Freeze-drying protectant and freeze-drying method for qPCR whole premix

Abstract

The application discloses a freeze-drying protective agent and a freeze-drying method for qPCR full premix liquid, wherein the freeze-drying protective agent comprises cellobiose and BSA, the mass concentration of the cellobiose is 3wt%-8wt%, and the mass concentration of the BSA is 0.001wt%-0.004wt%. In the application, the inventor finds that the combination of BSA and cellobiose with certain concentrations as the freeze-drying protective agent for the qPCR full premix liquid can provide protection for the full components of the premix liquid during freeze-drying, the reagent performance is qualified after freeze-drying, and the long-term stable biological activity of raw enzyme can be maintained; further through the selection of the freeze-drying step and the control of parameters, the shape of the obtained premix liquid freeze-drying preparation is complete and solid.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and more specifically, this invention relates to a lyophilization protectant for qPCR premix and a lyophilization method for qPCR premix. Background Technology

[0002] qPCR premix solution, including 10×PCR buffer, primers, probes, Mg 2+ The components include (2.5 mM), dNTPs (0.2 mM), reverse transcriptase, and DNA polymerase. Reverse transcriptase is an enzyme that uses RNA as a template to guide the synthesis of complementary DNA (cDNA) from deoxyribonucleotides (DRPs). It is a key raw material in one-step PCR amplification systems used to detect target genes in clinical samples such as pathogens. DNA polymerase, also known as DNA-dependent DNA polymerase (DNApol), is a class of enzymes that uses parental DNA as a template to catalyze the polymerization of substrate dNTP molecules to form daughter DNA.

[0003] The activity and stability of reverse transcriptase and DNA polymerase are affected by factors such as temperature, pH, and storage time, requiring cryopreservation at low temperatures, and their shelf life is generally around one year. This brings many inconveniences to the transportation, storage, and application of qPCR raw material enzymes.

[0004] Freeze-drying qPCR raw material enzymes facilitates product preservation and transportation. During the freeze-drying process, a freeze-drying protectant must be added. For example, patent CN110747263A discloses a freeze-drying additive comprising component A and component B. Component A consists of dithiothreitol, Tween 20, trehalose, gelatin, and BSA, while component B consists of tert-butanol. This freeze-drying additive, besides protecting the raw material enzymes during freeze-drying, also helps maintain a certain shape and promotes the freeze-drying process. However, tert-butanol is a volatile alcohol and will have an inhibitory effect on PCR amplification.

[0005] Furthermore, existing lyophilization protectants generally use raw materials containing trehalose, which is susceptible to moisture, causing the lyophilization protectant to become ineffective. Also, because reverse transcriptase is more easily inactivated in liquid form than polymerase, lyophilization processes generally do not lyophilize it together with other premixed liquid components. Even if reverse transcriptase is lyophilized together, the lyophilized reagent cannot be stored for long periods due to the easy degradation of reverse transcriptase.

[0006] Moreover, existing freeze-drying process research focuses on the freeze-drying of raw enzymes, and cannot perform full-component freeze-drying of the buffer (because the buffer contains a high concentration of salt ions, which will affect the eutectic point of the reagents during freeze-drying, making it more difficult to freeze-dry and form). This makes the process quite complex for operators in actual use.

[0007] Therefore, it is of great significance to explore a freeze-drying protectant and freeze-drying process that can protect all components of qPCR premix and maintain the long-term activity of raw material enzymes after freeze-drying. Summary of the Invention

[0008] Based on this, the purpose of the present invention is to provide a lyophilization protectant for qPCR premix and its preparation method, as well as a method for lyophilizing qPCR premix.

[0009] The technical solutions for achieving the above-mentioned objectives include the following.

[0010] In a first aspect, the present invention provides a lyophilization protectant for a fully premixed qPCR solution, the lyophilization protectant comprising cellobiose and BSA, wherein the mass concentration of cellobiose is 3 wt% to 8 wt% and the mass concentration of BSA is 0.001 wt% to 0.004 wt%.

[0011] In a second aspect, the present invention provides a method for preparing the lyophilization protectant of the above-mentioned qPCR premix, comprising the steps of: dissolving cellobiose and BSA in distilled water to the desired mass concentration, thereby obtaining the solution.

[0012] A third aspect of the present invention provides the application of the above-mentioned lyophilization protectant for qPCR premix in the lyophilization of qPCR premix.

[0013] A fourth aspect of the present invention provides a method for lyophilizing a qPCR premix, comprising the following steps:

[0014] (1) Pretreatment: Prepare PCR buffer, primers, probes, and Mg2+. 2+ Mix reverse transcriptase, DNA polymerase, dNTPs and the above-mentioned lyophilization protectant to prepare the sample for lyophilization.

[0015] (2) Pre-freezing: Freeze the sample to be freeze-dried at -82℃~-78℃ for 2h~3h; or freeze the sample to be freeze-dried at -55℃~-45℃ in a vacuum for 4h~6h.

[0016] (3) Initial drying: Drying at -27℃~-23℃ under vacuum of 0.02mbar~0.04mbar for 16h~20h;

[0017] (4) Drying again: Adjust the vacuum degree to 0.005mbar~0.015mbar, 18℃~22℃, and dry for 2h~6h.

[0018] In this invention, the inventors discovered that using a certain concentration of BSA and cellobiose as a lyophilization protectant for qPCR premix can protect the premix during the lyophilization of all components. After lyophilization, the reagent performance is qualified, and the long-term stable biological activity of the raw material enzyme can be maintained (the storage time at room temperature can be up to 22 months). Furthermore, by selecting the lyophilization steps and controlling the parameters, the obtained premix can be lyophilized to a complete and firm shape. Attached Figure Description

[0019] Figure 1 This is the lyophilized formulation of the qPCR premixed solution obtained in Example 1 of this invention.

[0020] Figure 2 This is the detection result (10000 copies / mL) of sample 1 using qPCR premix solution A in Experiment Example 1 of this invention.

[0021] Figure 3 This is the detection result (10000 copies / mL) of sample 1 using qPCR fully premixed solution B in Experiment Example 1 of this invention.

[0022] Figure 4 This is the detection result (10000 copies / mL) of sample 1 using qPCR premixed solution C in Experiment Example 1 of this invention.

[0023] Figure 5 This is the detection result (10000 copies / mL) of sample 1 using qPCR fully premixed solution D in Experiment Example 1 of this invention.

[0024] Figure 6 This is the detection result (500 copies / mL) of sample 2 using qPCR premix solution A in Experiment Example 1 of this invention.

[0025] Figure 7 This is the detection result (500 copies / mL) of sample 2 using qPCR fully premixed solution B in Experiment Example 1 of this invention.

[0026] Figure 8 This is the detection result (500 copies / mL) of sample 2 using qPCR premixed solution C in Experiment Example 1 of this invention.

[0027] Figure 9 This is the detection result (500 copies / mL) of sample 2 using qPCR fully premixed solution D in Experiment Example 2 of this invention.

[0028] Figure 10 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 1) in Experimental Example 2 of this invention.

[0029] Figure 11 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 3) in Experimental Example 2 of this invention.

[0030] Figure 12 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 5) in Experimental Example 2 of this invention.

[0031] Figure 13 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 7) in Experimental Example 2 of this invention.

[0032] Figure 14 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 6) in Experimental Example 2 of this invention.

[0033] Figure 15 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 8) in Experimental Example 2 of this invention.

[0034] Figure 16 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 9) in Experimental Example 2 of this invention.

[0035] Figure 17 The results show the amplification performance of the qPCR premixed solution lyophilized using the lyophilization protectant (serial number 10) in Experimental Example 2 of this invention.

[0036] Figure 18 This is the form of the qPCR premix obtained by freeze-drying under an initial drying vacuum of 0.3 mbar in Experimental Example 3 of the present invention.

[0037] Figure 19 This is the form of the qPCR premix obtained by freeze-drying under an initial drying vacuum of 0.03 mbar in Experimental Example 3 of this invention. Detailed Implementation

[0038] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0039] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0040] In some embodiments of this invention, a lyophilization protectant for a qPCR premix is ​​disclosed. The lyophilization protectant comprises cellobiose and BSA, wherein the mass concentration of cellobiose is 3 wt%–8 wt%, and the mass concentration of BSA is 0.001 wt%–0.004 wt%. The combination of 3 wt%–8 wt% cellobiose and 0.001 wt%–0.004 wt% BSA as a lyophilization protectant can protect all components of the premix during the lyophilization process of the qPCR premix, especially ensuring that the reverse transcriptase maintains its original biological activity and tertiary structure during vacuum freeze-drying (cellobiose has a relatively high glass transition temperature, weak hygroscopicity, and few internal hydrogen bonds, which is beneficial for forming hydrogen bonds with protein molecules and maintaining the stability of the protein's tertiary structure; BSA has a certain protein protection ability and acts as a surfactant, reducing the freezing and dehydration deformation caused by ice-water interfacial tension during freezing and dehydration, thus maintaining its original biological activity), resulting in good stability for all components of the lyophilized premix. Compared to the marketed and certified molecular diagnostic lyophilized products (National Medical Device Registration Certificate 20223401469), which have a shelf life of 6 months and need to be stored at 2-8℃, the lyophilized premixed solution of this invention still has a shelf life of 1 year under normal temperature storage conditions, providing stronger product protection.

[0041] In some embodiments, the cellobiose has a mass concentration of 4 wt% to 6 wt%, and the BSA has a mass concentration of 0.002 wt% to 0.003 wt%.

[0042] In some embodiments, the cellobiose has a mass concentration of 4.8 wt% to 5.2 wt%, and the BSA has a mass concentration of 0.002 wt% to 0.003 wt%.

[0043] In other embodiments of the present invention, a method for preparing a lyophilization protectant for a qPCR premix is ​​disclosed, comprising the steps of dissolving cellobiose and BSA in distilled water to the desired mass concentration.

[0044] In other embodiments of the present invention, the application of the lyophilization protectant of the above-mentioned qPCR premix in the lyophilized qPCR premix is ​​disclosed.

[0045] In other embodiments of the present invention, a method for lyophilizing qPCR premix using the above-mentioned lyophilization protectant is disclosed, specifically including the following steps:

[0046] (1) Pretreatment: Prepare PCR buffer, primers, probes, and Mg2+. 2+ The protectant, reverse transcriptase, DNA polymerase, and the above-mentioned lyophilization protectant (the volume of the lyophilization protectant is 1 / 3 of the volume of other components) are mixed together to form the sample to be lyophilized.

[0047] (2) Pre-freezing: There are two methods. The first method is to freeze the sample to be freeze-dried at -82℃ to -78℃ for 2h to 3h. The second method is to place the sample to be freeze-dried in a vacuum freeze dryer, set the drying chamber temperature at -55℃ to -45℃, and freeze for 4h to 6h. By controlling the pre-freezing time and temperature, the pre-treated sample to be freeze-dried becomes suitable ice crystals, so that free water and bound water can fully sublimate during the subsequent primary drying and secondary drying sublimation processes.

[0048] (3) Initial drying: Set the temperature of the partition of the vacuum freeze dryer to -27℃~-23℃, and dry the frozen sample to be freeze-dried for 16h~20h under a vacuum of 0.02mbar~0.04mbar. The initial drying will sublimate the free water in the freeze-dried reagent, so a high vacuum needs to be maintained to make the sublimation rate slower and better maintain the freeze-dried skeleton structure.

[0049] (4) Re-drying: Adjust the vacuum degree to 0.005mbar~0.015mbar, the temperature of the partition of the vacuum freeze dryer to 18℃~22℃, and dry for 2h~6h to obtain the lyophilized preparation of the qPCR premixed solution; re-drying will sublimate the bound water in the lyophilized reagent, and higher temperatures can provide greater sublimation kinetics.

[0050] In some embodiments, in step (2), the sample to be freeze-dried is frozen at -81°C to -79°C for 2.4h to 2.6h, or at -52°C to -48°C for 4.5h to 5.5h.

[0051] In some embodiments, in step (2), the sample to be freeze-dried is frozen at -80°C for 2 hours or at -50°C for 5 hours.

[0052] In some embodiments, in step (3), the vacuum degree is 0.025 mbar to 0.035 mbar, the drying temperature is -26°C to -24°C, and the drying time is 17h to 19h.

[0053] In some embodiments, in step (3), the vacuum degree is 0.03 mbar, the drying temperature is -25°C, and the drying time is 18 h.

[0054] In some embodiments, in step (4), the vacuum degree is 0.008 mbar to 0.012 mbar, the drying temperature is 19°C to 21°C, and the drying time is 3h to 5h.

[0055] In some embodiments, in step (4), the vacuum degree is 0.01 mbar, the drying temperature is 20°C, and the drying time is 4 h.

[0056] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0057] Example 1: A lyophilization protectant and lyophilization method for a fully premixed qPCR solution

[0058] This embodiment provides a lyophilization protectant for a fully premixed qPCR solution. The lyophilization protectant comprises cellobiose and BSA, wherein the mass concentration of cellobiose is 5 wt%, the mass concentration of BSA is 0.002 wt%, and the remainder is water.

[0059] Using the lyophilization protectant of the qPCR premix in this embodiment, the qPCR premix is ​​lyophilized, including the following steps:

[0060] (1) Preprocessing

[0061] 2.5mM Mg 2+ Mix 0.2 mM dNTP, PCR buffer, primers, probes, reverse transcriptase, DNA polymerase (the above components are prepared according to the manufacturer's dosage), and lyophilization protectant (the amount is 1 / 3 of the volume of the above components) by vortexing, and dispense into eight-tube strips as samples to be lyophilized.

[0062] (2) Pre-freezing

[0063] Place the sample to be freeze-dried in a vacuum freeze dryer, set the drying chamber temperature to -50℃, and freeze for 5 hours;

[0064] (3) Initial drying

[0065] The temperature of the partition of the vacuum freeze-drying oven was set to -25℃. The frozen sample to be freeze-dried was dried for 18 hours under a vacuum of 0.03 mbar.

[0066] (4) Dry again

[0067] Adjust the vacuum level to 0.01 mbar, set the temperature of the partition of the vacuum freeze dryer to 20°C, and dry for 4 hours to obtain the lyophilized preparation of the qPCR premix.

[0068] After lyophilization, the lyophilized formulation of the qPCR premix is ​​a white powder (e.g. Figure 1 As shown in the figure, the lyophilized formulation can be rapidly reconstituted in just 2–3 seconds, resulting in a clear and transparent solution. Even after 22 months of storage at room temperature, the lyophilized formulation still maintains excellent detection performance.

[0069] Experiment 1: Stability Comparison of Lyophilized qPCR Fully Premixed Reagents

[0070] This experiment tested the stability of the lyophilized qPCR premix after lyophilization using the lyophilization protectant and lyophilization method described in Example 1, and the lyophilized formulations stored for different time periods. The qPCR premix consisted of 2.5 mg / mL. 2+ 0.2 mM dNTP, 10× PCR buffer, reverse transcriptase, DNA polymerase (add according to manufacturer's instructions), 2019-nCoV detection primers (100 nmol / L), 2019-nCoV detection probes (100 nmol / L).

[0071] The 2019-nCoV detection primers and probes were selected from the open reading frame (ORF1ab) and nucleoprotein (N) gene regions of the novel coronavirus. They were synthesized by Sangon Biotech (Shanghai), and the specific sequences are as follows:

[0072] Target 1 (ORF1ab):

[0073] Forward primer (F): CCCTGTGGGTTTTACACTTAA (SEQ ID NO.1)

[0074] Reverse primer (R): ACGATTGTGCATCAGCTGA (SEQ ID NO.2)

[0075] Fluorescent probe (P):

[0076] 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'(SEQ ID NO.3)

[0077] Target 2(N):

[0078] Forward primer (F): GGGGAACTTCTCCTGCTAGAAT (SEQ ID NO.4)

[0079] Reverse primer (R): CAGACATTTTGCTCTCAAGCTG (SEQ ID NO.5)

[0080] Fluorescent probe (P):

[0081] 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'(SEQ ID NO.6)

[0082] I. Test Subjects

[0083] Type A: Freshly prepared lyophilized qPCR premix

[0084] Product B: Lyophilized qPCR premix stored at room temperature for 1 month

[0085] Size C: Lyophilized qPCR premix stored at room temperature for 10 months

[0086] D: Lyophilized qPCR premix stored at room temperature for 22 months

[0087] II. Test Methods

[0088] Nucleic acid was extracted from two 2019-nCoV SARS-CoV-2 samples (derived from ATCC and synthetic pseudoviruses) using a nucleic acid extraction and purification kit manufactured by Guangzhou Meiji Biotechnology Co., Ltd., namely Sample 1 (10000 copies / mL) and Sample 2 (500 copies / mL). Sample 1 and Sample 2 were then tested using four types of lyophilized qPCR premixes (A, B, C, and D) as described above. The reaction procedures are as follows:

[0089] 1 50℃ 10min 1 —— 2 95℃ 2min 1 —— 3 95℃ 5s 40 —— 4 60℃ 32s FAM, VIC, Cy5

[0090] III. Test Results

[0091] The fluorescence PCR amplification curves of sample 1 were detected using four lyophilized qPCR premixes (A, B, C, and D), as shown below. Figures 2-5 As shown; the fluorescence PCR amplification curves of sample 2 were detected using four types of lyophilized qPCR premixes, A, B, C, and D, respectively. Figures 6-9 As shown.

[0092] The results showed that the freeze-dried qPCR premixed solution, after being stored at room temperature for 1 month, 10 months, and 22 months, was comparable to the freshly prepared premixed solution in terms of performance. It was able to detect targets containing samples 1 and 2, and the sensitivity could reach 500 copies / mL.

[0093] This experimental example demonstrates that, using the lyophilization protectant and lyophilization method of this invention, the fully premixed solution obtained by lyophilization retains its normal appearance and stable detection performance after 22 months of storage at room temperature. It is suitable for long-distance transportation at room temperature, shortening operator usage time and avoiding errors during preparation and dispensing. Compared to commercially available molecular diagnostic lyophilized products (National Medical Device Registration Certificate 20223401469), which have a shelf life of 6 months and require storage at 2-8°C, this product offers significant advantages in terms of storage conditions and time.

[0094] Example 2: Screening of lyophilization protectant components and concentrations for qPCR premixed solutions

[0095] This experiment tested the effects of different formulations and concentrations of lyophilization protectants on the morphology and properties of lyophilized qPCR premixes.

[0096] Using different lyophilization protectant formulations as shown in Table 1, the qPCR premix of Experiment 1 was lyophilized, and then Sample 1 was amplified using the amplification method of Experiment 1. The properties of the lyophilized reagents are shown in Table 1.

[0097] Table 1

[0098] 1 5% Fibrobiose normal Decreased amplification performance 2 10% Fibrobiose normal Decreased amplification performance 3 0.1% BSA Unformed Amplification performance was unqualified. 4 0.001% BSA Unformed Amplification performance was unqualified. 5 5% Cellobiose + 0.1% BSA normal Decreased amplification performance 6 5% Cellobiose + 0.001% BSA normal Amplification performance and acceleration performance are both satisfactory. 7 10% Cellobiose + 0.1% BSA normal Decreased amplification performance 8 10% Cellobiose + 0.001% BSA normal Amplification performance is acceptable, but acceleration performance is declining. 9 5% Trehalose + 0.1% BSA normal Decreased amplification performance 10 5% Trehalose + 0.001% BSA normal Amplification performance is acceptable, but acceleration performance is declining.

[0099] As shown in Table 1, the protectants containing only cellobiose components (numbers 1 and 2) retained their normal lyophilized form after freeze-drying, but their amplification performance decreased. Figure 10 Protectants containing only BSA (numbers 3 and 4) failed to solidify after lyophilization, resulting in substandard amplification performance. Figure 11 The cryoprotectants containing cellobiose and BSA exhibited good lyophilized forms after lyophilization (numbers 5-8), but when the BSA concentration was too high (0.1%) (numbers 5 and 7), the amplification performance decreased. Figure 12 and Figure 13 When the BSA concentration was 0.001%, the amplification performance was satisfactory; when the cellobiose concentration was 5%, the acceleration performance was satisfactory. Figure 14 When the concentration of cellobiose was 10%, the acceleration performance showed a decreasing trend. Figure 15 (The accelerated aging reference formula is TIMETI=TIMERT / Q10^(T1–TRT) / 10, which achieves the purpose of accelerated aging by changing the storage temperature.)

[0100] Besides cellobiose and BSA, the inventors also tried adding sucrose, mannitol, glycine, and other protective agents and excipients, and using other lyophilization protectants. After lyophilization, these products exhibited a normal lyophilized form, but their amplification performance and accelerated reagent performance were inferior to those of the cellobiose and BSA combination. For example, using 5% trehalose + 0.1% BSA (serial number 9) in Table 1 resulted in a decrease in amplification performance. Figure 16 ), 5% trehalose + 0.001% BSA (serial number 10) accelerates performance decline ( Figure 17 ).

[0101] The results of this experiment show that the optimal combination of freeze-drying protectants is 4.8wt%–5.2wt% cellobiose and 0.002wt%–0.003wt% BSA. After freeze-drying, the samples have a good freeze-dried morphology, and the samples can be detected in the amplification experiment. The performance can be stabilized after 2 months of accelerated freezing.

[0102] Experiment 3: Optimization of the lyophilization method for qPCR premixed solution

[0103] The qPCR premix was lyophilized using the lyophilization protectant and method described in Example 1. The conditions for the initial and secondary drying steps are shown in Table 2, and the lyophilized forms are shown in Table 2. Figures 18-19 As shown.

[0104] Table 2

[0105] 1 0.3 mbar, 20 h 0.01 mbar, 2h It did not have a complete shape and was in the form of loose powder. 2 0.03mbar20h 0.01 mbar, 2h Freeze-dried products retain their shape and remain firm. 3 0.3 mbar, 20 h 0.01 mbar, 4h It did not have a complete shape and was in the form of loose powder. 4 0.03mbar20h 0.01 mbar, 4h Freeze-dried products retain their shape and remain firm.

[0106] From Table 2 and Figures 18-19 It can be seen that when the vacuum degree of the initial drying is 0.3 mbar (the vacuum degree setting for the main drying in current mainstream freeze-drying processes), the freeze-dried product does not have a complete shape and appears as loose powder. Figure 18 When the initial drying vacuum degree is 0.03 mbar, a slower sublimation rate is maintained under lower vacuum pressure, thus preserving a better freeze-dried form and ensuring the freeze-dried shape remains intact. Figure 19 Furthermore, freeze-drying can be completed in a relatively short time (the freeze-drying effect is the same for 2 hours and 4 hours of re-drying), and the freeze-dried shape is better.

[0107] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0108] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A lyophilization protectant for qPCR premixed solution, characterized in that, The freeze-drying protectant includes cellobiose and BSA, wherein the mass concentration of cellobiose is 3 wt% to 8 wt% and the mass concentration of BSA is 0.001 wt% to 0.004 wt%.

2. The lyophilization protectant for the qPCR premixed solution according to claim 1, characterized in that, The cellobiose has a mass concentration of 4 wt% to 6 wt%, and the BSA has a mass concentration of 0.002 wt% to 0.003 wt%.

3. The lyophilization protectant for the qPCR premixed solution according to claim 2, characterized in that, The cellobiose has a mass concentration of 4.8 wt% to 5.2 wt%, and the BSA has a mass concentration of 0.002 wt% to 0.003 wt%.

4. A method for preparing a lyophilization protectant for the qPCR premix according to any one of claims 1 to 3, characterized in that, The steps include: dissolving cellobiose and BSA in distilled water to the desired mass concentration.

5. The use of the lyophilization protectant of the qPCR premix according to any one of claims 1 to 3 in the lyophilized qPCR premix.

6. A method for lyophilizing a complete qPCR premix, characterized in that, Includes the following steps: (1) Pretreatment: Prepare PCR buffer, primers, probes, and Mg2+. 2+ The reverse transcriptase, DNA polymerase, dNTPs, and the freeze-drying protectant described in any one of claims 1 to 3 are mixed together to form the sample to be freeze-dried. (2) Pre-freezing: Freeze the sample to be freeze-dried at -82℃~-78℃ for 2h~3h; or freeze the sample to be freeze-dried at -55℃~-45℃ in a vacuum for 4h~6h. (3) Initial drying: Drying at -27℃~-23℃ under vacuum of 0.02mbar~0.04mbar for 16h~20h; (4) Drying again: Adjust the vacuum degree to 0.005mbar~0.015mbar, 18℃~22℃, and dry for 2h~6h.

7. The method for lyophilizing qPCR premix according to claim 6, characterized in that, In step (2), the sample to be freeze-dried is frozen at -81℃ to -79℃ for 2.4h to 2.6h, or at -52℃ to -48℃ for 4.5h to 5.5h.

8. The method for lyophilizing qPCR premix according to claim 6, characterized in that, In step (3), the vacuum degree is 0.025 mbar to 0.035 mbar, the drying temperature is -26℃ to -24℃, and the drying time is 17h to 19h.

9. The method for lyophilizing qPCR premix according to claim 6, characterized in that, In step (4), the vacuum degree is 0.008 mbar to 0.012 mbar, the drying temperature is 19°C to 21°C, and the drying time is 3h to 5h.

10. The qPCR premix obtained by freeze-drying according to any one of claims 6 to 9.

Images