under dark conditions, the previously transformed pSuper1300-GFP-MdBBX25 Agrobacterium tumefaciens culture was added to LB liquid medium (containing 100 mg / L Kan and 100 mg / L Rif) and cultured on a shaker at 200 rpm at 28°C to obtain the optimal growth environment for the strain. OD was then measured. 600 The value was around 0.8-1.0. Meanwhile, Mcherry (a nuclear localization marker) and P19 (which promotes infection) were cultured to OD using the same procedure. 600 The value is approximately 0.8-1.0. Based on the final concentrations of the target gene, Mcherry, and P19 Agrobacterium, calculate the amount of each bacterial culture to be used, transfer it to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 10 min, then discard the supernatant, retain the bacterial cells, and resuspend them in 1 / 2 MS liquid medium containing acetylsyringone (AS).

[0129] 3) Place the pretreated inner epidermis of the onion into the pre-prepared infection solution and soak for 15 minutes, stirring regularly to improve the soaking effect. Then, remove the soaking solution using sterile filter paper and place it on 1 / 2 MS solid medium containing AS, and keep it at 28°C for 16 hours (the entire process is carried out on a clean bench).

[0130] 4) Under an AUTO2 microscope, the onion epidermis was first immersed in 1 / 2 MS liquid culture medium, then washed in sterile water, and finally spread out on a clean glass slide. A film was sprinkled on it to remove air bubbles, and the localization of the target protein at the subcellular level was observed.

[0131] The results showed that MdBBX25-GFP was localized in the cell nucleus. (See [link to relevant documentation]) Figure 3 The scale bar is 125μm.

[0132] Example 6: Phenotypic, paraffin section, and physiological data determination of apple fruits after instantaneous transformation.

[0133] (I) Photographing the appearance of apple fruits

[0134] The apples from the four experimental groups were placed in a small photography studio, and a camera was used to photograph the injection holes.

[0135] The results showed that the fruit color of pSuper1300 apples deepened faster than that of MdBBX25-pSuper1300 apples, while the ripening process of MdBBX25-pSuper1300 apples was slower. (See [link to relevant documentation]). Figure 4 The color of A-pTRV apples deepens less rapidly than that of MdBBX25-pTRV apples. MdBBX25-pTRV apples mature faster. (See also: [link to relevant documentation]). Figure 7 A in the middle.

[0136] (II) Observation of apple fruit paraffin sections

[0137] 1) Take 1cm every four days 3 Apple pulp tissue from each experimental group was fixed in FAA solution and subjected to vacuum treatment twice at a pressure of -0.8 kg / cm.

[0138] 2) The paraffin slices that had been vacuum-treated in each experimental group were dehydrated by sequentially using 30%, 50%, 70%, 80%, 95%, 100%, and 100% alcohol, with each treatment lasting 2 hours.

[0139] 3) The sample treated above was then placed in 100% alcohol: xylene = 1:1, xylene, xylene for de-alcoholization treatment for 2-3 hours each time.

[0140] 4) Place the sample treated above in xylene:paraffin = 1:1 and incubate at 37°C for 2 days. Then place it in an incubator at 65°C until the paraffin dissolves. Finally, place the sample in 100% paraffin and let it stand for 1-2 days.

[0141] 5) Subsequently, the sample was placed in an embedding plate containing 65°C paraffin using a paraffin embedding machine (HistoCore Arcadia H 220-240VAC 50HZ 10A max). Then, the paraffin in the embedding plate was solidified using a fully automated tissue embedding machine cold stage (HistoCore Arcadia C220-240VAC 50HZ 5A max). Following this, the paraffin-embedded blocks were removed from the embedding plate and cut into 8–10 μm thick paraffin sections using a Leica microtome (Leica RM2245). The sections were then placed in distilled water in a 40°C slide bath (Leica HI1210) for 10 minutes. Finally, the sections were removed using a glass slide and placed on a 40°C slide dryer (Leica HI1220) for drying.

[0142] 6) Subsequently, staining and mounting were performed. The slides containing the sections were sequentially dewaxed and rehydrated in xylene, xylene, 100% ethanol:xylene = 1:1, 100%, 100%, 95%, 80%, 70%, 50%, 30% ethanol, distilled water, and distilled water, each treatment lasting 5 minutes. Then, they were stained with 0.02% toluidine blue for 5 minutes, followed by dehydration in distilled water, distilled water, 30%, 50%, 70%, 80%, 95%, 100%, and 100% ethanol, each treatment lasting 5 minutes. Finally, they were dehydrated in 100% ethanol:xylene = 1:1, xylene, and xylene, each treatment lasting 5 minutes. Canada balsam (not too much) was then added to the slide, and the slide was quickly mounted with a coverslip. After drying in a fume hood, it was observed under a fluorescence microscope.

[0143] The results showed that the cell structure of the pulp tissue of pSuper1300 apple fruit was more porous than that of MdBBX25-pSuper1300, and the cell wall degradation rate of MdBBX25-pSuper1300 fruit was slower. (See [link to relevant documentation]). Figure 4 In the B category, MdBBX25-pTRV apple pulp cells are more porous than those of pTRV, and the cell walls of MdBBX25-pTRV fruits degrade more rapidly. (See also: [link to relevant documentation]). Figure 7 B in the middle.

[0144] (III) Determination of apple fruit firmness, ethylene release rate, and respiration rate

[0145] 1) Fruit firmness determination: The firmness of apples from the four experimental groups was measured using a CT3 texture analyzer (Brookfield, USA) (10mm diameter probe). The fruit was peeled 1mm off 1cm from four injection points on the equator before measurement, at a speed of 1mm·s. -1 The depth was 10 mm. Five fruits were selected as replicates for each experimental group, and measurements were taken every 4 days.

[0146] 2) Determination of ethylene release rate from fruit: Five apples were taken from each of the four experimental groups. Each fruit was placed in a 1L beaker and sealed with plastic wrap. Each container was kept still for 1 hour. Then, three 1mL gas samples were extracted and injected into a GC-2010 gas chromatograph to determine the ethylene release rate.

[0147] 3) Determination of fruit respiration rate: Five apples were taken from each of the four experimental groups, and each fruit was placed in a 1L beaker and sealed with plastic wrap. Each container was kept still for 1 hour, and then the respiration rate of the fruit was measured using a CAMBO580 CO2 analyzer. The calculation formula was: Respiration rate = (C1 - C0) / W·t, where C1 represents the CO2 release at the time of measurement (mg), C0 represents the initial CO2 release (mg), W represents the weight of the fresh fruit (kg), and t represents the measurement time (h).

[0148] Throughout storage, the ripening process of MdBBX25-pSuper1300 fruit was slower compared to pSuper1300 fruit. (See [link to relevant documentation]). Figure 4 Compared to pTRV fruits, MdBBX25-pTRV fruits mature faster. (See [link to relevant documentation]). Figure 7 Correspondingly, the firmness of the fruits in all experimental groups decreased during storage, but compared with the fruits from their respective empty carriers, the softening rate of the MdBBX25-pSuper1300 fruits was significantly slower. (See [link to relevant documentation]). Figure 5 In A; while the MdBBX25-pTRV fruit softens significantly faster, see [reference needed]. Figure 8 A. Furthermore, compared to their respective empty carrier fruits, the ethylene production rate of MdBBX25-pSuper1300 fruits was significantly reduced; see [reference needed]. Figure 5 In case B, the respiratory rate is significantly reduced; see [reference needed]. Figure 5 The ethylene production rate of C;MdBBX25-pTRV fruits is significantly increased, see [reference needed]. Figure 8 In B, the respiratory rate is significantly increased; see [reference needed]. Figure 8 C in the middle.

[0149] Example 7: Expression levels of genes related to softening in apple fruit after transient transformation

[0150] 1) Apple pulp samples were taken from the four experimental groups at different storage periods and rapidly fixed in liquid nitrogen. Total RNA was extracted from the pulp of the different groups at different storage periods and reverse transcribed into cDNA, using the same method as step (I) in Example 1.

[0151] 2) The specific primer sequences for the MdBBX25 gene are SEQ ID NO.17 and SEQ ID NO.18. Specific primers were designed for the non-conserved regions of the MdACO, MdACS-1, MdXTHB, MdPG, MdEXPA8, and MdCEL genes, with the sequences as follows:

[0152] MdACO-qRT-F:GGCTACACACAGAGCATACAA (SEQ ID NO. 25);

[0153] MdACO-qRT-R:GCTGCCACCATTTCCTTAAAC (SEQ ID NO. 26);

[0154] MdACS-1-qRT-F:CTGGAAGAAGCCTACCAAGAAG (SEQ ID NO. 27);

[0155] MdACS-1-qRT-R: CCATGTCGTCGTTGGAGTAAA (SEQ ID NO. 28);

[0156] MdXTHB-qRT-F:GACCGAGTCAGATACCCTTCTA (SEQ ID NO. 29);

[0157] MdXTHB-qRT-R:CTGAGTACGTGTCATCTTCTTCTC (SEQ ID NO.30);

[0158] MdPG-qRT-F:CACAGTTGTTGTGGTCATTTGT (SEQ ID NO. 31);

[0159] MdPG-qRT-R: CCTTCTATGGTGTCCGTGTATG (SEQ ID NO. 32);

[0160] MdEXPA8-qRT-F: CCTCATCCTCTCTCTCCTTAGT (SEQ ID NO.33);

[0161] MdEXPA8-qRT-R:TGGCTGTACAAGTTCCCATATC (SEQ ID NO.34);

[0162] MdCEL-qRT-F:GGGATCCAAGGACCTTTCTATG (SEQ ID NO. 35);

[0163] MdCEL-qRT-R: CGGATGAGCTCTGGAGAATTT (SEQ ID NO. 36);

[0164] 3) Using the cDNA obtained in step (1) as a template, adjust these cDNA templates with apple internal reference primers MdActin-F (SEQ ID NO.23) and MdActin-R (SEQ ID NO.24) to make the concentration of each cDNA template consistent.

[0165] 4) Using cDNA templates of consistent concentration, qRT-PCR was performed to detect the expression differences of MdACO, MdACS-1, MdXTHB, MdPG, MdEXPA8, MdCEL, and MdBBX25 genes in fruits from different experimental groups at different storage periods.

[0166] The results showed that the expression level of MdBBX25 in MdBBX25-pSuper1300 fruit was significantly higher than that in control fruit (empty vector pSuper1300). Figure 6 In G; while in MdBBX25-pSuper1300 fruit, the expression levels of ethylene-related genes (MdACO and MdACS-1) were downregulated, see [link to relevant documentation]. Figure 6 A and Figure 6 In B, the expression levels of cell wall-related genes (MdPG, MdCEL, MdEXPA8, and MdXTHB) were also downregulated. See [link to relevant documentation]. Figure 6 C in Figure 6 D in Figure 6 E and Figure 6 The presence of F in the F-value further supports the negative correlation between the aforementioned genes and MdBBX25 expression. Compared to the control fruit (empty vector pTRV), MdBBX25 expression was significantly reduced in MdBBX25-pTRV fruit. Figure 9 In MdBBX25-pTRV fruit, ethylene-related genes (MdACO and MdACS-1) are upregulated; see [link to relevant documentation]. Figure 9 A and Figure 9 In B, cell wall-related genes (MdPG, MdCEL, MdEXPA8, and MdXTHB) are significantly upregulated, see [link to relevant documentation]. Figure 9 C in Figure 9 D in Figure 9 E and Figure 9The results strongly suggest that MdBBX25 negatively regulates cell wall degradation and ethylene production during fruit storage, and that MdBBX25 exerts its negative regulatory effect on fruit softening by inhibiting ethylene biosynthesis and cell wall degradation.

[0167] Based on the aforementioned techniques, a BBX gene, MdBBX25, was isolated from apples. Functional verification and physiological phenotypic determination through transient injection experiments in apples showed that MdBBX25 has a significant effect on inhibiting apple fruit softening. The discovery of the MdBBX25 gene provides a basis for improving the intrinsic quality of apple fruits and has significant economic and social benefits for improving apple quality.

[0168] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of a functional gene, as shown in SEQ ID NO.1 of the nucleotide sequence listing, in delaying postharvest apple fruit softening and improving quality, characterized in that: The functional gene shown in SEQ ID No. 1 of the nucleotide sequence listing was cloned into an overexpression vector. The overexpression of the functional gene inhibited ethylene biosynthesis and cell wall degradation in apples, delayed the decrease in apple fruit firmness, slowed down the ripening and senescence process, and achieved delayed postharvest apple fruit softening.

2. The application of the functional gene shown in SEQ ID NO.1 of the nucleotide sequence listing according to claim 1 in delaying postharvest apple fruit softening and improving quality, characterized in that: The overexpression vector is pSuper1300.

3. The application of the functional gene shown in SEQ ID NO.1 of the nucleotide sequence listing according to claim 1 in delaying postharvest apple fruit softening and improving quality, characterized in that: This refers to the application of using genetic engineering techniques to introduce the functional gene shown in SEQ ID No. 1 into apple varieties with poor storage resistance, thereby enhancing their storage resistance.

Images